Kluyveromyces marxianus inm3114, preparation and use thereof
Bread made by fermenting grape juice with Max Kluwer yeast INM3114 solves the problems of flavor and hardness during bread storage, maintains anthocyanin stability, and improves the sensory quality and anti-aging ability of bread.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- ZHEJIANG INM FOOD CO LTD
- Filing Date
- 2024-09-23
- Publication Date
- 2026-07-31
AI Technical Summary
Existing technologies have problems such as flavor degradation, poor taste, and increased hardness during bread storage. Furthermore, anthocyanins have poor stability after high-temperature cooking, which affects product acceptance.
Grape juice is fermented using Max Kluwer yeast INM3114 to create a low pH environment, which is then added to the dough. After fermentation, the bread is made, maintaining the stability of anthocyanins and producing the flavor compound trans-2-hexenal, thus enhancing the flavor and texture of the bread.
It effectively retains the anthocyanin content in bread, keeps it soft and moist, balances flavor and function, and enhances the sensory quality and anti-aging ability of bread.
Smart Images

Figure CN119320704B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of industrial microbial technology and relates to a strain of Kluyveromyces martensii INM3114 and its preparation and application. Background Technology
[0002] During storage, bread undergoes a series of physicochemical changes, leading to a decline in quality, primarily manifested as a loss of flavor and a deterioration in texture. This series of changes is a complex process involving multiple factors such as moisture loss, aging, microbial contamination, and oxidation.
[0003] The aroma of bread primarily depends on the characteristics and quantity of volatile and non-volatile substances produced during processing. During storage, factors such as microbial contamination, oxidation, and moisture loss can negatively impact flavor. Starch retrogradation is a key factor in bread staling. During the cooling process, amylose initially gelles and retrogrades, mainly affecting the firmness of fresh bread. As storage time increases, amylopectin retrogrades and forms recrystallized structures, leading to hardening of the bread texture and a deterioration in quality.
[0004] Kluyveromyces marxianus is widely found in nature and is listed in the European Food Additives Register as a food-grade yeast. The high sugar and low pH characteristics of grape juice provide excellent conditions for yeast growth and reproduction. Through long-term natural selection and evolution, a group of superior wild yeast resources adapted to environmental conditions and grape varieties have gradually formed and attached to the grape skin. During fermentation, yeast can produce various aromatic substances, giving the product a unique flavor; it can also produce various enzymes, vitamins, and other active ingredients, enriching the product's nutritional and probiotic properties.
[0005] Grapes are rich in anthocyanins, mostly in the form of glycosides, also known as anthocyanins. Anthocyanins can effectively delay bread staling. The basic structure of anthocyanins is 3,5,7-trihydroxy-2-phenylbenzopyran. Due to differences in the number and position of substituents, hydroxyl groups, and methoxy groups at the R1 and R2 positions of the B ring, six main anthocyanins are produced: pelargonidin, cyanidin, delphinidin, paeoniflorin, malvidin, and petunidin. In Eurasian grapes, the free anthocyanins in grapes are usually in the form of 3-O-monosaccharide anthocyanins, with the sugar group mostly being glucose. These sugar groups can only bind to the C3 position on the ring, generally existing as malvidin-3-O-glucoside, petunidin-3-O-glucoside, delphinidin-3-O-glucoside, and paeoniflorin-3-O-glucoside, but not pelargonidin.
[0006] trans-2-hexenal, also known as cyanaldehyde, is an organic compound. Its molecular formula is C6H2O.10 O, molecular weight 98.143, density 0.8±0.1 g / cm³ 3 A colorless, oily liquid, insoluble in water but soluble in organic solvents such as ethanol. It has a rich, fresh fruit and green leaf aroma and is naturally found in citronella oil, camphor oil, as well as tea leaves, mulberry leaves, and fruits such as grapes, apples, and strawberries.
[0007] Currently, research on the application of anthocyanins in bread is diverse. Patent: A method for producing colored wheat fermented flour products with high-stability anthocyanins - CN 116530645 A. This invention discloses a method using colored whole wheat flour as the main raw material, utilizing a mixed fermentation of yeast and lactobacillus to produce acid, while simultaneously adding soybean protein hydrolysate, which significantly improves the stability of anthocyanins and preserves their activity. It does not involve fermentation methods to enhance flavor. Patent: A micro-reaction system for synthesizing trans-2-hexenal - CN 111359560 A. This invention discloses a micro-reaction system for synthesizing trans-2-hexenal, but does not involve its application in flour products. Patent: A genetically engineered bacterium, its preparation method, and its application in anthocyanin synthesis - CN118222600 A. This invention discloses a genetically engineered bacterium, its preparation method, and its application in anthocyanin synthesis, an expression vector backbone, and a grape-derived colorless anthocyanin dioxygenase gene and an Arabidopsis-derived 3-O-glucosidase gene linked to the expression vector backbone. It does not cover the application of anthocyanins in flour products.
[0008] The above patents focus on product functionality, involving fermentation strains, the stabilizing effect of protein in anthocyanins in wheat products, the biosynthesis of anthocyanins, and a reactor system for the preparation of trans-2-hexenal. However, they overlook the significant impact of flavor on food acceptability. In particular, while lactic acid bacteria production has a certain stabilizing effect on anthocyanins, organic acids strongly influence the overall flavor structure of the product. Therefore, in product development, a strategy that considers both flavor and functionality will better cater to the market.
[0009] Studies have shown that anthocyanins possess powerful antioxidant and free radical scavenging abilities, but very little remains after high-temperature cooking. 1) While soy protein can stabilize anthocyanins, in practical applications, it often carries a genetically modified (GM) connotation. 2) Lactic acid bacteria secrete acidic substances, creating a low pH environment in the food system. While stabilizing anthocyanins, this also produces a sour taste, affecting the product's flavor profile. 3) The addition of whole grains rich in anthocyanins, such as black rice, results in a coarse texture, affecting the taste. All of these factors directly impact consumer acceptance of the product. Therefore, it is necessary to develop a strain that can stabilize anthocyanins while simultaneously harmonizing the flavor profile. Summary of the Invention
[0010] To address the above problems, this invention provides a strain of Kluyveromyces martensii INM3114, its preparation, and its application. This strain ferments grape juice to create a low-pH environment; it contains abundant and stable anthocyanins; when added to dough as an ingredient, it has no adverse effect on gluten formation; the bread prepared from this strain remains soft and moist during storage, without any irritating sour taste, and the anthocyanin content remains stable; it does not affect the internal structure of the product and achieves a perfect combination of functionality and sensory appeal.
[0011] The invention aims to achieve the following: a strain of Kluyveromyces marxianus INM3114, which was deposited on August 21, 2024, at the Guangdong Provincial Center for Microbial Culture Collection, accession number GDMCC NO:65037, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Province.
[0012] Furthermore, the colony characteristics of Kluyveromyces marxianus are as follows: after culturing on PDA plates for 2–3 days, it forms white, oval colonies with a diameter of 1.0–5.0 mm, smooth and moist surface, and regular, raised edges.
[0013] A method for preparing Kluyveromyces martensii.
[0014] Step 1: Isolation of Kluyveromyces marxianus:
[0015] Kluyveromyces marxianus was isolated and screened from raisin samples:
[0016] First, juice the raisins and incubate them in a 28°C incubator. Then, dilute the fermentation broth by 10%. 1 -10 7 Different dilutions of the fermentation broth were evenly spread on PDA medium and incubated at 28°C for 48 hours. White colonies were then selected from the PDA medium for screening.
[0017] Step 2: Cultivation of Kluyveromyces marxianus:
[0018] The obtained Kluyveromyces marxianus was cultured to the logarithmic growth phase, with a final strain concentration of 1×10⁻⁶. 7 The concentration of CFU / mL was then inoculated into grape juice at a rate of 1%, and the mixture was placed in a 28°C incubator and incubated for 48 hours to obtain the fermentation broth.
[0019] An application of Kluyveromyces martensii to increase the trans-2-hexenal content in grape juice after fermentation.
[0020] An application of a type of Max Kluwer yeast that effectively retains the anthocyanin content of bread after baking and improves the bread's anti-aging ability.
[0021] An application of the Max Kluwer yeast according to claim 1, in production: according to the ordinary bread making process, add fermentation liquid that has been fermented by Max Kluwer for 48 hours, the amount added is 50g / kg flour.
[0022] An application of Max Kluwer yeast in bread making.
[0023] An application of Max Kluwer yeast in the production of dinner rolls.
[0024] An application of Max Kluwer yeast in making toast.
[0025] An application of Max Kluwer yeast in the making of European bread.
[0026] Advantages of the present invention: (1) Kluyveromyces marxianus described in the present invention has the ability to produce the flavor compound trans-2-hexenal, which can effectively increase the trans-2-hexenal content after grape juice fermentation, making the flavor of baked goods more intense.
[0027] (2) The Kluyveromyces marxianus described in this invention can effectively retain the anthocyanin content of bread after baking, making the nutritional components of baked goods more stable.
[0028] (3) The Kluyveromyces marxianus described in this invention has the characteristics of improving the aroma and taste of the product and reducing the hardness of bread during storage. Attached Figure Description
[0029] Figure 1 10 7 Total ion chromatogram of trans-2-hexenal in bread making at the inoculation concentration.
[0030] Figure 2 This is a morphological diagram of Kluyveromyces marxianus culture medium.
[0031] Figure 3 Gram-stained microscopic image of Kluyveromyces marxianus. Detailed Implementation
[0032] The present invention will be further described below with reference to specific embodiments:
[0033] Unless otherwise specified, the experimental methods used in the following implementation examples are all conventional methods; the materials and reagents used are all commercially available unless otherwise specified.
[0034] Example 1, see attached document Figure 1-3 A strain of Kluyveromyces marxianus, INM3114, was deposited on August 21, 2024, at the Guangdong Provincial Center for Microbial Culture Collection, accession number GDMCC NO:65037, address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Province.
[0035] The colony characteristics of a strain of Kluyveromyces marxianus are as follows: after culturing on a PDA plate for 2-3 days, it forms white, oval colonies with a diameter of 1.0-5.0 mm, smooth and moist surface, and regular, raised edges.
[0036] A method for preparing Kluyveromyces martensii.
[0037] Step 1: Isolation of Kluyveromyces marxianus:
[0038] Kluyveromyces marxianus was isolated and screened from raisin samples:
[0039] First, juice the raisins and incubate them in a 28°C incubator. Then, dilute the fermentation broth by 10%. 1 -10 7 Different dilutions of the fermentation broth were evenly spread on PDA medium and incubated at 28°C for 48 hours. White colonies were then selected from the PDA medium for screening.
[0040] Step 2: Cultivation of Kluyveromyces marxianus:
[0041] The obtained Kluyveromyces marxianus was cultured to the logarithmic growth phase, with a final strain concentration of 1×10⁻⁶. 7 The concentration of CFU / mL was then inoculated into grape juice at a rate of 1%, and the mixture was placed in a 28°C incubator and incubated for 48 hours to obtain the fermentation broth.
[0042] An application of Kluyveromyces martensii to increase the trans-2-hexenal content in grape juice after fermentation.
[0043] An application of a type of Max Kluwer yeast that effectively retains the anthocyanin content of bread after baking and improves the bread's anti-aging ability.
[0044] An application of the Max Kluwer yeast according to claim 1, in production: according to the ordinary bread making process, add fermentation liquid that has been fermented by Max Kluwer for 48 hours, the amount added is 50g / kg flour.
[0045] 1. Raw material processing
[0046] Take 10g of raisins, wash off any surface dust, add them to 100g of grape juice, and let them ferment at 28℃ for 48 hours. Dilute the fermentation liquid by 10%. 1 -10 7 The bacterial suspension was evenly spread on PDA medium and the colony morphology was observed. Colonies with different morphologies were picked out and further isolated and purified on PDA, and numbered PDA1-PDA15.
[0047] 2. Preliminary screening of bacterial strains
[0048] The 15 bacterial strains were inoculated into malt extract medium at a 1% inoculum concentration and cultured at 28°C for 48 hours. The final bacterial cell density reached 10⁻⁶. 7 CFU / mL. Take 1 mL of bacterial culture from each tube and inoculate it into 100 mL of grape juice. After incubation at 28°C for 48 h, centrifuge at 8000 r / min for 10 min. The supernatant obtained is the sample, and its physicochemical properties are tested. The results are shown in Table 1.
[0049] Anthocyanin content: Microplate method using a plant anthocyanin detection kit.
[0050] Trans-2-Hexenal content: Extraction was performed using a 50 / 30µm DVB / CAR / PDMS Stableflex solid-phase microextraction head. 5g of sample was placed in a 30mL headspace vial and extracted in a 60℃ water bath for 40min. Gas chromatography-mass spectrometry (GC-MS) was used for detection with an HP-Innowax (30m×250μm, 0.25μm) capillary column. GC conditions were: helium as carrier gas, carrier gas flow rate set to 1mL / min, splitless injection, and injection port temperature of 250℃. MS conditions were: ion source temperature 230℃, MS quadrupole temperature 150℃, electron energy 70eV, mass spectrometry scan range 45–500, and full scan mode. The column oven temperature program was: 50℃ for 1min, increased to 160℃ at 4℃ / min, then increased to 250℃ at 10℃ / min and held for 2min. Compounds were identified using a mass spectrometry database method. Each peak was compared to the NIST Library mass spectrometry database using a computer, and a match score greater than 800 was used as the qualitative criterion. Internal standard quantification method: A certain amount of trans-2-hexenal standard was accurately added to an ethanol solution, and the trans-2-hexenal content was calculated based on the peak area ratio.
[0051] Hardness testing method: A flat-bottomed cylindrical probe P / 36R was used. The test conditions were determined as follows: pre-test speed: 1 mm / s; test speed: 1 mm / s; post-test speed: 3 mm / s; compression degree: 50%; dwell interval: 5 s; trigger value: 5 g. Each test was repeated 5 times.
[0052] Table 1. Analysis of anthocyanins and trans-2-hexenal produced during fermentation.
[0053]
[0054] Strains PDA3, PDA6, and PDA13, which had low pH and high levels of anthocyanins and trans-2-hexenal, were selected for secondary screening.
[0055] 3. Secondary screening of strains
[0056] The three yeast strains PDA3, PDA6, and PDA13 selected in the initial screening were reactivated and cultured until the cell concentration reached 10⁻⁶. 7 At a concentration of CFU / mL, 1% of the starter culture was inoculated into grape juice and fermented at 28°C for 48 hours. The fermented grape juice was then added to the starter culture at 10% of the total wheat content. Bread was made according to the national standard GB / T14612-2008, and sensory evaluation and hardness testing were conducted. The results are shown in Table 2.
[0057] Table 2 Sensory analysis and hardness of fermented bread
[0058] PDA3 5.0 4.5 4.75 305.584±14.256 PDA6 4.5 4.5 4.5 352.135±15.036 PDA13 4.5 4.5 4.5 369.411±14.833
[0059] Note: The lower the hardness, the softer the bread, and the better the anti-aging effect of the starter culture.
[0060] As shown in Table 2, bread made with PDA3 had the highest average sensory score and the lowest bread hardness score. As the target strain, the morphological observation of this strain on PDA plates is as follows: Figure 2 As shown, the colonies are 1.0–5.0 mm in diameter, white, oval, with a smooth, moist, raised surface and regular edges. Gram staining followed by microscopic observation yields the following results: Figure 3 As shown.
[0061] The PDA3 strain obtained from the above screening was identified by 16S rDNA sequencing. Comparative analysis showed that the 16S region sequence of the strain obtained in this invention had 100% similarity to *Kluyveromyces marxianus*, confirming that this strain is indeed *Kluyveromyces marxianus* and can be used in the food fermentation industry. It was named *Kluyveromyces marxianus* INM3114. This strain was deposited on August 21, 2024, at the Guangdong Provincial Microbial Culture Collection Center, accession number GDMCC NO:65037, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Province. Therefore, in this application, *Kluyveromyces marxianus* INM3114 and PDA3 refer to the same strain. The gene sequence of the PDA3 strain of this invention is as follows:
[0062] TGTGTTGCATATCCAAAAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAG
[0063] TGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGA
[0064] GGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAA
[0065] TCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAA
[0066] TGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGA
[0067] ACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATT
[0068] GTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCTGCTCCTTGTGGGTAGG
[0069] GGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTGGTGGCAGGATAAATCCATAGGAATGTA
[0070] GCTTGCCTCGGTAAGTATTATAGCCTGTGGGAATACTGCCAGCTGGGACTGAGGACTGCGACG
[0071] TAAGTCAAGGATGCTGGCATAATGGTTATATGCCGCCCGTCTTGAACACACCGGACCCA
[0072] Example 2, Genetic stability assay of Kluyveromyces marxianus INM3114:
[0073] The Kluyveromyces marxianus INM3114 strain from Example 1 was passaged 10 times on malt extract broth. The 1st, 5th, and 10th generation strains were then cultured at a concentration of 10... 7 CFU / mL, 1% inoculum was added to grape juice and fermented at 28℃ for 48 hours. The fermented grape juice was then added to the starter culture at 10% of the total wheat content. Bread was made according to national standard GB / T14612-2008, and its physicochemical properties were tested, including anthocyanin content, trans-2-hexenal content, and bread hardness, using the method described in Example 1. Sensory evaluation was also performed to determine its passage stability; specific data are shown in Table 3.
[0074] Table 3. Results of the passaging stability test
[0075]
[0076] Table 3 shows that the fermentation performance of Kluyveromyces marxianus INM3114 strains of different generations was normal, and the content of trans-2-hexenal and anthocyanins varied within 10%, indicating good genetic stability of the strains, which meets the requirements for production and use.
[0077] Example 3: Anthocyanin-rich bread made with Kluyveromyces marxianus INM3114;
[0078] Kluyveromyces marxianus INM3114 was inoculated at a concentration of 10... 4 -10 8 CFU / mL was inoculated into grape juice at a 1% inoculum and fermented at 28℃ for 48 hours. The fermented grape juice was then added to the starter culture at 10% of the total wheat content. Bread was made according to national standard GB / T 14612-2008, and its physicochemical properties were tested, including anthocyanin content, trans-2-hexenal content, and bread hardness. The method was the same as in Example 1. PDA9 was used as a control strain. The results are shown in Tables 4 and 5.
[0079] Table 4. Anthocyanin and trans-2-hexenal content in bread
[0080]
[0081]
[0082] Table 5 Sensory evaluation results of bread
[0083] Control group 1 <![CDATA[1.0×10 4 ]]> 4.5 4.5 4.6 13.6 564.706±12.467 Experimental group 1 <![CDATA[1.0×10 4 ]]> 6.2 6.3 6.2 18.7 343.336±13.081 Control group 2 <![CDATA[1.0×10 5 ]]> 4.3 4.6 4.4 13.3 565.698±11.958 Experimental Group 2 <![CDATA[1.0×10 5 ]]> 7.5 7.1 7.6 22.2 334.568±13.211 Control group 3 <![CDATA[1.0×10 6 ]]> 4.3 4.4 4.7 13.4 568.686±13.431 Experimental group 3 <![CDATA[1.0×10 6 ]]> 7.5 7.8 7.6 22.9 321.268±12.893 Control group 4 <![CDATA[1.0×10 7 ]]> 4.5 4.4 4.5 13.4 563.670±12.633 Experimental group 4 <![CDATA[1.0×10 7 ]]> 8.8 8.9 8.8 26.5 302.538±14.041 Control group 5 <![CDATA[1.0×10 8 ]]> 4.5 4.3 4.3 13.1 566.650±11.976 Experimental group 5 <![CDATA[1.0×10 8 ]]> 6.3 6.5 6.6 19.4 345.533±13.458
[0084] Note: Each assessment item is worth 10 points, with a scoring interval of 0.1. The overall score is the sum of all scores.
[0085] As shown in Tables 4 and 5, fermentation with Kluyveromyces marxianus INM3114 significantly increases the content of trans-2-hexenal and anthocyanins in bread, and the higher the inoculum size, the higher the content of trans-2-hexenal and anthocyanins. However, excessively high or low inoculum concentrations of Kluyveromyces marxianus INM3114 affect the sourness, sweetness, and texture of the bread. The optimal inoculum concentration is 1.0 × 10⁻⁶. 7 CFU / mL, this concentration is sufficient to produce enough anthocyanins while also enhancing the flavor and texture of whole-grain bread, such as Figure 1 , is the total ion chromatogram of trans-2-hexenal used in bread making at this inoculation concentration.
[0086] Example 4: Making toast with Kluyveromyces marxianus INM3114;
[0087] Kluyveromyces marxianus INM3114 was inoculated at a concentration of 10... 7 CFU / mL was inoculated into grape juice at a 1% inoculum and fermented at 28°C for 48 hours. The fermented grape juice was then added to the starter culture at 10% of the total wheat content. Toast was prepared according to national standard GB / T 14612-2008. PDA9 served as a control group, and toast was prepared in the same manner. After fermentation, the trans-2-hexenal, anthocyanin content, and hardness were measured after 1, 4, and 7 days of storage using the method described in Example 1. A professional evaluator also conducted a sensory evaluation of the toast's flavor, and the results are recorded in Table 6.
[0088] Table 6. Results of anthocyanin and trans-2-hexenal detection and sensory evaluation of toast.
[0089]
[0090]
[0091] Note: Each sensory evaluation item is worth 10 points, with a scoring interval of 0.1. The overall score is the sum of all items.
[0092] As shown in Table 6, after 10 days of vaccination... 7 Using CFU / mL Kluyveromyces marxianus INM3114 to make toast can significantly increase the content of trans-2-hexenal and anthocyanins in the toast. In addition, it can improve the sensory evaluation of the toast, increase the aroma, enhance the flavor and texture of the toast, and make the toast fragrant and sweet and sour.
[0093] Example 5: Preparation of meal packs using Kluyveromyces marxianus INM3114
[0094] Kluyveromyces marxianus INM3114 was inoculated at a concentration of 10... 7 CFU / mL was inoculated into grape juice at a 1% inoculum and fermented at 28°C for 48 hours. The fermented grape juice was then added to the starter culture at 10% of the total wheat content. Bread rolls were prepared according to national standard GB / T 14612-2008. PDA9 served as a control group, and bread rolls were prepared in the same manner. After fermentation, the content of trans-2-hexenal and anthocyanins, as well as the firmness, were measured after 1, 4, and 7 days of storage, as described in Example 1. A professional evaluator also conducted a sensory evaluation of the bread rolls' flavor. The results are recorded in Table 7.
[0095] Table 7. Results of anthocyanin and trans-2-hexenal detection and sensory evaluation of the dinner rolls.
[0096]
[0097]
[0098] Note: Each sensory evaluation item is worth 10 points, with a scoring interval of 0.1. The overall score is the sum of all items.
[0099] As shown in Table 7, after 10 days of vaccination... 7 Using CFU / mL Kluyveromyces marxianus INM3114 to make dinner rolls significantly increased the content of trans-2-hexenal and anthocyanins in the fermented dough; it also improved the sensory evaluation of the dinner rolls, increased aroma, and enhanced flavor and texture. Example 6: Making European-style bread with Kluyveromyces marxianus INM3114
[0100] Kluyveromyces marxianus INM3114 was inoculated at a concentration of 10... 7 CFU / mL was inoculated into grape juice at a 1% inoculum and fermented at 28°C for 48 hours. The fermented grape juice was then added to the starter culture at 10% of the total wheat content. European-style bread was prepared according to national standard GB / T 14612-2008. PDA9 served as a control group, and European-style bread was prepared in the same manner. After fermentation, the trans-2-hexenal, anthocyanin content, and firmness were measured after 1, 4, and 7 days of storage, as described in Example 1. A professional evaluator also conducted a sensory evaluation of the bread's flavor, and the results are recorded in Table 8.
[0101] Table 8. Results of anthocyanin and trans-2-hexenal detection and sensory evaluation of European bread.
[0102]
[0103]
[0104] Note: Each sensory evaluation item is worth 10 points, with a scoring interval of 0.1. The overall score is the sum of all items.
[0105] As shown in Table 8, the results indicate that after 10 days of vaccination... 7 Using CFU / mL Kluyveromyces marxianus INM3114 to make European-style bread can significantly increase the content of anthocyanins and trans-2-hexenal; in addition, it can also improve the flavor and texture of European-style bread.
[0106] Based on the results of the above embodiments, the Kluyveromyces marxianus INM3114 provided by the present invention, when applied to the production of toast, dinner rolls, and European bread, can significantly increase the anthocyanin and trans-2-hexenal content of the relevant products without changing the existing process. At the same time, it can also improve the aroma and taste of the products, and significantly improve the product quality.
[0107] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, which fall within the scope of protection of the present invention. Therefore, the scope of protection of this invention patent should be determined by the appended claims.
Claims
1. A strain of Kluyveromyces macrocephala, characterized by: Saccharomyces marxianus (ATCC® 8233®) Kluyveromyces marxianus ) INM3114, which was deposited on August 21, 2024, at the Guangdong Microbial Culture Collection Center, with the accession number GDMCC NO: 65037, and the address: 59 Building, 5th Floor, Guangzhou, Guangdong, China.
2. The strain of *Kluyveromyces roxburghii* according to claim 1, characterized in that: Max Kluwer yeast ( Kluyveromyces marxianus The colony characteristics of the bacteria are as follows: after culturing on PDA plates for 2-3 days, white, oval, smooth and moist colonies with regular and raised edges are formed with a diameter of 1.0-5.0 mm.
3. An application of the Kluyveromyces macrocephalae according to claim 1 to increase the trans-2-hexenal content in grape juice after fermentation.
4. An application of the Max Kluwer yeast according to claim 1 to effectively retain the anthocyanin content of bread after baking and improve the bread's anti-aging ability.
5. An application of *Kluyveromyces martensii* according to claim 1, characterized in that: Production application: Following the standard bread-making process, add 50g / kg of flour fermented liquid that has been fermented by Max Kluwer for 48 hours.
6. An application of the Max Kluwer yeast according to claim 1 for making bread.
7. An application of the Max Kluwer yeast according to claim 1 for the production of dinner rolls.
8. An application of the Max Kluwer yeast according to claim 1 for making toast.
9. An application of the Kluwer yeast according to claim 1 for the production of European bread.