Rpa-lfd primer probe, kit for detecting infectious spleen and kidney necrosis virus and its subtypes and application thereof

Abstract

The application relates to RPA-LFD primer probes, kits and applications for detecting infectious spleen and kidney necrosis virus and subtypes thereof, comprising the following steps: performing multi-sequence alignment on four subgenotypes of ISKNV susceptible to Siniperca chuatsi; and utilizing the characteristics that RPA can tolerate a small amount of base mismatch between a template and a primer, optimizing mutation of non-conserved bases on a target fragment of the primer, so as to reduce a doublet structure formed between the primer and the probe; and the designed primer and probe combination can increase the detection rate of the ISKNV subgenotypes, reduce false positives caused by primer dimers, and thus improve the accuracy of the detection result as a whole.

Description

Technical Field

[0001] This invention belongs to the field of virus detection technology, specifically relating to RPA-LFD primers, probes, kits, and applications for detecting infectious spleen and kidney necrosis virus and its subtypes. Background Technology

[0002] Mandarin fish (Siniperca chuatsi) is a high-quality freshwater fish species in my country, prized for its delicious and nutritious flesh. However, with the continuous expansion of mandarin fish farming, disease problems have become a major bottleneck restricting the industry's development. In recent years, Infection spleen and kidney necrosis virus (ISKNV) has caused significant damage to mandarin fish farming. This virus belongs to the family Iridoviridae and the genus Megeaocytovirus. ISKNV has three genotypes: red sea bream iridovirus (RSIV), infectious spleen and kidney necrosis virus (ISKNV), and turbot red body disease iridovirus (TRBIV). These genotypes are further subdivided into six subgenotypes (ISKNV-I, ISKNV-II, RSIV-I, RSIV-II, TRBIV-I, and TRBIV-II). Current research has found that both RSIV and ISKNV can infect mandarin fish, while TRBIV only infects marine fish such as flatfish and rarely infects other fish species. ISKNV is highly contagious and has a high mortality rate, and there is currently no effective treatment. Therefore, rapid and accurate detection of ISKNV is of great significance for the healthy aquaculture of mandarin fish.

[0003] Currently, the detection and identification of ISKNV mainly rely on conventional PCR, nested PCR, and quantitative real-time PCR. These methods require complex instruments and equipment, making rapid detection at the breeding site impossible. Recombinase polymerase amplification (RPA) is an isothermal DNA amplification technique that amplifies specific oligonucleotide sequences by reacting at a constant temperature of 30-45℃ for 10-30 minutes. The amplification products can be visually interpreted using lateral flow dipsticks (LFD).

[0004] Current detection methods for ISKNV primarily target a single ISKNV genotype, neglecting other genotypes and potentially leading to missed detections. Therefore, there is an urgent need to develop a rapid detection method that can simultaneously detect four subgenotypes of mandarin fish susceptibility (ISKNV-Ⅰ, ISKNV-Ⅱ, RSIV-Ⅰ, RSIV-Ⅱ) on-site. Summary of the Invention

[0005] This invention provides a primer and probe combination for detecting infectious spleen and kidney necrosis virus and its subtypes, wherein the primers include: forward primer ISKNV-F: CTCATCAGCCAGAGCAACCAGGCCGACA, and reverse primer ISKNV-R: CCTCAACCTCACGCTCCTCCCTTCTCAGTA; the probes include probe ISKNV-P: TGGCCATATCGACCGTCACCATGGCTAACA / THF / TGGCAATGTAGCACCCG.

[0006] Furthermore, the 5' end of the reverse primer ISKNV-R is connected to Biotin, the 5' end of the probe is labeled with carboxyfluorescein FAM, the 3' end is added with an extension blocking group C3 Spacer, and the 31st position of the probe sequence is not a base, but tetrahydrofuran (THF).

[0007] The present invention also provides a kit for detecting infectious spleen and kidney necrosis virus and its subtypes, comprising any of the primer and probe combinations described above.

[0008] Furthermore, the kit includes a dual microsphere system, a disposable diluent, and a nucleic acid test strip. The dual microsphere system includes microsphere 1 and microsphere 2, wherein microsphere 1 contains an RPA-LFD primer and probe combination, a recombinase that binds to single-stranded nucleic acids, a single-stranded DNA binding protein, and a strand displacement DNA polymerase, and microsphere 2 contains a rehydration buffer and a magnesium acetate solution.

[0009] Furthermore, the primer concentration was 1-20 μmol / L, and the probe concentration was 0.625-5 μmol / L.

[0010] Furthermore, the primer concentration was 10 μmol / L and the probe concentration was 2.5 μmol / L.

[0011] This invention also provides the application of any of the primer and probe combinations or kits described above in any of the following:

[0012] A1) Application in the detection of infectious spleen and kidney necrosis virus for non-disease diagnostic purposes;

[0013] A2) Application in the preparation of products for detecting infectious spleen and kidney necrosis virus.

[0014] This invention also provides a method for detecting infectious spleen and kidney necrosis virus for non-disease diagnostic purposes, using any of the above-described kits, the method comprising the following steps:

[0015] S1. Extract nucleic acid from the sample to be tested;

[0016] S2. Add 25 μL of the nucleic acid extracted in step S1 to the dual microsphere system, mix well, and start the reaction immediately. After the reaction is completed, the amplification product is obtained.

[0017] S3. After diluting the amplification product with disposable diluent, analyze the amplification product obtained in step S2 using a nucleic acid test strip.

[0018] Furthermore, nucleic acid test strips are used to determine the amplification products: the presence of bands on both the control line (C) and the test line (T) on the test strip indicates a positive result; the presence of a band on the control line (C) but no band on the test line (T) indicates a negative result; and the absence of a band on the control line (C) indicates an invalid reaction.

[0019] Furthermore, the reaction temperature of the kit is 25-45℃, preferably 39℃; the reaction time is 10 min or more, preferably 15 min.

[0020] Beneficial effects:

[0021] (1) Time saving: RPA reaction has lower requirements for the purity of template nucleic acid and can be used in conjunction with commercially available rapid nucleic acid release agents, which can save time for nucleic acid extraction and purification; and conventional PCR takes at least 1 hour to complete one reaction, while RPA amplification time is at most 30 minutes. This invention can even detect as low as 10 after 15 minutes of reaction. 1 The viral copies / μL significantly shortened the time for nucleic acid amplification.

[0022] (2) Lower the reaction temperature: RPA can be completed under constant temperature conditions of 25-45℃, which is much lower than the 60-95℃ of PCR.

[0023] (3) Simple operation: The enzymes, RPA-LFD primer-probe combination, and buffer required for amplification are all pre-prepared as lyophilized microspheres. During amplification, simply add the extracted nucleic acid to the dual microsphere system, mix well, and the reaction can be started. The detection method of this invention has low requirements for the professional skills of operators, is suitable for on-site detection in fish farms, and can also be used for scientific research on infectious spleen and kidney necrosis virus.

[0024] (4) High specificity: The kit of the present invention contains probe sequences, which increases the specificity of detection.

[0025] (5) High sensitivity and easy interpretation of results: The sensitivity is comparable to or even higher than that of conventional PCR widely used in molecular detection laboratories; and the results can be directly observed through the test strip. If both the test line and the control line show color, it can be determined that ISKNV is positive.

[0026] (6) Increase the accuracy of detection results: This invention performs multiple sequence alignment on four subgenotypes of ISKNV susceptible to mandarin fish, and takes advantage of the characteristic that RPA can tolerate a small number of base mismatches between the template and the primer. The non-conservative bases are mutated and optimized on the target fragment of the primer to reduce the dimer structure formed between the primer and the probe. The designed primer and probe combination not only increases the detection rate of multiple subgenotypes of ISKNV, but also reduces false positives caused by primer dimers, thereby improving the overall accuracy of detection results. Attached Figure Description

[0027] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0028] Figure 1 Demonstration of primer and probe locations and point mutation optimization on target genes.

[0029] Figure 2 Optimize the reaction conditions of the RPA-LFD detection system, including: (A) the effect of different probe concentrations on RPA-LFD amplification; (B) the effect of different reaction temperatures on RPA-LFD amplification; and (C) the effect of different reaction times on RPA-LFD amplification.

[0030] Figure 3 Results of RPA-LFD specificity detection.

[0031] Figure 4 The sensitivity of PCR and RPA-LFD was detected using the pMD18-MCP plasmid, where: (A) PCR detection results; (B) RPA-LFD detection results.

[0032] Figure 5 Target fragments of four ISKNV subtypes were synthesized to test the compatibility of RPA-LFD. Detailed Implementation

[0033] The following embodiments are only used to more clearly illustrate the technical solutions of the present invention, and are therefore merely examples and should not be used to limit the scope of protection of the present invention. It should be noted that, unless otherwise stated, the technical or scientific terms used in this application should have the ordinary meaning understood by those skilled in the art. Unless specifically stated, the reagents, methods, and equipment used in this invention are conventional reagents, methods, and equipment in this technical field. Unless specifically stated, the reagents and materials used in the following embodiments are commercially available.

[0034] In some embodiments, the product is analyzed by 2% agarose gel electrophoresis.

[0035] In some embodiments, nucleic acid test strips are used to analyze the products: the presence of bands on both the control line and the test line indicates a positive result; the presence of a band on the control line but no band on the test line indicates a negative result; and the absence of a band on the control line indicates an invalid reaction.

[0036] It should be noted that the DNA isothermal rapid detection kit (product number: WLN8203KIT) and nucleic acid detection test strip (product number: WLFS8204) in the following examples were all purchased from Weifang Anpu Future Biotechnology Co., Ltd., China. The 25μL dual microsphere system was customized by Suzhou Geneno Biomedical Technology Co., Ltd.

[0037] Example 1: Design and optimization of ISKNV RPA-LFD primer pairs and probe sequences

[0038] (1) Design of primer pairs and probe sequences

[0039] This invention downloaded the gene sequences of the major capsid proteins (MCPs) of four subgenotypes of ISKNV published in GenBank (AB104413.1, AY779031.1, KC775382.1, AY894343.1, AF371960, HQ317460.1, AB666339.1, ON743043.1, AB669096.1, HM067835.1). After confirming the designed fragments through multiple sequence alignment using DNAMAN, primer pairs and probe sequences were designed using Primer Premier 5.0 according to the design principles of RPA primers and probes. BLAST was then used for sequence alignment analysis to determine the specificity of the primer pairs and probes.

[0040] (2) Optimization of reverse primer and probe sequences

[0041] Because RPA reactions are tolerant of mismatches, meaning they can tolerate a small number of base mismatches between the template and the primer or probe, this characteristic allows for some flexibility in modifying primer and probe sequences. This invention used Primer Premier 5.0 software to perform a one-by-one alignment analysis of the reverse primer and probe sequences, and optimized the bases according to the following principles: if three or more bases are consecutively paired, it is considered likely to form primer dimers and base optimization should be performed; mismatches at the 5' end or in the middle of the primer have a smaller impact on the RPA reaction, while mismatches at the 3' end have a larger impact; therefore, only the 5' end or middle bases of the primer are modified; consecutive modification of two adjacent bases is avoided; after confirming mismatched bases on the primer, mutation optimization is performed on non-conserved bases in the target fragment whenever possible. Figure 1 As shown, the red bases on the primers are bases that have been artificially optimized by the inventors.

[0042] The following are the optimized primer pairs and probe combinations (primer pairs and probes were synthesized by Qingke Biotechnology Co., Ltd.):

[0043]

[0044] The reverse primer ISKNV-R has a biotin attached to its 5' end; the probe's 5' end is labeled with carboxyfluorescein FAM, and the 3' end has an extension blocking group C3 Spacer added. The 31st position of the probe sequence is not a base, but tetrahydrofuran (THF).

[0045] Example 2: Optimization of the reaction system and conditions for ISKNV RPA-LFD

[0046] (1) Extraction of viral genomic DNA

[0047] Genomic nucleic acid was extracted from mandarin fish tissue (mixed liver, spleen, and kidney samples) infected with ISKNV according to the instructions of the viral DNA / RNA extraction kit (purchased from Yisheng Biotechnology (Shanghai) Co., Ltd.), and finally eluted with 30 μL of DNase- and RNase-free water. The extracted DNA was stored at -20℃ for later use.

[0048] (2) RPA-LFD reaction system

[0049] The reaction system consisted of 2 μL of forward primer (10 μM), 2 μL of reverse primer (10 μM), 0.6 μL of probe (10 μM), 2 μL of DNA template (DEPC water was used as the template for the template-free control group), 11.5 μL of LEPC water, and 29.4 μL of Abuffer. These were added to a reaction tube containing lyophilized enzyme powder. 2.5 μL of starter buffer B was added to the reaction tube cap. The tubes were then capped, centrifuged, and vortexed to mix, ensuring a consistent start-up time.

[0050] Result interpretation: Take 10 μL of amplification product and dilute it with ddH2O to a total volume of 200 μL. Then add 80 μL of the diluted product to the nucleic acid test strip for color development. The color development time should be controlled within 10 min.

[0051] The amplification products are analyzed using nucleic acid test strips: a positive result is indicated when both the control line (C) and the test line (T) on the test strip show bands; a negative result is indicated when the control line (C) shows a band but the test line (T) does not show a band; and an invalid result is indicated when the control line (C) shows no band.

[0052] (3) Probe concentration optimization

[0053] The optimal initial probe concentration for RPA-LFD was investigated. Initial probe concentrations were set at 10 μM, 5 μM, 2.5 μM, 1.25 μM, and 0.625 μM, with a corresponding template-free control group (i.e., DEPC water as template). The reaction was carried out at 39℃ for 15 min. The results are as follows: Figure 2 As shown in Figure A, when the initial probe concentration is 10 μM, a false positive band appears in the template-free control group. When the initial probe concentration drops to 5 μM or below, the template-free control group shows a normal negative result. When the initial probe concentration is 2.5 μM, the detection band of the positive control group is basically the same as that at 5 μM. To avoid false positive results due to excessively high probe concentration, 2.5 μM is selected as the optimal initial concentration of the RPA-LFD probe.

[0054] (4) Optimization of reaction temperature

[0055] The optimal reaction temperature for the RPA-LFD method was determined by testing eight different reaction temperatures: 25℃, 30℃, 35℃, 37℃, 39℃, 41℃, 45℃, and 50℃, with an incubation time set at 15 min. The test results are as follows: Figure 2 As shown in Figure B, positive samples can be detected within a reaction temperature range of 25-45℃. The clearest positive band on the test strip is observed at a reaction temperature of 39℃. Therefore, the optimal reaction temperature for this method is approximately 39℃.

[0056] (5) Optimization of reaction time

[0057] The optimal reaction time for the RPA-LFD method was determined by setting six different times at 39℃: 1 min, 5 min, 10 min, 15 min, 20 min, and 25 min. The detection results are as follows: Figure 2 As shown in Figure C, a weak positive band appeared on the test strip after 5 minutes of reaction. A positive sample could be detected when the reaction time was 10 minutes or longer. To ensure more stable test results, we chose 15 minutes as the reaction time for subsequent experiments.

[0058] Example 3: ISKNV RPA-LFD Specific Detection

[0059] ISKNV RPA-LFD Specificity Detection: Genomic nucleic acids of ISKNV, mandarin frog iridovirus (MRV), neural necrosis virus (NNV), mandarin frog rhabdovirus (SCRV), and Aeromonas hydrophila were extracted and preserved in our laboratory. The specificity of RPA-LFD was detected using nucleic acids from ISKNV, MRV, NNV, SCRV, and Aeromonas hydrophila as templates, respectively. A template-free control group (NTC) was also included. Results are as follows: Figure 3 As shown, only the reaction using ISKNV as a template showed a positive band on the test strip, while other pathogens showed negative results, indicating that this method is specific for detecting ISKNV.

[0060] Example 4: ISKNV RPA-LFD Sensitivity Detection

[0061] (1) Constructing the ISKNV-MCP plasmid:

[0062] The PCR primers for amplifying the ISKNV MCP gene are shown below:

[0063] Forward primer: 5'-CCAGCGGGTTCATCGACATCTCC-3'

[0064] Reverse primer: 5'-CGCCGTCAGCAATCTTCATGATG-3'

[0065] The reaction system consisted of 1 μL of forward primer (10 μM), 1 μL of reverse primer (10 μM), 1 μL of template, 10 μL of 2×TaqMaster Mix (Nanjing Novizan Biotechnology Co., Ltd.), and 7 μL of ddH2O.

[0066] The amplification program was as follows: 94℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 30 cycles; and 72℃ extension for 10 min.

[0067] PCR products were identified by electrophoresis on a 2% agarose gel. The PCR products were recovered using an agarose gel DNA recovery kit (purchased from Guangzhou Meiji Biotechnology Co., Ltd.), ligated into the pMD18-T cloning vector (TAKARA), transformed into *E. coli* competent cells DH5α (purchased from Beijing TransGen Biotech Co., Ltd.), and plated on LB agar plates containing 100 mg / L ampicillin, incubated at 37°C for 12 h. Positive single colonies were screened and cultured overnight at 37°C in liquid medium containing ampicillin. Finally, plasmids were extracted using a plasmid mini-extraction kit (purchased from Tiangen Biotech Co., Ltd.), and sent to Qingke Biotechnology Co., Ltd. for sequencing. After sequencing confirmed the pMD18-MCP plasmid as positive, the concentration of the extracted pMD18-MCP plasmid was measured using a Nanodrop-2000 spectrophotometer.

[0068] According to the formula for calculating the copy number: Copy number (copies) / μL = 6.02 × 10⁻⁶ 23 × plasmid concentration (ng / μL) × 10 -9 Calculate the copy number of the extracted recombinant plasmid pMD18-MCP using the formula / (plasmid base number × 660), and then dilute it to 10^6. 7 copies / μL. For a concentration of 10... 7 Plasmids with copies / μL were serially diluted 10-fold to select a copy number of 10. 7 ~10 0 Using a plasmid of copies / μL as a template, the following reaction was carried out.

[0069] (2) RPA-LFD reaction was carried out using plasmid as a template.

[0070] The reaction mixture consisted of 2 μL of forward primer (10 μM), 2 μL of reverse primer (10 μM), 0.6 μL of probe (2.5 μM), 2 μL of plasmid template, 11.5 μL of DEPC water, and 29.4 μL of Abuffer, all added to a reaction tube containing lyophilized enzyme powder. 2.5 μL of starter buffer B was added to the tube cap. The tubes were then capped, centrifuged, and vortexed to mix, ensuring a consistent start-up time. The amplification reaction was carried out at 39 °C for 15 min.

[0071] Result interpretation: Take 10 μL of amplification product and dilute it with ddH2O to a total volume of 200 μL. Then add 80 μL of the diluted product to the nucleic acid test strip for color development. The color development time is controlled at 10 min.

[0072] The amplification products are analyzed using nucleic acid test strips: a positive result is indicated when both the control line (C) and the test line (T) on the test strip show bands; a negative result is indicated when the control line (C) shows a band but the test line (T) does not show a band; and an invalid result is indicated when the control line (C) shows no band.

[0073] (3) Perform routine PCR detection using plasmid as a template.

[0074] The PCR primer pairs used were those specified in the industry standard "Detection Method for Infectious Splenectomy and Renal Necrosis Virus" (SC / T 7211-2011), and their nucleotide sequences are shown below:

[0075] ISKNV-F: 5'-CGTGAGACCGTGCGTAGT-3'

[0076] ISKNV-R: 5'-AGGGTGACGGTCGATATG-3'

[0077] The reaction system consisted of 1 μL of forward primer, 1 μL of reverse primer, 1 μL of template, 10 μL of 2×Taq Master Mix (Nanjing Novizan Biotechnology Co., Ltd.), and 7 μL of ddH2O.

[0078] Amplification program: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 30 s, 61℃ annealing for 45 s, 72℃ extension for 1 min, 30 cycles; 72℃ extension for 7 min.

[0079] Finally, the PCR products were identified by electrophoresis on a 2% agarose gel.

[0080] Test results as follows Figure 4 As shown, the PCR detection limit is 10. 3 copies / μL, while RPA-LFD can detect concentrations of 10 at a reaction time of 15 min. 1 ISKNV at copies / μL is two orders of magnitude more sensitive than PCR.

[0081] In summary, the RPA-LFD detection method and primer probes for ISKNV established in this invention have high sensitivity.

[0082] Example 5: Compatibility testing of ISKNV RPA-LFD with four subgenotypes

[0083] To improve the convenience of using the testing kit in fish farms, the optimized testing reagents were integrated into lyophilized dual microspheres for testing. The dual microsphere reaction system is as follows: Microsphere 1: contains 10 μmol / L forward primer, 10 μmol / L reverse primer, 2.5 μmol / L probe, recombinase for binding single-stranded nucleic acid, single-stranded DNA binding protein, and strand displacement DNA polymerase; Microsphere 2: contains rehydration buffer and magnesium acetate solution. The reaction only requires the addition of 2 μL of purified nucleic acid and 23 μL of DEPC water, or directly the addition of 25 μL of supernatant from rapid nucleic acid release products. After mixing, the reaction can be started at 39°C.

[0084] (1) Synthesize four ISKNV subtype MCP target fragments and construct plasmids.

[0085] pUC57 plasmids (synthesized by Qingke Biotechnology Co., Ltd.) containing four ISKNV subgenotype MCP target fragments were diluted to 1 ng / μL as detection samples, with DEPC water used as a template-free control group. The nucleotide sequence information of the four ISKNV subgenotype MCP target fragments is as follows:

[0086] AF371960(ISKNV-Ⅰ):

[0087] AAGCTGCGGCGCTGGGAGGACCTGCTCATCAGCCAGAGCAACCAGGCCGACATGGCCATATCGACCGTCACCCTGGCTAACATTGGCAATGTAGCACCCGCACTGACCAATGTGTCTGTGATGGGCACTTACGCTGTACTGACAAGCGAGGAGCGTGAGGTGGTGGCCCAGTCTAGTCGTAGCATGCTCATTGAACAGTG

[0088] AB669096.1(ISKNV-Ⅱ):

[0089] AAGCTGCGGCGCTGGGAGGACCTGCTCATCAGCCAGAGCAGCCAGGCCGACATGGCCATATCAACCGTCACCCTGGCTAACATTGGCAATGTAGCACCTGCACTAACCAATGTGTCTGTGATGGGCACTTACGCTGTGCTGACAAGCGAGGAGCGTGAGGTGGTGGCCCAGTCTAGTCGTAGCATGCTCATTGAACAGTG

[0090] AB104413.1(RSIV-Ⅰ):

[0091] AAGCTGCGGCGCTGGGAGGACCTGCTCATCAGCCAGAGCACCCAGGCTGACATGGCCATATCGACTGTCACCGTGGCTAACATTGGCAATGTAACACCCGCACTGACCAACGTGTCCGTGATGGGCACCTACGCCGTACTGACAAGTGAGGAGCGTGAGGTCGTGGCCCAGTCTAGCCGTAGCATGCTCATTGAACAGTG

[0092] AY894343.1(RSIV-Ⅱ):

[0093] AAGCTGCGGCGCTGGGAGGACCTGCTCATCAGCCAGAGCACCCAGGCCGACATGGCCATATCGACTGTCACCCTGGCTAACATTGGCAATGTAGCACCCGCACTGACCAACGTGTCCGTGATGGGCACCTACGCTGTACTGACAAGTGAGGAGCGTGAGGTTGTGGCCCAGTCTAGCCGTAGCATGCTCATTGAGCAGTG

[0094] (2) RPA-LFD reaction was performed using plasmids of four ISKNV subgenotypes as templates.

[0095] Add 2 μL of template plasmid to 23 μL of DEPC water, mix well, and then add it to 25 μL of the dual microsphere system. After shaking and mixing, react at 39 °C for 15 min.

[0096] Result interpretation: Dilute 10 μL of the amplification product with ddH2O to a total volume of 200 μL, then add 80 μL of the diluted product to the nucleic acid test strip for color development. The color development time is controlled at 10 min. Analyze the amplification product using the nucleic acid test strip: the presence of bands on both the control line (C) and the test line (T) on the test strip indicates a positive result; the presence of a band on the control line (C) but no band on the test line (T) indicates a negative result; if there is no band on the control line (C), the reaction is invalid.

[0097] The results are as follows Figure 5 As shown, all four ISKNV subgenotypes can produce positive bands, indicating that the primer and probe combination of the present invention is compatible with the detection of the four ISKNV subgenotypes. This not only increases the detection rate of multiple ISKNV subgenotypes, but also reduces false positives caused by primer dimers, thereby improving the overall accuracy of the detection results.

[0098] The above detailed embodiments describe the implementation of the present invention; however, the present invention is not limited to the specific details described in the above embodiments. Within the scope of the claims and technical concept of the present invention, various simple modifications and changes can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

Claims

1. A primer and probe combination for detecting infectious spleen and kidney necrosis virus and its subtypes, characterized in that, The primers include: forward primer ISKNV-F: CTCATCAGCCAGAGCAACCAGGCCGACA, and reverse primer ISKNV-R: CCTCAACCTCACGCTCCTCCCTTCTCAGTA; the probes include probe ISKNV-P: TGGCCATATCGACCGTCACCATGGCTAACA / THF / TGGCAATGTAGCACCCG; The reverse primer ISKNV-R has a biotin attached to its 5' end, the 5' end of the probe is labeled with carboxyfluorescein FAM, the 3' end has an extension blocking group C3 Spacer, and the 31st position of the probe sequence is not a base, but tetrahydrofuran (THF). The RPA-LFD primer and probe combination is compatible with the detection of four ISKNV subtypes: ISKNV-I, ISKNV-II, RSIV-I, and RSIV-II.

2. A kit for detecting infectious spleen and kidney necrosis virus and its subtypes, characterized in that, It includes the primer and probe combination as described in claim 1.

3. The reagent kit according to claim 2, characterized in that, The kit contains a dual microsphere system, disposable diluent, and nucleic acid test strips. The dual microsphere system includes microsphere 1 and microsphere 2. Microsphere 1 contains an RPA-LFD primer and probe combination, a recombinase that binds to single-stranded nucleic acids, a single-stranded DNA binding protein, and a strand displacement DNA polymerase. Microsphere 2 contains a rehydration buffer and a magnesium acetate solution.

4. The kit according to any one of claims 2-3, characterized in that, Primer concentrations ranged from 1 to 20 μmol / L, and probe concentrations ranged from 0.625 to 5 μmol / L.

5. The reagent kit according to claim 4, characterized in that, The primer concentration was 10 μmol / L, and the probe concentration was 2.5 μmol / L.

6. The use of the primer and probe combination of claim 1 or the kit of any of claims 2-5 in any of the following: A1) Application in the detection of infectious spleen and kidney necrosis virus for non-disease diagnostic purposes; A2) Application in the preparation of products for detecting infectious spleen and kidney necrosis virus; The infectious spleen and kidney necrosis virus mentioned therein includes four subgenotypes: ISKNV-I, ISKNV-II, RSIV-I, and RSIV-II.

7. A method for detecting infectious spleen and kidney necrosis virus for non-disease diagnostic purposes, characterized in that, The detection is performed using the kit described in any one of claims 3-5, and the method includes the following steps: S1. Extract nucleic acid from the sample to be tested; S2. Add 25 μL of the nucleic acid extracted in step S1 to the dual microsphere system, mix well, and start the reaction immediately. After the reaction is completed, the amplification product is obtained. S3. After diluting the amplification product with disposable diluent, analyze the amplification product obtained in step S2 using a nucleic acid test strip.

8. The method according to claim 7, characterized in that, The amplification products are determined using nucleic acid test strips: a positive result is indicated when both the control line (C) and the test line (T) on the test strip show bands; a negative result is indicated when the control line (C) shows a band but the test line (T) does not show a band; and an invalid result is indicated when the control line (C) shows no band.

9. The method according to any one of claims 7-8, characterized in that, The reaction temperature of the kit is 25-45℃; the reaction time is more than 10 minutes.

10. The method according to claim 9, characterized in that, The reaction temperature of the kit is 39℃, and the reaction time is 15 min.

Images