A linked kasp molecular marker of a wheat stripe disease resistant gene YrBN1 and application thereof

Abstract

The present application relates to a kind of wheat resistance to stripe rust gene YrBN1 Linkage KASP molecular marker and its application, the KASP molecular marker is XK1D-8;The KASP molecular marker is located on the chromosome of wheat 1DS with wheat resistance to stripe rust gene YrBN1, the nucleotide sequence of the XK1D-8 is as shown in SEQ ID NO.1, and nucleotide sequence from 5' end is the 100th base of SNP site, and the polymorphism of this SNP site is C / A respectively.The KASP molecular marker of the present application is closely linked with resistance to stripe rust gene YrBN1, can accurately identify the small wheat stripe disease plant, and it is of great significance to screen wheat germplasm resources resistance to stripe rust gene, wheat resistance to stripe rust material creation or molecular assisted breeding.

Description

Technical Field

[0001] This invention belongs to the field of molecular breeding technology, specifically relating to a linked KASP molecular marker for the wheat stripe rust resistance gene YrBN1 and its application. Background Technology

[0002] Wheat production is frequently threatened by various diseases and pests, among which wheat stripe rust, caused by the fungal pathogen *Puccinia striiformis* Westend. f. sp. *Tritic*, is one of the most important wheat diseases. There are two main methods for controlling wheat stripe rust: chemical fungicides and breeding and planting disease-resistant varieties. Discovering disease-resistant genes and breeding and planting disease-resistant varieties is the most environmentally friendly and effective measure for controlling wheat stripe rust.

[0003] Currently, 86 formally named stripe rust resistance genes (Yr1-86) and numerous provisionally named stripe rust resistance genes have been reported in wheat. Wheat stripe rust resistance genes can be divided into adult-stage resistance (APR) and all-growth-cycle resistance (ASR). All-growth-cycle resistance is effective only against specific physiological or virulence races, also known as race-specific resistance. It is generally a qualitative trait and controlled by a single major gene, effective at all stages of wheat growth. However, due to frequent mutations of stripe rust fungi and the prevalence of new virulence races, many wheat varieties primarily based on a single resistance source lose their resistance after only 3-5 years of use. A large number of disease resistance genes in wheat have lost their resistance to new virulence races. Therefore, it is urgent to discover and utilize the Xinxiang stripe rust resistance source and corresponding molecular markers to further accelerate the process of molecularly assisted breeding for wheat disease resistance.

[0004] Single nucleotide polymorphisms (SNPs) refer to DNA sequence polymorphisms caused by variations in a single nucleotide, mainly including deletions, insertions, transitions, and transversions of single bases. In recent years, with the rapid development of the wheat genome, SNP markers have been widely used. Third-generation KASP (Kompetitive allele-specific PCR) molecular markers based on SNPs are a fluorescence-based homogenotyping technique. Its principle is based on specific matching of primer terminal bases, enabling precise biallelic genotyping of target SNPs and InDels at specific sites. It features extremely high accuracy and transformation rate, low cost, high throughput, and simple and rapid result analysis, playing a crucial role in gene mapping, marker-assisted selection breeding, and germplasm resource identification. Therefore, developing KASP markers closely linked to stripe rust resistance genes is of great significance for rapid screening of rust resistance genes in wheat germplasm resources and marker-assisted selection breeding, which will accelerate the breeding process of new wheat varieties resistant to stripe rust. Summary of the Invention

[0005] The purpose of this invention is to overcome the deficiencies in the prior art and provide a linked KASP molecular marker for the wheat stripe rust resistance gene YrBN1 and its application. The wheat stripe rust resistance gene YrBN1 provides a foundation for breeding superior disease-resistant varieties, while the closely linked KASP molecular marker accurately identifies the stripe rust resistance gene YrBN1, promoting the application of the stripe rust resistance gene YrBN1 in molecular breeding. This is of great significance for the creation of wheat stripe rust resistant materials or molecular marker-assisted selection breeding of wheat stripe rust resistance.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0007] A wheat stripe rust resistance gene, YrBN1, is located on the wheat 1DS chromosome, within the 0-8.2 cM region of the Chinese spring reference genome IWGSC RefSeq v1.0, corresponding to a physical location of 7.92-10.41 Mb.

[0008] As a further technical solution, the IWGSC RefSeq v1.0 genome version of the Chinese Spring reference genome can be obtained from http: / / 202.194.139.32 / download.html.

[0009] A KASP molecular marker linked to the wheat stripe rust resistance gene YrBN1, wherein the KASP molecular marker is XK1D-8; the nucleotide sequence of XK1D-8 is shown in SEQ ID NO.1, and the 100th base from the 5′ end of the nucleotide sequence is an SNP site, and the polymorphism of the SNP site is C / A.

[0010] As a further technical solution, the XK1D-8 gene and the wheat stripe rust resistance gene YrBN1 are co-located on the wheat 1DS chromosome.

[0011] A specific primer set for amplifying the KASP molecular marker includes forward primer XK1D-8-FAM, forward primer XK1D-8-HEX, and a common reverse primer XK1D-8-Common; wherein,

[0012] The nucleotide sequence of the forward primer XK1D-8-FAM is shown in SEQ ID NO.2;

[0013] The nucleotide sequence of the forward primer XK1D-8-HEX is shown in SEQ ID NO.3;

[0014] The nucleotide sequence of the common reverse primer XK1D-8-Common is shown in SEQ ID NO.4.

[0015] A detection kit for the wheat stripe rust gene YrBN1, comprising a specific primer set for the functional KASP molecular marker.

[0016] A method for identifying whether wheat material contains the stripe rust resistance gene YrBN1 includes the following steps: using the genomic DNA of the wheat material to be tested as a template, amplifying it with the specific primer set of the KASP molecular marker described in claim 4, transferring the amplification product to an enzyme-linked immunosorbent assay (ELISA) reader to read the fluorescence data, and determining whether the wheat material to be tested contains the stripe rust resistance gene YrBN1 based on the fluorescence data of the amplification product.

[0017] When the obtained genotype is a homozygous allele with FAM fluorescence or a heterozygous genotype, the wheat material to be tested contains the stripe rust resistance gene YrBN1; when the obtained genotype is a homozygous allele with HEX fluorescence, the wheat material to be tested does not contain the stripe rust resistance gene YrBN1.

[0018] As a further technical solution, in step (2), the PCR amplification reaction system is: DNA 0.2 μg, primer mixture 0.0448 μL, 2×KASPv4.0 Master mix 2 μL, ddH2O 1.9552 μL;

[0019] In the primer mixture, the concentrations of the forward and reverse primers are 12 μM, and the concentration of the shared reverse primer is 30 μM.

[0020] As a further technical solution, in step (2), the PCR amplification reaction program is as follows: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s, 65℃ annealing for 60 s, 10 cycles, with the annealing temperature decreasing by 0.6℃ per cycle; 94℃ denaturation for 20 s, 55℃ annealing for 60 s, 32 cycles.

[0021] The functional KASP molecular marker, the specific primer set, or the detection kit described herein are used in identifying whether wheat materials contain the stripe rust resistance gene YrBN1, detecting wheat stripe rust resistance morphology, screening germplasm resources of the wheat stripe rust resistance gene YrBN1, creating stripe rust resistant wheat materials, or in molecularly assisted breeding of wheat with stripe rust resistance.

[0022] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0023] This invention discovered the wheat stripe rust resistance gene YrBN1 through research and identified a SNP marker closely linked to YrBN1. Based on this SNP marker, a KASP marker closely linked to YrBN1 was developed. The two markers exhibit co-segregation characteristics, enabling accurate identification of the presence of the wheat stripe rust resistance gene YrBN1. This allows for the elimination of susceptible plants during the breeding process, improving breeding efficiency. This invention is of great significance for the creation of wheat stripe rust resistant materials or for molecular marker-assisted selection breeding of wheat stripe rust resistance. Attached Figure Description

[0024] Figure 1 This is the initial mapping result of the wheat stripe rust resistance gene YrBN1 on the 1DS chromosome in Example 1 of the present invention;

[0025] Figure 2 This is the genotyping result of the XK1D-8 marker on the F2 genetic segregating population in Example 3 of the present invention;

[0026] Figure 3 This is the genotype-phenotype association result of the XK1D-8 marker in the F2 population in Example 3 of the present invention. Detailed Implementation

[0027] The technical solution of the present invention will be clearly and completely described below with reference to specific embodiments. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0028] Example 1: Genetic localization of YrBN1 and development of tightly linked KASP molecular markers

[0029] The localization of a wheat stripe rust resistance gene, YrBN1, and the development of a tightly linked KASP molecular marker include the following steps:

[0030] A recombinant inbred line, constructed by crossing the stripe rust-resistant wheat variety Baomai 6 with the stripe rust-susceptible wheat variety Avocet S and then continuously self-pollinating, was used to form an initial genetic mapping population. Phenotypic segregating families were selected from this population as residual heterozygous lines to construct a fine-mapping population. The stripe rust fungus was selected from the CYR32 physiological race. The entire experiment was conducted in a plant artificial climate chamber (incubator). The specific steps were as follows: wheat materials were planted in 10×10×10cm seedling pots, and the planted wheat was placed in an incubator with a light-dark cycle of 16℃ for 16h of light and 10℃ for 8h of darkness, a light intensity of 20000 xl, and a relative humidity of 85%. At the two-leaf stage of wheat, 10 μL of a mixture of stripe rust fungus and fluoride solution (1:1000) was evenly pipetted onto wheat leaves. Inoculated wheat seedlings were sealed in moistened black plastic bags and cultured in the dark at 10°C for 24 hours. They were then transferred to normal culture conditions, with water sprayed every two days to maintain a humid environment. Phenotypic development was recorded after the seedlings had fully developed the disease (approximately 14-16 days). Infection type (IT) evaluation was used for phenotypic identification, with an IT scale of 0-9 (Line and Qayoum 1992). Genomic DNA was extracted from leaves of the parental plant 'Baomai 6', the Avocet S and F2 secondary segregating populations, and the RIL population using the CTAB (Cetyltrimethylammonium bromide) method (Rogers and Bendich 1985, Plant Mol. Biol., 1985, 5:69-76). DNA quality control was performed using the agarose gel electrophoresis method, and DNA quantification was performed using Thermo Fisher Scientific's NanoDrop assay. TM The DNA was measured using a One / OneC ultra-micro UV spectrophotometer. Qualified DNA was sent to Shijiazhuang Borui Technology Co., Ltd. for 16K SNP chip typing, and a genetic map was constructed using IciMapping V4.2.

[0031] Using the Inclusive Composite Interval Mapping-ADD (ICIM-ADD) method in QTL IciMapping V4.2, with a threshold LOD ≥ 2.5, QTLs were detected using the stripe rust seedling resistance phenotype. The wheat stripe rust resistance gene YrBN1 was located, and the genetic distance between YrBN1 and molecular markers was calculated. Initially, YrBN1 was located within a 15.5 cM interval in 1DS using a RIL population, corresponding to a physical location of 0-12.8 Mb in the Chinese Spring Reference Genome 1.0. Subsequently, new molecular markers within the corresponding interval were developed using GBW16K and Wheat660K SNP microarray data. Using a secondary segregating population (population size 464), YrBN1 was finally located within an 8.2 cM interval, corresponding to a physical location of 7.92-10.41 Mb, and co-segregated with the KASP marker XK1D-8. Figure 1 ).

[0032] In this embodiment, the KASP molecular markers were obtained from the GBW16K and Wheat660K SNP microarray data of the parental strains, Bomai 6 and Avocet S. The obtained SNP sites were converted into KASP markers using the Polymarker website and synthesized at Shanghai Sangon Biotech Co., Ltd.

[0033] The KASP molecular marker XK1D-8 was derived from Wheat660K SNP microarray data of the parental strains Boma 6 and Avocet S, and was co-separated with YrBN1. The nucleotide sequence of XK1D-8 is shown in SEQ ID NO.1, and is as follows:

[0034] 5′-TACCTTTGCAAGTACCCATTCGTCTCGAGTTAAAACTTAGAAGAGGCACATTTTT CTGTCGTGGGATCCAATGAACTCGACTAAGCTATTAAAGTTGTG[C / A]TGAATATTATCGT ACAATGTAGGTTATAGTTGGACTCGGGGTCATACAGTGTGTGGATAGAATATGGAGTCAT GTCGTAGTTGGACCTCTTATATATGAG-3′.

[0035] The nucleotide sequence of XK1D-8 has an SNP site at the 100th base from the 5′ end, and the polymorphism of the SNP site is C / A.

[0036] The specific primer set for the KASP molecular marker XK1D-8 includes:

[0037] The forward primer XK1D-8-FAM has the nucleotide sequence shown in SEQ ID NO.2, specifically: 5′-gaaggtgaccaagttcatgcttcgactaagctattaaagttgtgC-3′;

[0038] The forward primer XK1D-8-HEX has the nucleotide sequence shown in SEQ ID NO.3, specifically: 5′-gaaggtcggagtcaacggatttcgactaagctattaaagttgtgA-3′;

[0039] The reverse primer XK1D-8-Common has the nucleotide sequence shown in SEQ ID NO.4, specifically: 5′-actgtatgaccccgagtcca-3′.

[0040] Among them, 5′-gaaggtgaccaagttcatgct-3′ is a universal primer for FAM fluorescence, and the FAM fluorescent group is observed at an excitation wavelength of 485 nm and an emission wavelength of 520 nm; 5′-gaaggtcggagtcaacggatt-3′ is a universal primer for HEX fluorescence, and the HEX fluorescent group is observed at an excitation wavelength of 535 nm and an emission wavelength of 556 nm.

[0041] Example 2: Genotyping method for XK1D-8 (method for identifying whether wheat materials contain the stripe rust resistance gene YrBN1)

[0042] A method for identifying whether wheat materials contain the stripe rust resistance gene YrBN1 includes the following steps:

[0043] Step 1: Synthesize the specific primer set of the KASP molecular marker XK1D-8 described in Example 1, and prepare a primer mixture, wherein the concentration of the forward primer and the reverse primer is 12 μM, and the concentration of the shared reverse primer is 30 μM;

[0044] Step 2: Extract genomic DNA from the wheat material to be tested using the CTAB method as an amplification template;

[0045] Step 3: Using the genomic DNA of the wheat material to be tested as a template, the specific primer set of the KASP molecular marker XK1D-8 obtained in Example 1 was used to perform real-time PCR amplification on the genomic DNA of the wheat material to be tested to obtain the amplification product.

[0046] The reaction system for real-time PCR amplification was as follows: 0.2 μg of genomic DNA from the wheat material to be tested, 2 μL of 2×KASPV4.0 Master mix, 0.0448 μL of primer mixture, and 1.9552 mL of ddH2O.

[0047] In the primer mixture, the concentrations of XK1D-8-FAM and XK1D-8-HEX were both 12 μM, and the concentration of XK1D-8-Common was 30 μM.

[0048] The reaction program for real-time PCR amplification was as follows: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s, 65℃ annealing for 60 s, 10 cycles, with the annealing temperature decreasing by 0.6℃ per cycle; 94℃ denaturation for 20 s, 55℃ annealing for 60 s, 32 cycles.

[0049] Step 3: Transfer the amplification product to a microplate reader to read the fluorescence data, and then import the fluorescence data into KlusterCaller software for analysis to obtain genotype data and obtain the genotype;

[0050] The homozygous allele genotype with HEX fluorescence is “Y:Y”, the homozygous allele genotype with FAM fluorescence is “X:X”, the heterozygous genotype is “X:Y” or “Y:X”, and the deletion genotype is “?”.

[0051] In the KASP marker XK1D-8, if the genotype is "X:X", the wheat material being tested contains the stripe rust resistance gene YrBN1; if the genotype is "Y:Y", the wheat material being tested does not contain the stripe rust resistance gene YrBN1; if the genotype is "X:Y" or "Y:X", the wheat material being tested contains the heterozygous stripe rust resistance gene YrBN1.

[0052] It has been verified that wheat materials with genotypes of "X:X", "X:Y" or "Y:X" are all resistant to stripe rust.

[0053] Example 3: Application of molecular marker XK1D-8 in selecting stripe rust resistance gene YrBN1

[0054] Genotyping of the F2 progeny of Baomai 6 and Avocet S was performed using the KASP molecular marker XK1D-8 described in Example 1 and the method described in Example 2. The results showed that the F2 progeny could be clearly divided into three types, which co-segregated with disease resistance. Figure 2 and Figure 3As shown, if the genotype is "X:X", the wheat material being tested contains the stripe rust resistance gene YrBN1, denoted as A; if the genotype is "Y:Y", the wheat material being tested does not contain the stripe rust resistance gene YrBN1, denoted as B; if the genotype is "X:Y" or "Y:X", the wheat material being tested contains the heterozygous stripe rust resistance gene YrBN1, denoted as H. Based on the XK1D-8 marker genotype, the average IT of plants containing the stripe rust resistance gene YrBN1 was 2, significantly lower than the average IT of plants not containing the stripe rust resistance gene YrBN1 (7.5). Furthermore, the average IT of plants containing the heterozygous stripe rust resistance gene YrBN1 was 4, also significantly lower than the average IT of plants not containing the stripe rust resistance gene YrBN1. The actual results were consistent with the expected results. The molecular marker XK1D-8 of the present invention can replace phenotypic selection for YrBN1 selection and germplasm resource screening. It can be applied to molecular-assisted selection breeding of YrBN1 to accelerate the breeding process.

[0055] The embodiments described above are merely preferred embodiments of the present invention, and not an exhaustive list of all possible implementations of the present invention. Any obvious modifications made by those skilled in the art without departing from the principles and spirit of the present invention should be considered to be included within the scope of protection of the claims of the present invention.

Claims

1. A specific primer set for amplifying the KASP molecular marker is used in identifying whether wheat materials contain the stripe rust resistance gene YrBN1, detecting wheat stripe rust resistance traits, screening germplasm resources for the wheat stripe rust resistance gene YrBN1, creating stripe rust-resistant wheat materials, or in molecularly assisted breeding of wheat for stripe rust resistance, characterized in that, The KASP molecular marker is linked to the stripe rust resistance gene YrBN1; The KASP molecular marker is XK1D-8; the nucleotide sequence of XK1D-8 is shown in SEQ ID NO.1, and the 100th base from the 5′ end of the nucleotide sequence is an SNP site, and the polymorphism of the SNP site is C / A. The specific primer set includes the forward primer XK1D-8-FAM, the forward primer XK1D-8-HEX, and the common reverse primer XK1D-8-Common; wherein... The nucleotide sequence of the forward primer XK1D-8-FAM is shown in SEQ ID NO.2; The nucleotide sequence of the forward primer XK1D-8-HEX is shown in SEQ ID NO.3; The nucleotide sequence of the common reverse primer XK1D-8-Common is shown in SEQ ID NO.4; Genotyping of the wheat to be tested was performed. If the obtained genotype of XK1D-8 was a homozygous allele with FAM fluorescence or a heterozygous genotype, then the wheat material to be tested contained the stripe rust resistance gene YrBN1. If the obtained genotype was a homozygous allele with HEX fluorescence, then the wheat material to be tested did not contain the stripe rust resistance gene YrBN1. Wheat containing the stripe rust resistance gene was selected for breeding.

2. The application according to claim 1, characterized in that, The XK1D-8 gene and the stripe rust resistance gene YrBN1 are co-located on the wheat 1DS chromosome.

3. A detection kit for the stripe rust resistance gene YrBN1, used in identifying whether wheat materials contain the stripe rust resistance gene YrBN1, detecting wheat stripe rust resistance traits, screening germplasm resources for the wheat stripe rust resistance gene YrBN1, creating stripe rust-resistant wheat materials, or molecular-assisted breeding of wheat with stripe rust resistance, characterized in that... Includes the specific primer set for the KASP molecular marker described in claim 1; Genotyping of the wheat to be tested was performed. If the obtained genotype of XK1D-8 was a homozygous allele with FAM fluorescence or a heterozygous genotype, then the wheat material to be tested contained the stripe rust resistance gene YrBN1. If the obtained genotype was a homozygous allele with HEX fluorescence, then the wheat material to be tested did not contain the stripe rust resistance gene YrBN1. Wheat containing the stripe rust resistance gene was selected for breeding.

4. A method for identifying whether wheat materials contain the stripe rust resistance gene YrBN1, characterized in that, The steps include: using the genomic DNA of the wheat material to be tested as a template, amplifying it with the specific primer set of the KASP molecular marker described in claim 1, transferring the amplification product to an enzyme-linked immunosorbent assay (ELISA) reader to read the fluorescence data, and determining whether the wheat to be tested contains the stripe rust resistance gene YrBN1 based on the fluorescence data of the amplification product; When the obtained genotype is a homozygous allele with FAM fluorescence or a heterozygous genotype, the wheat material to be tested contains the stripe rust resistance gene YrBN1; when the obtained genotype is a homozygous allele with HEX fluorescence, the wheat material to be tested does not contain the stripe rust resistance gene YrBN1.

5. The method for identifying whether wheat materials contain the stripe rust resistance gene YrBN1 according to claim 4, characterized in that, The amplification reaction system consisted of: 0.2 μg DNA, 0.0448 μL primer mixture, 2 μL 2×KASPv4.0 Mastermix, and 1.9552 μL ddH2O. In the primer mixture, the concentrations of the forward and reverse primers are 12 μM, and the concentration of the shared reverse primer is 30 μM.

6. The method for identifying whether wheat materials contain the stripe rust resistance gene YrBN1 according to claim 4, characterized in that, The amplification reaction program is as follows: pre-denaturation at 94 °C for 15 min; denaturation at 94 °C for 20 s, annealing at 65 °C for 60 s, 10 cycles, with the annealing temperature decreasing by 0.6 °C per cycle; denaturation at 94 °C for 20 s, annealing at 55 °C for 60 s, 32 cycles.

Images