Application of ZmFS1 gene in corn disease control
Patent Information
- Application Number
- CN202411601891.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-11
- Publication Date
- 2026-09-15
- Estimated Expiration
- 2044-11-11
AI Technical Summary
黄酮合酶I催化黄烷酮转化为相应的黄酮,如将柚皮素、圣草酚等催化生成芹菜素、木犀草素,但目前关于玉米黄酮合酶ZmFS1在玉米抗病中的功能尚未见报道
[0021] This invention, through gene function experiments and verification, discovered that ZmFS1 transgenic overexpression positive lines exhibit susceptible phenotypes against various maize diseases, including small leaf spot, large leaf spot, and stalk rot. Disease resistance identification of two transposon insertion mutant lines, ZmFS1-1 and ZmFS1-2, revealed that these mutants exhibit broad-spectrum resistance to multiple maize fungal diseases, including small leaf spot, large leaf spot, southern rust, and stalk rot. Therefore, the ZmFS1 gene provided by this invention is a broad-spectrum disease resistance gene that can significantly enhance maize's resistance to multiple diseases, offering a new solution for controlling maize diseases from a molecular biological perspective and providing a theoretical and practical basis for applying this gene to maize disease-resistant breeding.
Smart Images

Figure CN119351450B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of crop disease control technology, and in particular to the application of the ZmFS1 gene in the control of maize diseases. Background Technology
[0002] The information disclosed in the background section of this invention is intended only to enhance the understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.
[0003] Maize (Zea mays L.) is one of the world's major food crops, widely used in animal feed and industrial raw materials. However, with climate change, various pathogens causing diseases such as small leaf spot, large leaf spot, stalk rot, and southern rust have seriously affected maize yield and quality. Therefore, it is urgent to enhance maize's disease resistance and improve its yield and quality. Pathogens use susceptible genes in plants to infect them, affecting plant growth and development and reducing grain quality. Discovering susceptible genes in maize and studying their mechanisms, and using biotechnological methods to reduce the expression of susceptible genes to obtain sustained and broad-spectrum resistance to multiple diseases, can provide new strategies for plant molecular breeding and lead to more high-quality, high-yield maize varieties.
[0004] Secondary metabolites, flavonoids, not only participate in plant growth and development but also play an important role in plant disease resistance. Flavonoids can be classified into: flavanones, flavanols, flavonols, anthocyanins, isoflavones, and flavones. Flavonoid synthase I, a 2-ketoglutarate-dependent dioxygenase, directly catalyzes the formation of double bonds between carbon 2 and carbon 3 in flavanone compounds, such as catalyzing the conversion of naringenin to apigenin. It is a key enzyme in the synthesis of plant flavonoids. Flavonoid synthase I catalyzes the conversion of flavanones into their corresponding flavonoids, such as catalyzing the conversion of naringenin and sennaol to apigenin and luteolin. However, the function of maize flavonoid synthase ZmFS1 in maize disease resistance has not yet been reported. Summary of the Invention
[0005] In view of this, the present invention provides the application of the ZmFS1 gene in the prevention and control of maize diseases. The present invention improves the broad-spectrum disease resistance of maize by reducing the expression of the ZmFS1 gene, which is of great significance in maize disease resistance breeding.
[0006] In a first aspect, the present invention provides the application of the ZmFS1 gene in the prevention and control of maize diseases, wherein the nucleotide sequence of the cDNA of the ZmFS1 gene is shown in SEQ ID NO.1.
[0007] Preferably, the corn diseases include small leaf spot, large leaf spot, southern rust, anthracnose, stalk rot, and seed rot.
[0008] Preferably, the application is to inhibit the expression of the ZmFS1 gene in maize, thereby improving the crop's resistance to maize diseases.
[0009] Furthermore, the method for inhibiting the expression of the ZmFS1 gene in maize includes one or more of transposon insertion, gene editing, gene silencing, or ethyl methanesulfonate (EMS) mutagenesis.
[0010] Furthermore, the insertion sites of the transposon are located at positions 432 and 946 of the SEQ ID No.1 sequence, respectively.
[0011] Secondly, this invention provides the application of biological materials related to the ZmFS1 gene in the prevention and control of maize diseases, wherein the nucleotide sequence of the cDNA of the ZmFS1 gene is shown in SEQ ID NO.1; the maize diseases include small leaf spot, large leaf spot, southern rust, anthracnose, stalk rot and seed rot.
[0012] Preferably, the biomaterial is any one of (1) to (4) below:
[0013] (1) A protein encoded by the ZmFS1 gene, the amino acid sequence of which is shown in SEQ ID NO.2;
[0014] (2) Recombinant vectors containing the ZmFS1 gene;
[0015] (3) Recombinant microorganisms containing the ZmFS1 gene;
[0016] (4) Transgenic plant cell lines containing the ZmFS1 gene.
[0017] Furthermore, the vector is a plasmid, granule, bacteriophage, or viral vector; the microorganism may be yeast, bacteria, algae, or fungi.
[0018] Thirdly, the present invention provides a method for preventing and controlling maize diseases by inhibiting the expression of the ZmFS1 gene in maize; the nucleotide sequence of the cDNA of the ZmFS1 gene is shown in SEQ ID NO.1, and the maize diseases include small leaf spot, large leaf spot, southern rust, anthracnose, stalk rot and seed rot.
[0019] Fourthly, the present invention provides a maize breeding method, comprising the following steps: inhibiting the expression of the ZmFS1 gene in maize, thereby making maize resistant to small leaf spot, large leaf spot, southern rust, anthracnose, stalk rot and seed rot; the nucleotide sequence of the cDNA of the ZmFS1 gene is shown in SEQ ID NO.1.
[0020] Compared with the prior art, the present invention has achieved the following beneficial effects:
[0021] This invention, through gene function experiments and verification, discovered that ZmFS1 transgenic overexpression positive lines exhibit susceptible phenotypes against various maize diseases, including small leaf spot, large leaf spot, and stalk rot. Disease resistance identification of two transposon insertion mutant lines, ZmFS1-1 and ZmFS1-2, revealed that these mutants exhibit broad-spectrum resistance to multiple maize fungal diseases, including small leaf spot, large leaf spot, southern rust, and stalk rot. Therefore, the ZmFS1 gene provided by this invention is a broad-spectrum disease resistance gene that can significantly enhance maize's resistance to multiple diseases, offering a new solution for controlling maize diseases from a molecular biological perspective and providing a theoretical and practical basis for applying this gene to maize disease-resistant breeding. Attached Figure Description
[0022] The accompanying drawings, which form part of this specification, are used to provide a further understanding of the invention. The illustrative embodiments and descriptions of the invention are used to explain the invention and do not constitute an undue limitation thereof. Obviously, those skilled in the art can obtain other drawings based on these drawings without any inventive effort.
[0023] Figure 1 This is an electrophoresis image of the CDS sequence of the maize type I flavonoid synthase gene ZmFS1 cloned by PCR in Example 1 of this invention;
[0024] Figure 2 This is a Western blot identification diagram of the transgenic overexpression positive line in Example 2 of the present invention; wherein, the ZmFS1 transgenic material was identified by Western blot using GFP antibody, and the numbers above the lanes are the positive (pos) and corresponding negative (neg) plants of the two transgenic lines; 1, 2, 3, 4, 5, and 6 are from six different plants;
[0025] Figure 3 This invention describes the identification of resistance to anthracnose and small leaf spot in ZmFS1 transgenic overexpression seedlings during the seedling stage in Example 2 of this invention. A represents the phenotype of the ZmFS1 positive overexpression line and its corresponding negative line after inoculation with *Colletotrichum graminicola*; B represents the lesion area after inoculation measured using ImageJ; C represents the resistance phenotype of the ZmFS1 positive overexpression line and its corresponding negative line to small leaf spot; and D represents the lesion area after inoculation with small leaf spot pathogen measured using ImageJ (*p<0.05, **p<0.01, Student's t-test).
[0026] Figure 4This invention, in Example 2, describes the field resistance of ZmFS1 transgenic overexpression adult plants to small leaf spot and large leaf spot. A represents the resistance phenotype of the ZmFS1 positive overexpression line and its corresponding negative overexpression line to small leaf spot; B represents the lesion severity of the ZmFS1 positive overexpression line and its corresponding wild-type after small leaf spot infection; C represents the resistance phenotype of the ZmFS1 positive overexpression line and its corresponding negative overexpression line to large leaf spot; and D represents the lesion severity of the ZmFS1 positive overexpression line and its corresponding negative overexpression line after large leaf spot infection (*p<0.05, ***p<0.001, Student's t-test).
[0027] Figure 5 This invention describes the identification of the resistance of the ZmFS1 transgenic overexpression lines to stem rot and seed rot in Example 2 of this invention. A represents the resistance phenotype of the ZmFS1 positive overexpression line and its corresponding negative overexpression line to stem rot; B represents the lesion grade of the ZmFS1 positive overexpression line and its corresponding negative overexpression line after inoculation with *Fusarium verticillioides*; C represents the resistance phenotype of the ZmFS1 positive overexpression line and its corresponding negative overexpression line to seed rot; and D represents the spore concentration of the ZmFS1 positive overexpression line and its corresponding negative overexpression line after inoculation with *Fusarium verticillioides* (*p<0.05, **p<0.01, ***p<0.001, Student's t-test).
[0028] Figure 6 This document describes the identification of the ZmFS1 mutant line in Example 3 of the present invention; wherein, A is a schematic diagram of the ZmFS1 gene structure and the location of the ChinaMu transposon insertion site; B is the PCR identification result of the ZmFS1 mutant; C is the transcriptional level of ZmFS1 in the ZmFS1 mutant detected by qRT-PCR (*P<0.05, **p<0.01, Student's t-test);
[0029] Figure 7 This invention describes the field resistance identification of the ZmFS1 mutant to small leaf spot and large leaf spot in Example 3 of this invention; wherein, A represents the field phenotype of the ZmFS1 mutant and its wild type to small leaf spot; B represents the lesion grade of the ZmFS1 mutant and its wild type after infection with small leaf spot; C represents the field phenotype of the ZmFS1 mutant and its wild type to large leaf spot; and D represents the lesion grade of the ZmFS1 mutant line and its wild type after infection with large leaf spot (**p<0.01; ***p<0.001, Student's t-test).
[0030] Figure 8This invention describes the identification of the resistance of the ZmFS1 mutant line to stem rot and seed rot in Example 3 of this invention; wherein, A represents the resistance phenotype of the ZmFS1 mutant and its wild type to stem rot; B represents the lesion grade of the ZmFS1 mutant and its wild type after inoculation with Fusarium verticillioides; C represents the resistance phenotype of the ZmFS1 mutant and its wild type to seed rot; and D represents the spore concentration of the ZmFS1 mutant and its wild type after inoculation with Fusarium verticillioides (*P<0.05, **p<0.01, Student's t-test).
[0031] Figure 9 This invention provides an example of the identification of resistance of the ZmFS1 mutant strain to southern rust. In this example, A represents the field phenotype of the ZmFS1 mutant and its wild type to southern rust, and B represents the lesion grade of the ZmFS1 mutant and its wild type after infection with southern rust (**p<0.01, Student's t-test). Detailed Implementation
[0032] In the following embodiments, the molecular biology techniques and methods used are all conventional methods known in the art. For details not provided, please refer to *Molecular Cloning: A Laboratory Manual* (Sambrook and Russell, 2001). Those skilled in the art can employ other conventional techniques and reagents according to the embodiments of the present invention, and are not limited to the specific embodiments of the present invention. The examples of the present invention are merely preferred embodiments. The following description is for illustrative purposes only and is not intended to limit the present invention in any way. Any simple modifications made to specific implementations based on the technical essence of the present invention fall within the scope of the present invention. Unless otherwise specified, the materials and reagents used in the embodiments were commercially available.
[0033] The technical solution of the present invention will be further described below with reference to specific embodiments.
[0034] Example 1: Cloning of ZmFS1
[0035] 1. Extraction of total RNA from maize inbred line B73
[0036] (1) Corn B73 leaves were ground into powder by pouring liquid nitrogen into a mortar sterilized at high temperature and then transferred to a centrifuge tube. 500 μL of RNA-easy extraction solution was added immediately.
[0037] (2) Add 500 μL of RNase-free ddH2O, mix by inverting the container, and let stand at room temperature for 5 min;
[0038] (3) Centrifuge at 12,000g for 15 min, aspirate the supernatant and transfer it to a new centrifuge tube, add an equal volume of isopropanol, mix well and let stand at room temperature for 10 min;
[0039] (4) Centrifuge at 12,000g for 10 min, discard the supernatant, wash the precipitate with 500 μL of 75% ethanol, and gently tap the bottom of the tube to allow the precipitate to fully contact the liquid; centrifuge at 8,000g for 3 min; discard the supernatant, and repeat the above steps to wash a second time;
[0040] (5) Place it in a clean bench and dry for about 3 minutes, then add 30 μl of RNase-Free water to dissolve it;
[0041] (6) The OD value and concentration of the RNA sample were measured using an ultra-micro spectrophotometer, with A 260 / A 280 A value of 1.8-2.0 is ideal; RNA quality is detected by agarose gel electrophoresis.
[0042] 2. RNA is reverse transcribed into cDNA
[0043] (1) Add the reagents listed in Table 1 (20 μl reaction system) to the centrifuge tube in sequence:
[0044] Table 1. Reagents and dosages
[0045]
[0046] (2) After mixing with a pipette, incubate at 42°C for 2 minutes.
[0047] (3) Add 4 μl of 5×HiScriptⅢqRT SuperMix to the centrifuge tube;
[0048] (4) After mixing, 25℃ for 5 min, 50℃ for 15 min, 85℃ for 5 min, and then store at -20℃ for later use.
[0049] 3. Cloning of the ZmFS1 gene
[0050] The primer sequences used are:
[0051] ZmFS1-F1: 5'-GCACGCACGGCGCCGGCGGC-3' (SEQ ID NO. 3); ZmFS1-R1: 5'-ATCCATCCGTATCCGATTCG-3' (SEQ ID NO. 4).
[0052] The reaction system for amplification using the high-fidelity enzyme KOD is shown in Table 2 (20 μl system).
[0053] Table 2 Reaction System
[0054]
[0055]
[0056] The amplification conditions are as follows:
[0057] (1) 5℃, 2min;
[0058] (2) 98℃, 10s;
[0059] (3) 60℃, 30s;
[0060] (4) 68℃, 45s;
[0061] (5) Repeat steps (2) to (4) 34 times;
[0062] (6) 68℃, 7min;
[0063] (7) Store at 15℃.
[0064] After amplification, loading buffer was added, followed by agarose gel electrophoresis for detection. Figure 1 As shown, the CDS sequence length of the ZmFS1 gene is 1011 bp.
[0065] The cloned fragments were recovered using the Polymer DNA Purification Kit.
[0066] 4. Ligation of the target gene and the entry vector
[0067] The reaction system is shown below:
[0068] DNA fragment recovered: 7 μl;
[0069] Introducing vector pENTR-T: 1 μl;
[0070] T4 Ligase: 1 μl;
[0071] T4 Buffer: 1 μl.
[0072] 16℃, overnight connection.
[0073] 5. Transform E. coli competent cells with plasmid or DNA ligation products.
[0074] (1) Add 10 μL of the ligation product to 50 μL of DH5α competent cells, mix well and incubate on ice for 30 min;
[0075] (2) Heat shock at 42℃ for 1 min, then on ice for 2 min, add 800 μl of LB medium, and shake at 37℃ and 220 rpm for 1 h;
[0076] (3) Centrifuge at room temperature, 5000 rpm for 2 min, and discard the supernatant;
[0077] (4) After leaving a small amount of supernatant to suspend the bacterial cells, spread it on LB plates containing the corresponding antibiotics and incubate overnight at 37°C with the plates upside down.
[0078] (5) Select single clones for colony PCR identification, select positive clones for sequencing, and name the clone with correct sequencing results as ZmFS1. The nucleotide sequence of the cDNA of the gene is shown in SEQ ID No.1, and the amino acid sequence it encodes is shown in SEQ ID No.2.
[0079] Example 2: Construction of ZmFS1 overexpression vector and verification of disease resistance function of transgenic lines
[0080] 1. Construction of maize ZmFS1 overexpression vector
[0081] (1) Add BamH1 and Xma1 restriction sites to both ends of the gene ZmFS1, and then double-digest the overexpression vector pCAMBIA3301 and the ZmFS1 fragment.
[0082] (2) After gel recovery, DNA ligation was performed using T4 DNA ligase;
[0083] (3) Transformed Escherichia coli competent cells DH5α, and positive clones identified by PCR were sent to the company for sequencing. The correct plasmid vector was named pCAMBIA3301::ZmFS1.
[0084] 2. Plasmid transformation of Agrobacterium
[0085] (1) Transfer 1 μg of pCAMBIA3301::ZmFS1 plasmid into EHA105 competent cells, mix well, and place on ice for 30 min.
[0086] (2) Quick freeze in liquid nitrogen for 1 min; freeze at 37℃ for 3 min; add 800 μl of LB liquid culture medium, shake at 28℃ and 220 rpm for 3 h;
[0087] (3) Centrifuge at room temperature, 5000 rpm for 2 min, and discard the supernatant;
[0088] (4) After leaving a small amount of supernatant to suspend the bacterial cells, spread them on LB culture plates containing the corresponding antibiotics, incubate upside down at 28°C for 48 hours, pick single clones for colony PCR identification, and store positive clones in a -80°C freezer.
[0089] 3. Genetic transformation of maize
[0090] Agrobacterium EHA105 containing the pCAMBIA3301::ZmFS1 plasmid vector was sent to a biotechnology company to transform maize inbred line B104, resulting in a transgenic line.
[0091] 4. Western blot detection of ZmFS1 transgenic maize plants
[0092] (1) Preparation of SDS-PAGE stacking and separating gels:
[0093] First, prepare a 10% separating gel. After preparing the separating gel, add water to seal it until a clear dividing line is formed. Then, let the separating gel solidify and remove the upper liquid layer. Next, prepare a 5% stacking gel. After preparing the stacking gel, insert a comb and let it stand for 0.5 hours until the stacking gel solidifies. The formula for the 10% separating gel is shown in Table 3.
[0094] Table 3 10% Separating Gel Formulation
[0095]
[0096] The formulation for 5% concentrated gum is shown in Table 4.
[0097] Table 4 5% Concentrated Gum Formulation
[0098]
[0099]
[0100] (2) Sample preparation:
[0101] Take 200 mg of leaf samples and place them in a 2 ml centrifuge tube. Add ceramic beads, freeze quickly in liquid nitrogen, and then use a sampler (40 Hz, 30 s) to break the sample into powder. Add 200 μL of protein extraction buffer, mix thoroughly, and incubate on ice for 30 min. The protein extraction buffer formulation is shown in Table 5.
[0102] Table 5 Protein Extraction Buffer Formulation
[0103]
[0104] (3) Centrifuge at 4℃ and 12000rpm for 15min, take 15μL of supernatant and mix with 15μL of 2×laemmlli (containing 5% mercaptoethanol) to prepare for sample loading.
[0105] (4) Place the SDS-PAGE gel into the electrophoresis tank, pour in 1×Running buffer, vertically remove the comb, take 15μL of sample and spot it, 80V, 20min, 150V, 1h.
[0106] The formulation of the 10×Running buffer is shown in Table 6.
[0107] Table 6 10×Running buffer formulation
[0108]
[0109] (5) Transfer membrane
[0110] a. After the gel electrophoresis is completed, remove the top layer of stacking gel, place the separating gel in a glass dish containing ddH2O for cleaning, and place the cut NC membrane (5.8×8.5cm) and filter paper (8×10cm) in 1× transfer buffer for cleaning and use.
[0111] b. With the black side of the transfer clamp facing down, place the sponge, filter paper, separating gel, NC membrane, filter paper, and sponge in sequence. After each placement, remove any excess air bubbles. Once fixed, place the membrane in the transfer tank with ice packs and add pre-cooled 1× transfer buffer.
[0112] c. Place the electrophoresis tank in an ice-water mixture to transfer the membrane, with a current of 160-200 mA for 2.25 hours.
[0113] The formulation of 10× transfer buffer is shown in Table 7.
[0114] Table 7 10× Transfer Buffer Formulation
[0115]
[0116]
[0117] (6) Closed
[0118] After the transfer is complete, place the membrane in a blocking solution (4% skim milk powder) and block for 1.5 hours.
[0119] (7) Primary antibody
[0120] Remove the blocking solution, transfer the NC membrane to the primary antibody solution (1:5000), and incubate on a horizontal shaker at room temperature for 2 hours.
[0121] (8) Secondary Antibody
[0122] Pour out the primary antibody, wash the membrane 3 times with 1×PBST for 10 min each time, add the secondary antibody (1:4000), and incubate on a horizontal shaker at room temperature for 1.5 h.
[0123] (9) Pour out the secondary antibody, wash the membrane twice with 1×PBST, and wash the membrane once with 1×PBS, for 10 min each time.
[0124] (10) Using the ECL kit, the chromogenic solution A and B were mixed in equal volumes. The mixture was then evenly spread onto the front side of the NC membrane, and finally developed using a chemiluminescence analyzer. The Western blot results of the ZmFS1 transgenic overexpressing plants are as follows: Figure 2 As shown.
[0125] 5. Identification of maize leaf spot and anthracnose through in vitro inoculation
[0126] (1) The two fungi that cause corn leaf spot and anthracnose, namely *Helicobacter spp.* and *Anthracnose graminearum*, were grown on V8 medium and cultured in a 28°C incubator in the dark.
[0127] (2) Preparation of spore eluent: 0.5 g / L agar powder, 0.5 ml / L Tween-20, ddH2O to a final volume of 1 L, autoclave;
[0128] (3) Add an appropriate amount of spore elution buffer to the bacterial plate, scrape off the bacterial plate and filter it with filter paper. Count the spores under a microscope using a cell counting plate. Dilute the bacterial solution to 1×10⁻⁶. 6 pcs / ml;
[0129] (4) Place two layers of filter paper in a black tray, attach corn leaves to the filter paper, punch holes in the leaves, add an appropriate amount of sterilized water to the tray, and then drip 10 μl of bacterial solution onto the holes.
[0130] (5) Seal the tray with plastic wrap for better moisture retention. Keep it in the dark for two days, then photograph and observe the lesion phenotype. Statistical analysis was performed using ImageJ. Identification revealed that the ZmFS1 overexpressing lines (W1-10 pos, W1-11 pos) were more susceptible to anthracnose than their corresponding negative lines (W1-10neg, W1-11 neg). The identification results are as follows: Figure 3 As shown in A and B, the ZmFS1 overexpressing lines (W1-10 pos, W1-11 pos) were more susceptible to small spot disease than their corresponding negative lines (W1-10 neg, W1-11 neg), as indicated by the identification results. Figure 3 As shown in C and D.
[0131] 6. Disease resistance identification for field leaf spot and field large leaf spot
[0132] In mid-May, maize samples were planted in Qingdao, and the phenotype of small leaf spot was statistically analyzed in the field after flowering. The disease was graded according to severity, with a total of 9 levels (1-9), where the larger the affected area, the lower the level. ZmFS1 overexpressing lines (W1-10pos, W1-11pos) were more susceptible to small leaf spot in the field than their corresponding negative lines (W1-10 neg, W1-11neg). The identification results are as follows: Figure 4 As shown in A and B in the diagram.
[0133] In late April, maize was planted in Changchun, Jilin Province, and the phenotype of large leaf spot disease after flowering was statistically analyzed in the field. The disease was graded according to severity, with a total of 9 levels (1-9), the larger the affected area, the higher the level. ZmFS1 overexpressing lines (W1-10pos, W1-11pos) were more susceptible to large leaf spot disease in the field than their corresponding negative lines (W1-10 neg, W1-11neg). The identification results are as follows: Figure 4 As shown in C and D.
[0134] 7. Disease resistance identification for maize stalk rot and seed rot
[0135] (1) Fusarium verticillata was cultured in PDA medium, and the mycelium was grown in the middle of the PDA and cultured in a 28°C incubator in the dark.
[0136] (2) Pick Fusarium verticillata mycelium blocks from mung bean culture medium and incubate them on a shaker at 28°C for 48 hours;
[0137] (3) Filter the bacterial solution with four layers of gauze, centrifuge at 1000g for 5 minutes, and discard the supernatant;
[0138] (4) Add an appropriate amount of sterile ddH2O to completely dissolve the bacterial clumps, count them using a hemocytometer, and dilute to 1×10⁻⁶. 6 pcs / ml;
[0139] (5) Draw 500 μl of bacterial suspension into a 1 ml syringe and inject it into the third internode of the corn plant. Seal the inoculation site. Two weeks later, cut off the third internode and split it in half. Determine the lesion grade. There are 5 grades (1-5), with larger diseased areas indicating higher grades. ZmFS1 overexpressing lines are more susceptible to stem rot than their corresponding negative lines. The identification results are as follows: Figure 5 As shown in A and B in the diagram.
[0140] (4) Seed rot: Wash seeds with 70% ethanol for 5 min, then with sterile water for 1 min; wash with 2.5% sodium hypochlorite for 10 min, and finally rinse with sterile water for 5 min * 3 times. Dry the seeds and make a cut on the embryo side with a blade. Place 4 seeds in a 20 ml bottle, inoculate with 200 μL of spore suspension, vortex to coat the seeds evenly with the suspension, slightly loosen the cap, and place in a plastic container to create a humidity chamber; incubate at 28℃ for 3-7 days. ZmFS1 overexpression lines are more susceptible to seed rot than their corresponding negative lines. The identification results are as follows: Figure 5 As shown in C and D.
[0141] Example 3: Identification and Verification of Disease Resistance Function of ZmFS1 Mutant
[0142] 1. Extraction of maize DNA using the CTAB method
[0143] Mutants 68614 (ZmFS1-1) and 71667 (ZmFS1-2) of the ZmFS1 gene were screened and purchased from the ChinaMu maize mutant library (http: / / chinamu.jaas.ac.cn / cindex.html). Seeds of the ZmFS1-1 and ZmFS1-2 mutants were sown in the field. Maize leaves were placed in 96-well DNA extraction plates, flash-frozen in liquid nitrogen, and then ground into powder. 250 μl of CTAB extraction buffer was added, mixed, and incubated at 65°C for 30 min. An equal volume of chloroform was added, and the mixture was incubated at room temperature for several minutes until separation occurred. The plates were then centrifuged at 4000 rpm for 30 min. 100 μl of the supernatant was transferred to a 96-well plate, an equal volume of isopropanol was added, mixed, and incubated at -20°C overnight. The plates were centrifuged at 4000 rpm for 30 min, the supernatant was discarded, and 100 μl of 75% ethanol was added, followed by centrifugation for 15 min. This step was repeated once. Discard the supernatant, blow dry the precipitate, add an appropriate amount of ddH2O to dissolve it, and store at 4℃ for later use.
[0144] The formulation of CTAB extract is shown in Table 8.
[0145] Table 8 CTAB Extract Formulation
[0146]
[0147] 2. Identification of ZmFS1 mutants
[0148] The ZmFS1 transposon insertion sites are located at positions 432 (Zmfs1-1) and 946 (Zmfs1-2) of the sequence in SEQ ID No. 1. Primers were designed based on the insertion sites of the ZmFS1-1 and ZmFS1-2 mutants for identification. The location of the identification primers in the ZmFS1 gene is shown in [link to primer]. Figure 6 A in the middle.
[0149] F1:GCACGCACGGCGCCGGCGGC (SEQ ID NO.3);
[0150] R1: GCCACTTTCTCTTTCTCCTGTC (SEQ ID NO.5);
[0151] F2: GCCCTTTCTTCGTAGACG (SEQ ID NO.6);
[0152] R2:CAGTTCACCGAGTCCTCTTTA(SEQ ID NO.7);
[0153] Mu67: GAAGCCAACGCCAWCGCCTCYATTTCGTCGAAT (SEQ ID NO. 8).
[0154] The reaction conditions are shown in Table 9.
[0155] Table 9 Reaction conditions
[0156]
[0157]
[0158] The amplification conditions are as follows:
[0159] (1) 95℃, 2min;
[0160] (2) 98℃, 10s;
[0161] (3) 58℃, 30s;
[0162] (4) 68℃, 1 min;
[0163] (5) Repeat steps (2) to (4) 30 times;
[0164] (6) 68℃, 5 min;
[0165] (7) Store at 15℃.
[0166] After PCR was stopped, agarose gel electrophoresis was performed for identification. FR showed no band, while F+Mu67 and R+Mu67 showed bands and were homozygous; FR showed a band, while F+Mu67 and R+Mu67 showed no bands and were wild-type. The identification results are as follows: Figure 6 As shown in B in the diagram.
[0167] After identifying ZmFS1-1 and ZmFS1-2 and their corresponding wild types, the transcriptional level of ZmFS1 in the ZmFS1-1 and ZmFS1-2 mutants was analyzed by quantitative PCR. The ZmFS1 content was decreased in both the ZmFS1-1 and ZmFS1-2 mutants, as shown in the results below. Figure 6 As shown in C.
[0168] 3. Disease resistance identification for small leaf spot and large leaf spot in the field.
[0169] In mid-May, maize samples were planted in Qingdao, and the phenotype of small leaf spot was observed in the field after flowering. The disease was graded according to severity, with a total of 9 levels (1-9), where the larger the affected area, the lower the level. The ZmFS1 mutant line (ZmFS1-1 homo) was more resistant to small leaf spot in the field than its corresponding wild type (ZmFS1-1 WT), as shown in the identification results. Figure 7 As shown in A and B in the diagram.
[0170] In late April, maize was planted in Changchun, Jilin Province, and the phenotype of large leaf spot disease after flowering was statistically analyzed in the field. The disease was graded according to its severity, with a total of 9 levels (1-9), the larger the affected area, the higher the level. The ZmFS1 mutant lines (ZmFS1-1homo, ZmFS1-2 homo) were more resistant to large leaf spot disease in the field than their corresponding wild types (ZmFS1-1 WT, ZmFS1-2 WT). The identification results are as follows: Figure 7 As shown in C and D.
[0171] 4. Disease resistance identification for maize stalk rot and seed rot
[0172] (1) Fusarium verticillata was cultured in PDA medium, and the mycelium was grown in the middle of the PDA and cultured in a 28°C incubator in the dark.
[0173] (2) Pick Fusarium verticillata mycelium blocks from mung bean culture medium, incubate on a shaker at 28℃ for 2 hours, filter the bacterial solution through four layers of gauze, centrifuge at 1000g for 5 minutes, discard the supernatant, add an appropriate amount of sterile ddH2O to completely dissolve the mycelium blocks, count them using a hemocytometer, and dilute to 1×10⁻⁶. 6 pcs / ml;
[0174] (3) Stem rot: Draw 500 μl of bacterial solution into a 1 ml syringe and inject it into the third internode of the corn. Seal the inoculation site. Two weeks later, cut off the third node and split it in half to count the lesion grade. There are 5 grades (1-5), with the larger the diseased area, the higher the grade. The ZmFS1 mutant line is more resistant to stem rot than its corresponding wild-type line. The identification results are as follows: Figure 8 As shown in A and B in the diagram;
[0175] (4) Seed rot: Wash seeds with 70% ethanol for 5 min, then with sterile water for 1 min; wash with 2.5% sodium hypochlorite for 10 min, and finally rinse with sterile water for 5 min * 3 times. Dry the seeds and make a cut on the embryo side with a blade. Place 4 seeds in a 20 ml bottle, inoculate with 200 μL of spore suspension, vortex to coat the seeds evenly with the suspension, slightly loosen the cap, and place in a plastic container to create a humidity chamber; culture at 28℃ for 3-7 days. The ZmFS1 mutant line is more resistant to seed rot than its corresponding wild-type line. The identification results are as follows: Figure 8 As shown in C and D.
[0176] 5. Disease resistance identification of maize southern rust
[0177] In November, corn was planted in Hainan, and the phenotype of Southern Rust was observed in the field after flowering. The disease was graded according to its severity, with a total of 9 levels (1-9), where the larger the affected area, the higher the level. Figure 9 As shown, the ZmFS1 mutant line is more resistant to southern rust than its corresponding wild type.
[0178] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. ZmFS1 The application of genes in the prevention and control of maize diseases is characterized by, By inhibiting corn ZmFS1 Gene expression levels are achieved, the aforementioned ZmFS1 The nucleotide sequence of the gene's cDNA is shown in SEQ ID NO. 1; The corn diseases mentioned are small leaf spot, large leaf spot, southern rust, stalk rot, and seed rot.
2. A method for preventing and controlling corn diseases, characterized in that, By inhibiting corn ZmFS1 Gene expression levels are achieved; the aforementioned ZmFS1 The nucleotide sequence of the cDNA of the gene is shown in SEQ ID NO.
1. The maize diseases mentioned are small leaf spot, large leaf spot, southern rust, stalk rot and seed rot.
3. A method for breeding maize, characterized in that, The steps include: inhibiting the growth of certain substances in corn. ZmFS1 The expression level of genes, thereby enabling maize to resist small leaf spot, large leaf spot, southern rust, stalk rot, and seed rot; ZmFS1 The nucleotide sequence of the gene's cDNA is shown in SEQ ID NO. 1.
Citation Information
Patent Citations
Disease resistant plants
CN101617049A
Methods and compositions for increasing harvestable yield via editing ga20 oxidase genes to generate short stature plants
CN112567041A