Fluorescence sensor based on allosteric transcription factor and application of fluorescence sensor in tetracycline detection

Abstract

The invention discloses a fluorescence sensor based on an allosteric transcription factor and application of the fluorescence sensor in tetracycline detection, and belongs to the technical field of biochemistry. The invention adopts a fluorescence sensor based on an allosteric transcription factor. The fluorescence sensor comprises an identification element, a target, a transmission element, a light source and spectrum detection equipment, the identification element is aTF; the aTF is TetR; the transmission element is an optical fiber; the optical fiber comprises an optical fiber probe; the surface of the optical fiber probe is modified with a TetR-QD compound; the detection method has the advantages of one-step rapid detection, portability, simplicity, reusability and easiness in field quantification.

Description

Technical Field

[0001] The invention relates to the technical field of biochemistry, and in particular to a fluorescent sensor based on an allosteric transcription factor and application thereof in tetracycline detection. Background Art

[0002] There are various types of pollution in the existing environment. Tetracycline pollution is mainly through industrial wastewater, aquaculture wastewater, medical waste, domestic sewage, etc. The impact on the water environment is mainly reflected in its widespread existence and persistence, ecotoxicity and the production of drug-resistant bacteria; the impact on the soil environment is mainly reflected in adsorption, residue, and the impact on soil microorganisms and plants; the impact on human health is mainly reflected in potential health risks and ecological safety considerations. Tetracycline has certain biological toxicity. If feces containing tetracycline are directly discharged without treatment or used for farmland fertilization, it will cause tetracycline pollution in soil and water. Tetracycline pollution can cause water pollution, soil pollution and ecotoxicity, and then cause microbial inhibition, leading to an imbalance in the structure of microbial communities; it will also affect the growth of animals and plants through the food chain due to long-term residues; tetracycline residues in the environment enter the human body through drinking water, food, etc., which will pose a potential danger to human health.

[0003] The detection methods of tetracycline in the environment mainly include liquid chromatography-mass spectrometry (LC-MS / MS), but its equipment is expensive, the cost is high, and the technical requirements for operators are high; high-performance liquid chromatography (HPLC) is sensitive to impurity interference in the sample and cannot detect multiple tetracycline drugs at the same time (relative to LC-MS / MS); enzyme-linked immunosorbent assay (ELISA) is not as specific and sensitive as mass spectrometry, and there is a risk of cross-reaction and high false positive rate; microbial inhibition method is difficult to distinguish between types of tetracycline, difficult to perform quantitative detection, and the test results are easily interfered by other antibiotics or environmental factors; capillary electrophoresis chromatography has high equipment requirements, complex operation, and high requirements for sample purity; immunoaffinity column purification combined with high-performance liquid chromatography has a relatively complex operation process and high cost; optical fiber is widely used as a carrier for environmental detection due to its small size and high detection accuracy, but the traditional immunofluorescence sensor detection step usually includes incubation, which takes a long time, greatly limiting the application of immunofiber fluorescence sensors in on-site detection. Constructing a sensor that can detect pollutants in a one-step rapid manner, is portable and simple, reusable, and easy to quantify on site has become a technical problem that needs to be solved urgently at this stage. Summary of the invention

[0004] Based on the above technical problems to be solved by the present invention, the present invention proposes a fluorescent sensor based on allosteric transcription factors and its application in tetracycline detection. The detection method has the advantages of one-step rapid detection, portability and simplicity, reusability and easy on-site quantification.

[0005] One of the purposes of the present invention is to provide a fluorescence sensor based on an allosteric transcription factor, the fluorescence sensor comprising a recognition element, a target, a transmission element, a light source and a spectrum detection device;

[0006] The recognition element is aTF;

[0007] The aTF is TetR;

[0008] The transmission element is an optical fiber;

[0009] The optical fiber includes an optical fiber probe;

[0010] The surface of the optical fiber probe is modified with a TetR-QD complex;

[0011] The TetR sequence is shown in SEQ ID NO: 1;

[0012] The target DNA sequence is shown in SEQ ID NO: 2;

[0013] The light source is a fluorescent light source.

[0014] Further, the TetR is connected to the optical fiber surface through DNA recognition;

[0015] The surface of the optical fiber probe is covalently modified with a TetR-QD complex;

[0016] The optical fiber is a sensing optical fiber.

[0017] Further, the fluorescent light source includes one of ultraviolet light, high pressure mercury lamp, xenon lamp, metal halide lamp, LED light, and laser;

[0018] The sensing optical fiber is one of quartz glass optical fiber, silicon optical fiber and plastic optical fiber.

[0019] The second purpose of the present invention is to provide an application of a fluorescent sensor based on an allosteric transcription factor in the detection of tetracycline.

[0020] Furthermore, the main steps of the tetracycline detection include:

[0021] (1) Preparation of TetR-QD complexes:

[0022] EDC, NHS and QD-COOH were added to BBS buffer respectively and incubated in the dark at room temperature; the activated quantum dots were mixed with TetR and incubated in the dark at room temperature; free TetR was removed and washed with ddH2O to obtain the TetR-QD complex;

[0023] (2) Covalent modification of optical fiber surface:

[0024] The optical fiber coating is removed and wiped with alcohol; the optical fiber probe part is immersed in a 30%-50% HF solution, the surface of the optical fiber probe is treated with a piranha solution, taken out, ultrasonicated, and blown dry with nitrogen to form hydroxyl groups; the optical fiber probe part is placed in a mixture of APTES, isopropanol and ammonia water, stirred, and dried; the dried optical fiber probe part is placed in a glutaraldehyde solution, magnetically stirred, and washed with Tris-HCl to obtain an optical fiber probe with an aldehyde group introduced;

[0025] (3) DNA modification:

[0026] The fiber optic probe was incubated in dsDNA-NH2 overnight; the remaining aldehyde sites were blocked with BSA solution; the DNA-modified fiber optic probe and TetR-QD complex was obtained, and then washed with ddH2O; and the surface of the fiber optic probe was observed.

[0027] Furthermore, the fluorescent sensor TetR can bind to or separate from the target DNA sequence, and when no target is present, the TetR is connected to the optical fiber surface through DNA recognition;

[0028] The ultraviolet light activates QD fluorescence, and the optical fiber collects and analyzes the fluorescence signal, at which time the fluorescence intensity is the maximum;

[0029] After the target is added, the TetR binds to the target and changes its conformation, causing the TetR-QD complex to dissociate from the fiber probe and the fluorescence intensity to decrease;

[0030] The concentration of tetracycline in the solution was detected by the change of fluorescence intensity.

[0031] Further, the optical fiber probe is connected to the spectrum detection device via a jumper and a rotary joint;

[0032] During detection, the optical fiber probe is inserted into a sample tube containing a sample, and then taken out to collect the fluorescence signal;

[0033] The changes in fluorescence spectrum were recorded to detect the concentration of tetracycline in the solution.

[0034] Further, the final concentrations of EDC, NHS and QD-COOH added to BBS buffer were 0.8 mg / ml to 1.6 mg / ml, 1.4 mg / ml to 2.2 mg / ml and 1.2 μM to 2.0 μM, respectively;

[0035] The method for removing free TetR is a 30 kDa ultrafiltration tube.

[0036] Further, the concentration of the HF solution is 20%-60%;

[0037] The piranha solution is 98% H2SO4:30% H2O2 in a volume ratio of 3:1;

[0038] The APTES concentration is 2%;

[0039] The volume ratio of 2% APTES, isopropanol and ammonia water = 5:5:1;

[0040] The fiber optic probe was incubated in dsDNA-NH2 overnight at 37°C.

[0041] Furthermore, under the excitation of the fluorescent light source, a signal output is collected, and the signal value is ΔS (S1-S2).

[0042] Compared with the prior art, the present invention provides a fluorescent sensor based on an allosteric transcription factor and its application in tetracycline detection.

[0043] The present invention uses TetR as a recognition element and optical fiber as a carrier to propose a sensor for tetracycline detection, realizes the development of one-step fluorescent biological on-site sensing, and greatly shortens the detection time; the sensor has high selective sensitivity and repeatability, greatly reducing the cost; the fluorescent optical fiber sensing detection method based on allosteric transcription factors realizes the construction of an optical fiber sensor based on aTF for the first time, and as a universal detection platform, it can realize the detection of other substances according to different aTF categories and characteristics, and provides a reference for the one-step on-site rapid detection of optical fiber sensing. The sensor and the corresponding detection method have the following beneficial effects:

[0044] 1. The fluorescent sensor proposed in the present invention uses aTF as the recognition element. Since aTF itself has the characteristics of high sensitivity and specificity to quickly recognize the target and dissociate from DNA, it realizes one-step rapid detection; the sensor does not require a long and complicated reaction system and pretreatment process, and can achieve quantitative detection within 5 minutes.

[0045] 2. The present invention uses optical fiber as a carrier, covalently modifies TetR-QD on the surface of the optical fiber, collects and transmits signals through the optical fiber, and outputs the signal data to a computer by a spectrometer. Since optical fiber has the characteristics of high sensitivity, strong anti-interference and fast transmission, and the spectrometer is small and easy to carry, it avoids complex and expensive instruments and equipment, and can achieve on-site quantification in complex environments with scarce resources.

[0046] 3. The sensor proposed in the present invention is reusable and can be reused after being treated. It can be soaked in 0.5% SDS for 5 minutes and prepared again. It can be reused at least 5 times without affecting its performance, which greatly reduces the cost.

[0047] 4. The detection method of the present invention can be mass-produced after the preliminary preparation of the optical fiber probe. Each optical fiber probe is equivalent to a sensor. In actual application, it is only necessary to add 1 ml of sample into a 1.5 ml ep tube and immerse the sensor probe into the test liquid to complete the detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 A schematic diagram of a signal acquisition device according to an embodiment of the present invention is shown;

[0049] Figure 2 A typical signal spectrum diagram of an embodiment of the present invention is shown;

[0050] Figure 3 The TetR-QD fluorescent fiber sensor of the present invention is shown in FIG. 3 μM linear relationship diagram;

[0051] Figure 4 A selectivity characterization diagram of a TetR-QD composite fluorescent optical fiber biosensor according to an embodiment of the present invention is shown, wherein (A) ΔS of the TetR-QD optical fiber biosensor to various metal ions; (B) ΔS of the TetR-QD optical fiber biosensor to mixed antibiotics;

[0052] Figure 5 A repeatability characterization diagram of a TetR-QD composite fluorescent optical fiber biosensor according to an embodiment of the present invention is shown. DETAILED DESCRIPTION

[0053] The exemplary embodiments of the present application will be described in more detail below with reference to the accompanying drawings. Although the exemplary embodiments of the present application are shown in the accompanying drawings, it should be understood that the present application can be implemented in various forms and should not be limited by the embodiments set forth herein. On the contrary, these embodiments are provided in order to enable a more thorough understanding of the present application and to fully convey the scope of the present application to those skilled in the art.

[0054] In the following examples, unless otherwise specified, the technical means adopted are conventional means well known to those skilled in the art, and the reagents and materials in the present invention are obtained from the market or other public channels.

[0055] The experimental materials and equipment involved in the present invention mainly include but are not limited to:

[0056] Reagents:

[0057] The raw materials of hydrogen peroxide (H2O2, 30%), concentrated sulfuric acid (H2SO4, 98%), isopropanol (C3H80, 99.7%), ammonia (NH3·H2O, 25%), and anhydrous ethanol (C2H5OH, 99.7%) were obtained from Shanghai Sinopharm Chemical Reagent Co., Ltd., China. Water-soluble CdSe / ZnS carboxylated quantum dots (QD-COOH, 8 μM in H2O), N-hydroxysuccinimide (NHS, 98%), and hydrofluoric acid (HF, 40%) were provided by Aladdin (Shanghai, China). (3-Aminopropyl)triethoxysilane (APTES, 99%) and glutaraldehyde (50% in H2O) were purchased from Macklin (Shanghai, China). Borate buffer solution (BBS, 0.05 mol / L, pH = 7.4) and 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) were purchased from Yuanye (Shanghai, China) and Sangon Biotech (Shanghai, China), respectively. Phosphate buffer, protein (BSA) and Tris-HCl were purchased from Solarbio (Beijing, China), Beyotime Biotechnology (Shanghai, China) and Absin (Shanghai, Chain), respectively.

[0058] instrument:

[0059] Scanning electron microscope (SEM, Sigma 300, Zeiss, Oberkochen, Germany), fluorescence microscope (BX63, Obvious, Tokyo, Japan), optical microscope (DM500, Leica, Wetzlar, Germany), and spectrometer (Maya2000 Pro, Ocean Optics, Florida, USA).

[0060] The present invention discloses a fluorescent sensor based on allosteric transcription factor and its application in tetracycline detection. The allosteric transcription factor (aTF) is combined with optical fiber sensing to construct an aTF-quantum dot (QD) composite fluorescent optical fiber biosensor for one-step quantitative on-site detection of tetracycline. The prepared biosensor achieves quantitative detection of tetracycline within 5 minutes, with a detection rate of 10 to 1×10 6 The linear range of nM was 16nM, and the detection limit was 16nM. The biosensor was also found to have excellent selectivity and could be reused at least 5 times by regeneration. In actual samples, the detection recovery rate of the biosensor for tetracycline was 96.86% to 112.66%. Therefore, the prepared biosensor has the advantages of fast detection speed, high sensitivity and good selectivity.

[0061] The technical principle of the present invention mainly includes: based on allosteric transcription factors (aTFs) as a transcriptional regulatory protein that can specifically recognize targets. The TetR-QD composite fluorescent optical fiber biosensor proposed by the present invention, under different conditions, TetR can bind to or separate from a specific DNA sequence. When there is no target substance, TetR is connected to the optical fiber surface through DNA recognition; UV activates QD fluorescence, and the optical fiber collects and analyzes the fluorescence signal, at which time the fluorescence intensity is the maximum; after the target is added, TetR binds to the target and changes its conformation, resulting in the dissociation of the TetR-QD complex from the fiber probe and a decrease in fluorescence intensity.

[0062] Based on the above principle, the present invention proposes a fluorescent sensor based on an allosteric transcription factor and its application in tetracycline detection, and the specific steps mainly include:

[0063] S1. Preparation of TetR-QD complexes:

[0064] EDC, NHS and QD-COOH were added to BBS buffer respectively and incubated in the dark at room temperature; the activated quantum dots were mixed with TetR and incubated in the dark at room temperature; the free TetR was removed and washed with ddH2O, and the obtained TetR-QD complex was stored at 4°C in the dark for future use.

[0065] S2, aTF sequence is as follows:

[0066] Table 1 Amino acid sequence of TetR

[0067]

[0068] S3. Covalent modification of optical fiber surface:

[0069] The optical fiber coating is removed and wiped with alcohol; the optical fiber probe part is immersed in a 30%-50% HF solution, the surface of the optical fiber probe is treated with a piranha solution, the ultrasound is removed, and the probe is blown dry with nitrogen for standby use to form a hydroxyl group (-OH); the optical fiber probe probe part is inserted into a mixture of APTES, isopropanol and ammonia water, magnetically stirred, and dried; the dried optical fiber probe probe part is placed in a glutaraldehyde solution for treatment, magnetically stirred, and washed with Tris-HCl to introduce an aldehyde group (-CHO).

[0070] S4. DNA modification:

[0071] The fiber optic probe was incubated in dsDNA-NH2 overnight; the remaining aldehyde sites were blocked with BSA solution; the DNA-modified fiber optic probe was complexed with TetR-QD and washed with ddH2O; the surface of the fiber optic probe was observed using a scanning electron microscope (SEM, Sigma 300, Zeiss, Oberkochen, Germany), UV light, and fluorescence microscope (BX63, Evident, Tokyo, Japan).

[0072] S5. The DNA sequences used in this work are as follows:

[0073] The TetR binding DNA sequence (SEQ ID NO: 2) is:

[0074] ttttttttttagagatagtgactatccctggaggat-5`NH2

[0075] atcctccagggatagtcactatctctaaaaaaaaaa

[0076] The fluorescent sensor proposed in the present invention uses aTF as the recognition element. Since aTF itself has the characteristics of high sensitivity and specificity to quickly recognize the target and dissociate from DNA, it realizes one-step rapid detection. The sensor does not require a long and complicated reaction system and pretreatment process, and can achieve quantitative detection within 5 minutes.

[0077] Example 1

[0078] The present invention provides a TetR-QD composite fluorescent optical fiber biosensor.

[0079] Mainly include:

[0080] The TetR-QD composite fluorescent optical fiber biosensor proposed in the present invention uses TetR as a recognition element and optical fiber as a transmission element, and covalently modifies the TetR-QD complex on the surface of the optical fiber probe to achieve specific detection of tetracycline.

[0081] The present invention constructs a signal acquisition device, adopts an ultraviolet 310nm LED as a light source, excites fluorescence on the surface of an optical fiber probe, and the optical fiber probe is connected to a Mayya 2000pro spectrometer (Maya2000 pro, Ocean Optics, Florida, American) through a jumper and a rotary joint; during detection, the optical fiber probe is inserted into a 1.5ml ep tube containing a sample for a period of time, and then taken out to collect fluorescence signals; and the fluorescence spectrum is displayed on a laptop computer for further analysis.

[0082] Results: See Figure 1The TetR-QD composite fluorescent optical fiber biosensor proposed in the present invention uses aTF (allosteric transcription factor) as the recognition element. aTF itself has the characteristics of high sensitivity and specificity to quickly recognize the target and dissociate from DNA, thus realizing one-step rapid detection. The sensor does not require a long and complicated reaction system and pretreatment process, and can achieve quantitative detection within 5 minutes. With optical fiber as a carrier, TetR-QD is covalently modified on the surface of the optical fiber, and the signal is collected and transmitted through the optical fiber. Finally, the signal data is output to the computer by the spectrometer. Since the optical fiber has the characteristics of high sensitivity, strong anti-interference and rapid transmission, and the spectrometer is small and easy to carry, it avoids complex and expensive instruments and equipment, and can achieve on-site quantification in complex environments with scarce resources.

[0083] Example 2

[0084] The present invention provides a method for using a TetR-QD composite fluorescent optical fiber biosensor for tetracycline detection.

[0085] Mainly include:

[0086] The steps of using the TetR-QD composite fluorescent optical fiber biosensor proposed in the present invention for tetracycline detection include:

[0087] S1. Preparation of TetR-QD complexes:

[0088] EDC, NHS and QD-COOH were added to 125 μl BBS buffer with final concentrations of 1.2 mg / ml, 1.8 mg / ml and 1.6 μM, respectively, and incubated in the dark at room temperature for 30 min; the activated quantum dots were mixed with 0.0342 mg / ml TetR and incubated in the dark at room temperature for 2 h; free TetR was removed with an ultrafiltration tube (30 kDa MWCO, Millipore), washed 3 times with ddH2O, and the obtained TetR-QD complex was stored in the dark at 4°C for later use.

[0089] S2, aTF sequence is as follows:

[0090] Table 1 Amino acid sequence of TetR

[0091]

[0092] S3. Covalent modification of optical fiber surface:

[0093] Remove the fiber coating and wipe it with alcohol; immerse the fiber probe part 5cm in 40% HF solution, treat the fiber probe surface with piranha solution (98% H2SO4:30% H2O2, 3:1 [V / V]) for 30min, take out 320W ultrasound for 10s, blow dry with nitrogen for use, and form hydroxyl (-OH); insert the fiber probe part into a mixture of 2% APTES, isopropanol and ammonia water (5:5:1 [V / V]) and stir magnetically at 250rpm for 2h. After stirring, dry at 60℃ for 2h. Insert the dried fiber probe part into 5% glutaraldehyde solution, stir magnetically at 250rpm for 2h, and wash it 3 times with Tris-HCl (0.3M, pH=8.0) to introduce aldehyde group (-CHO).

[0094] S4. DNA modification:

[0095] The fiber optic probe was incubated in dsDNA-NH2 at 37°C overnight; the remaining aldehyde sites were blocked with 0.01g / ml BSA solution for 1h; the DNA-modified fiber optic probe and TetR-QD complex were incubated at 37°C for 30min and washed three times with ddH2O; the surface of the fiber optic probe was observed using a scanning electron microscope (SEM, Sigma 300, Zeiss, Oberkochen, Germany), 310nm ultraviolet light and a fluorescence microscope (BX63, Evident, Tokyo, Japan).

[0096] S5. The DNA sequences used in this work are as follows:

[0097] TetR binding DNA sequence

[0098] ttttttttttagagatagtgactatccctggaggat-5`NH2

[0099] atcctccagggatagtcactatctctaaaaaaaaaa

[0100] S6. Detection of tetracycline by TetR-QD composite fluorescent fiber biosensor

[0101] An ultraviolet 310nm LED was used as the light source to excite fluorescence on the surface of the fiber optic probe, which was connected to a Mayya 2000pro spectrometer (Maya2000 pro, Ocean Optics, Florida, American) via a jumper and a rotary joint. During detection, the fiber optic probe was inserted into a 1.5ml ep tube containing the sample for a period of time and then taken out to collect the fluorescence signal. The fluorescence spectrum was displayed on a laptop computer for further analysis.

[0102] Results: See Figure 1 The TetR-QD composite fluorescent optical fiber biosensor proposed in the present invention can be mass-produced after the preliminary preparation of the optical fiber probe; one optical fiber probe is a sensor; in actual application, only 1 ml of sample needs to be added to a 1.5 ml ep tube, and the sensor probe can be immersed in the test liquid to complete the detection.

[0103] Example 3

[0104] The present invention proposes a parameter optimization experiment of a TetR-QD composite fluorescent optical fiber biosensor.

[0105] Mainly include:

[0106] (1) Optimization of optical fiber probe:

[0107] Single-mode fiber probes and multi-mode fiber probes were analyzed. For HF corrosion time verification, different corrosion times (5min, 10min, 15min, 20min, 25min, 30min) were evaluated under the same conditions, and the subsequent preparation conditions were the same. Under the excitation of external light sources, the signal output was collected, and the signal value was ΔS (S1-S2). The typical signal spectrum is shown in Figure 2 shown.

[0108] (2) Determination of testing time:

[0109] The experiment used a series of concentrations of tetracycline (0.01μM, 0.1μM, 1μm, 10μm, 100μm, 1000μM), which were inserted into 1.5ml ep tubes containing different concentrations of the target to be detected. The signal was collected once every 5s within 5min, once every 1min from 5-20min, and once every 2min from 20-30min.

[0110] (3) Obtaining the quantitative formula for tetracycline detection:

[0111] After determining the detection time, based on the detection time experiment, it was calculated that ΔS and tetracycline concentration were in the range of 0.01μM-10 3 μM, showing a good linear relationship, the linear equation is Y = 889.3 × X + 1985 (R 2 =0.9846), where Y is ΔS and X is the logarithm of the tetracycline concentration.

[0112] Results: See Figure 2 In order to improve the detection efficiency, a multimode optical fiber was selected, and it was determined that the transmission efficiency was best when the corrosion time was 15 min, and the aTF-QD composite fluorescent optical fiber biosensor was in the range of 0.01 μM-10 3The detection efficiency is greatly improved, the detection steps are reduced, the detection time is shortened, and the detection performance is good.

[0113] Example 4

[0114] The present invention proposes a performance and detection limit (LOD) determination experiment of a TetR-QD composite fluorescent optical fiber biosensor.

[0115] Mainly include:

[0116] The present invention proposes the calculation of the detection limit (LOD) of the TetR-QD composite fluorescent optical fiber biosensor. According to the classification of the National Bureau of Standards of the United States, the detection limit is defined as 3 times the blank standard deviation, that is, 3α blank (or 3S blank), which is the average value of the background signal generated by the matrix blank plus 3 times the mean standard deviation. Ultrapure water without tetracycline is used as a blank sample, and 10 tests are performed. The average value of ΔS obtained plus 3 times the mean standard deviation is brought into a tetracycline detection quantitative formula for calculation. According to the linear formula, the LOD of tetracycline is 16 nM.

[0117] The present invention constructs a fluorescent optical fiber sensing system to measure the ΔS induced by the tetracycline concentration gradient, and further investigates the performance and limit of detection (LOD) of the TetR-QD composite fluorescent optical fiber biosensor.

[0118] Results: See Figure 3 For the TetR-QD composite fluorescent optical fiber biosensor of the present invention, the 3 There is a good linear relationship between the detection limit and the detection time. The detection process only needs to be incubated with the sample for 5 minutes. No other incubation process is required to achieve one-step detection. It has great potential in qualitative detection, and the detection limit of tetracycline is as low as 16nM. Therefore, the detection limit can fully meet the needs of detection when the LOD is similar. In the case of similar LOD, the fiber optic probe significantly shortens the detection time. In traditional immune fiber optic sensors, whether the sandwich method or the competitive method is used, the detection process involves a series of incubation processes that take at least 1 hour. However, the aTF-QD composite fluorescent fiber optic biosensor can detect the sample in only 5 minutes in one incubation step.

[0119] Example 5

[0120] The present invention proposes a selectivity experiment of a TetR-QD composite fluorescent optical fiber biosensor.

[0121] Mainly include:

[0122] The present invention uses 7 antibiotics (vancomycin, norfloxacin, erythromycin, roxithromycin, ampicillin, chloramphenicol and streptomycin) as potential interferents, and the concentration of the antibiotics in ddH2O is 10 μM.

[0123] Using ddH2O as a control, different types of 10μM antibiotics were detected by the sensor, the detection time was 5min, and three groups of experiments were conducted and the test results were observed. In addition, in order to study the specificity of tetracycline in the presence of other antibiotics, tetracycline and other types of antibiotics were prepared into mixed solutions with a concentration of 10μM. Using ddH2O as a control, the mixed solutions of different types of antibiotics were detected by the sensor, the detection time was 5min, and three groups of experiments were conducted and the test results were observed.

[0124] Results: See Figure 4 (A) and Figure 4 (B). 4(A) shows that only tetracycline produced a significant signal, indicating that the biosensor has good selectivity for tetracycline. In addition, tetracycline was also recognized by the biosensor in the presence of other antibiotics ( Figure 4 (B)). This indicates that the TetR-QD composite fluorescent fiber biosensor has high selectivity for target detection.

[0125] Example 6

[0126] The present invention proposes a repeatability experiment of a TetR-QD composite fluorescent optical fiber biosensor.

[0127] Mainly include:

[0128] The fiber probe of the fiber probe used for detection by the present invention was soaked in 0.5% SDS for 5 minutes to remove the residual TetR-QD complex, washed 3 times with PBS; incubated with TetR-QD at 37°C for 30 minutes, and the TetR-QD complex was coupled with the DNA fixed in the fiber probe; the regeneration process was run for 5 cycles. In order to evaluate the detection performance of the regenerated fiber probe, the present invention tested different concentrations of tetracycline (0.1μM, 1μM, 10μM, 100μM, 1000μM) and compared with the performance of the new fiber probe.

[0129] Results: See Figure 5 , after SDS treatment, the fluorescence intensity of the tetR-QD fiber biosensor dropped below 2500. After re-incubation with fresh tetR-QD, the fluorescence intensity increased to 7000-10000. Moreover, even after 5 cycles of regeneration, the fluorescence intensity was stable, with good reproducibility.

[0130] After soaking in 0.5% SDS for 5 minutes and preparing again, there was no significant difference between ΔS and the initial ΔS, indicating that the regenerated biosensor had the same detection performance as the new biosensor, indicating that the TetR-QD composite fluorescent fiber biosensor proposed in the present invention is reusable and can be reused at least 5 times after treatment without affecting its performance, greatly reducing costs.

[0131] Comparative Example

[0132] The present invention proposes a comparison experiment between a method of using a TetR-QD composite fluorescent optical fiber biosensor for tetracycline detection and other main methods in the prior art.

[0133] Mainly include:

[0134] The effect of actual samples on sensor performance was investigated by peaking samples containing different concentrations of tetracycline in milk. Milk was purchased from a supermarket. The milk samples were centrifuged at 30,000 rpm for 10 min, and the upper fat layer and lower sediment were discarded after centrifugation. The middle layer was transferred to a 30 kDa ultrafiltration tube and centrifuged at 10,000 rpm for 3 min. The lower layer was collected after centrifugation. In the recovery experiment, tetracycline standard solutions of different concentrations (10 μM, 50 μM, 100 μM) were added to the prepared milk samples and filtered. Recovery experiments were performed on the spiked samples and compared with the standard method LC-MS / MS.

[0135] result:

[0136] As shown in Table 2, the TetR-QD biosensor accurately determined the concentration of tetracycline in milk with a recovery rate of 96.86% to 112.66% and a relative standard deviation (RSD) of 7.3% to 15.7%. The results showed that the TetR-QD fiber biosensor has excellent detection capabilities and performs well in actual samples.

[0137] Table 2 Detection accuracy of TetR-QD composite optical fiber biosensors of different samples

[0138]

[0139]

[0140] It should be noted that the term "includes" or any other variation thereof is intended to cover non-exclusive inclusion, so that a process, method, article or device including a series of elements includes not only these elements, but also other elements not explicitly listed, or also includes elements inherent to such process, method, article or device. In the absence of further restrictions, the elements defined by the sentence "includes..." do not exclude the existence of other identical elements in the process, method, article or device including the elements.

[0141] The above are only embodiments of the present application and are not intended to limit the present application. For those skilled in the art, the present application may have various changes and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application should be included within the scope of the claims of the present application.

Claims

1. A fluorescent sensor based on an allosteric transcription factor, characterized in that: The fluorescence sensor includes a recognition element, a target, a transmission element, a light source and a spectrum detection device; The recognition element is aTF; the aTF is TetR; The transmission element is an optical fiber; the optical fiber includes an optical fiber probe; the surface of the optical fiber probe is modified with a TetR-QD complex; The TetR sequence is shown in SEQ ID NO: 1; The target DNA sequence is shown in SEQ ID NO: 2; The light source is a fluorescent light source.

2. The fluorescent sensor based on the allosteric transcription factor according to claim 1, characterized in that: The TetR is attached to the optical fiber surface through DNA recognition; The surface of the optical fiber probe is covalently modified with a TetR-QD complex; The optical fiber is a sensing optical fiber.

3. The fluorescent sensor based on the allosteric transcription factor according to claim 1, characterized in that: The fluorescent light source includes one of ultraviolet light, high pressure mercury lamp, xenon lamp, metal halide lamp, LED light and laser; The sensing optical fiber is one of quartz glass optical fiber, silicon optical fiber and plastic optical fiber.

4. Application of fluorescent sensor based on allosteric transcription factor in tetracycline detection, characterized in that: The fluorescent sensor is the fluorescent sensor based on the allosteric transcription factor according to any one of claims 1 to 3.

5. The use of the fluorescent sensor based on the allosteric transcription factor in tetracycline detection according to claim 4, characterized in that: The method for tetracycline detection comprises: (1) Preparation of TetR-QD complexes: EDC, NHS and QD-COOH were added to BBS buffer respectively and incubated in the dark at room temperature; the activated quantum dots were mixed with TetR and incubated in the dark at room temperature; free TetR was removed and washed with ddH2O to obtain the TetR-QD complex; (2) Covalent modification of optical fiber surface: The optical fiber coating is removed and wiped with alcohol; the optical fiber probe part is immersed in a 30% to 50% HF solution, the surface of the optical fiber probe is treated with a piranha solution, taken out, ultrasonicated, and blown dry with nitrogen to form hydroxyl groups; the optical fiber probe part is placed in a mixture of APTES, isopropanol and ammonia water, stirred, and dried; the dried optical fiber probe part is placed in a glutaraldehyde solution, magnetically stirred, and washed with Tris-HCl to obtain an optical fiber probe with an aldehyde group introduced; (3) DNA modification: The fiber optic probe was incubated in dsDNA-NH2 overnight; the remaining aldehyde sites were blocked with BSA solution; the DNA-modified fiber optic probe and TetR-QD complex was obtained, and then washed with ddH2O; and the surface of the fiber optic probe was observed.

6. The use of the fluorescent sensor based on the allosteric transcription factor in tetracycline detection according to claim 5, characterized in that: The fluorescent sensor TetR can bind to or separate from the target DNA sequence. When no target is present, the TetR is connected to the optical fiber surface through DNA recognition; The ultraviolet light activates QD fluorescence, and the optical fiber collects and analyzes the fluorescence signal, at which time the fluorescence intensity is the maximum; After the target is added, the TetR binds to the target and changes its conformation, causing the TetR-QD complex to dissociate from the fiber probe and the fluorescence intensity to decrease; The concentration of tetracycline in the solution was detected by the change of fluorescence intensity.

7. The use of the fluorescent sensor based on allosteric transcription factors in tetracycline detection according to claim 5, characterized in that: The optical fiber probe is connected to the spectrum detection device through a jumper and a rotary joint; During detection, the optical fiber probe is inserted into a sample tube containing a sample, and then taken out to collect the fluorescence signal; The changes in fluorescence spectrum were recorded to detect the concentration of tetracycline in the solution.

8. The use of the fluorescent sensor based on allosteric transcription factors in tetracycline detection according to claim 5, characterized in that: The final concentrations of EDC, NHS and QD-COOH added to the BBS buffer were 0.8 mg / ml to 1.6 mg / ml, 1.4 mg / ml to 2.2 mg / ml and 1.2 μM to 2.0 μM, respectively; The method for removing free TetR is a 30 kDa ultrafiltration tube.

9. The use of the fluorescent sensor based on allosteric transcription factors in tetracycline detection according to claim 5, characterized in that: The concentration of the HF solution is 20% to 60%; The piranha solution is 98% H2SO4:30% H2O2 in a volume ratio of 3:1; The APTES concentration is 2%; The volume ratio of 2% APTES, isopropanol and ammonia water = 5:5:1; The fiber optic probe was incubated in dsDNA-NH2 overnight at 37°C.

10. The use of the fluorescent sensor based on allosteric transcription factors in tetracycline detection according to claim 5, characterized in that: Under the excitation of the fluorescent light source, the signal output is collected, and the signal value is ΔS (S1-S2).

Images