Delivery systems targeting inhibition of gdf8 and uses thereof

Abstract

The application provides a delivery system for targeted inhibition of GDF8, including RNA capable of inhibiting GDF8 gene expression and a delivery carrier; the delivery carrier carrying the RNA and a targeting element self-assemble to form a complex structure in the organs and tissues of a mammal, the complex structure finds and delivers the RNA capable of inhibiting GDF8 gene expression into a target tissue through the targeting element, and inhibits GDF8 expression in the target tissue. The application has the beneficial effect that: the application develops a targeted treatment method for tumor-induced muscle atrophy disorders by using an siRNA in-vivo self-assembly delivery system; the method can use the mammal's own organs as a natural biological reactor, utilize an endogenous miRNA secretion mechanism, assemble, process and secrete exosome-wrapped siRNA capable of targeting GDF8 into the circulatory system, and finally effectively deliver the siRNA drug into the muscle to treat tumor-induced muscle atrophy disorders.

Description

Technical Field

[0001] This application relates to the field of biomedical technology, specifically to a delivery system that targets and inhibits GDF8 and its application in the preparation of products for treating muscular dystrophy. Background Technology

[0002] Lewis lung cancer is a cell line (LLC) established from the lungs of C57BL mice carrying tumors resulting from the implantation of primary Lewis lung cancer. It is widely used as a model of metastasis and can be used to study the mechanisms of cancer chemotherapy agents.

[0003] RNAi drugs have provided a new direction for research on muscle atrophy. RNA interference (RNAi) is a ubiquitous gene silencing phenomenon in organisms, mediated by small interfering RNA (siRNA) and involving specific enzymes. It blocks gene expression at the transcriptional, post-transcriptional, and translational levels, thereby exerting its biological effects. It is now clear that siRNA can be produced endogenously by cells, i.e., cleaved by the endonuclease Dicer from linear long double-stranded RNA, or introduced exogenously to exert its effects directly. Figure 2 By designing suitable siRNAs, RNAi can theoretically be used to silence almost all genes. This species-conserved, efficient, and sequence-specific gene silencing technology can not only be used for basic research by knocking down specific genes, but also has great potential to become a new type of drug to interfere with the expression of disease-causing genes, thereby playing a role in gene therapy. Summary of the Invention

[0004] To address the aforementioned technical limitations, this application proposes a delivery system for targeting and inhibiting GDF8 and its application in the preparation of products for treating muscular dystrophy; it overcomes the deficiencies and defects mentioned in the background art.

[0005] To achieve the above objectives, this application adopts the following technical solution:

[0006] The inventive point of this application is to provide a delivery system for targeting and inhibiting GDF8, the delivery system comprising: RNA capable of inhibiting GDF8 gene expression and a delivery vector; the delivery vector carrying RNA capable of inhibiting GDF8 gene expression and a targeting element self-assemble in mammalian organs and tissues to form a composite structure, the composite structure using the targeting element to locate and deliver RNA capable of inhibiting GDF8 gene expression into the target tissue, thereby inhibiting GDF8 expression in the target tissue.

[0007] Optionally, in the above-described targeted GDF8 inhibition delivery system, the RNA capable of inhibiting GDF8 gene expression includes: a promoter element and at least one of siRNA capable of inhibiting GDF8 gene expression and encoding siRNA.

[0008] Optionally, in the above-described delivery system for targeting and inhibiting GDF8, the nucleotide sequence of the siRNA capable of inhibiting GDF8 gene expression is any one of SEQ ID No. 1 to SEQ ID No. 4;

[0009] SEQ ID No. 1:

[0010] TAATGATTGTTTCCGTGGTAGGTTTTGGCCACTGACTGACCTACCACG AACAATCATTA;

[0011] SEQ ID No. 2:

[0012] TAGAAAGTCAGACTCTGTAGGGTTTTGGCCACTGACTGACCCTACAG ACTGACTTTCTA;

[0013] SEQ ID No. 3:

[0014] AACATTTGGGCTTGCCATCCGGTTTTGGCCACTGACTGACCGGATGG CGCCCAAATGTT;

[0015] SEQ ID No.4:

[0016] TCAATACTCTGCCAAATACCAGTTTTGGCCACTGACTGACTGGTATTT CAGAGTATTGA.

[0017] The nucleotide sequences encoding the positive strand of the siRNA that can inhibit GDF8 gene expression are any one of SEQ ID No. 5 to SEQ ID No. 8;

[0018] SEQ ID No.5: CUACCACGAACAAUCAUUA;

[0019] SEQ ID No.6:CCUACAGACUGACUUUCUA;

[0020] SEQ ID No.7: CGGAUGGCGCCCAAAUGUU;

[0021] SEQ ID No. 8: UGGUAUUUCAGAGUAUUGA.

[0022] The nucleotide sequences encoding the antisense strand of the siRNA that can inhibit GDF8 gene expression are any one of SEQ ID No. 9 to SEQ ID No. 12;

[0023] SEQ ID No.9: UAAUGAUUGUUUCCGUGGUAG;

[0024] SEQ ID No.10: UAGAAAGUCAGACUCUGUAGG;

[0025] SEQ ID No.11: AACAUUUGGGCUUGCCAUCCG;

[0026] SEQ ID No. 12: UCAAUACUCUGCCAAAUACCA.

[0027] Optionally, in the above-described delivery system for targeting and inhibiting GDF8, the composite structure is an exosome.

[0028] Optionally, in the above-described targeted GDF8 delivery system, the targeting element includes one, two, or more targeting sequences.

[0029] The target sequence was selected as MSP muscle-targeting peptide, and the specific sequence is shown in SEQ ID No. 13.

[0030] SEQ ID No. 13: ASSLNIA;

[0031] The nucleotide sequence encoding the MSP muscle-targeting peptide is shown in SEQ ID No. 14.

[0032] SEQ ID No. 14: gccagcagcctgaacatcgcc.

[0033] Optionally, in the above-described delivery system for targeting and inhibiting GDF8, the delivery vector is a plasmid vector or a viral vector.

[0034] Optionally, in the above-described delivery system for targeting and inhibiting GDF8, the viral vector includes at least one of a retroviral vector, a lentiviral vector, an adenovirus vector, and an adeno-associated virus vector.

[0035] The second inventive point of this application is to provide the application of the above-mentioned targeted GDF8 inhibitory delivery system in the preparation of products for treating muscular dystrophy.

[0036] Optionally, in the above applications, the product for treating muscular dystrophy includes reagents that inhibit GDF8 gene expression and drugs that have preventive and / or therapeutic effects on muscular dystrophy.

[0037] Optionally, in the above application, the muscle atrophy disease is tumor-induced muscle atrophy, preferably Lewis lung cancer cell-induced muscle atrophy.

[0038] The beneficial effects of this application are as follows: This application utilizes the in vivo self-assembly delivery system of siRNA to develop a targeted therapy for tumor-induced muscular atrophy. This method can use the mammal's own organs as a natural bioreactor, utilize the endogenous miRNA secretion mechanism to assemble, process, and secrete siRNA encapsulated in exosomes that can target GDF8 into the circulatory system, and ultimately effectively deliver siRNA drugs into the muscle to treat tumor-induced muscular atrophy.

[0039] The GDF8-targeting delivery system provided in this application and its application in the preparation of products for treating muscular dystrophy have the following advantages compared with the prior art:

[0040] 1) Effectiveness: Based on synthetic biological elements, using human organs as natural bioreactors, and with the help of the miRNA processing and maturation mechanism of eukaryotic cells, siRNA is generated and self-assembled into exosomes, enters the circulatory system and reaches various major organs.

[0041] 2) Safety: This delivery system utilizes a naturally occurring secretion mechanism, thus avoiding the toxicity caused by using various carriers;

[0042] 3) Targeting: Delivery systems with muscle-specific targeting elements can deliver siRNA to muscle tissue, improving delivery efficiency while avoiding potential side effects;

[0043] 4) Upgradeability: The targeting elements and genes can be adjusted according to the needs of different muscle disease treatments to adapt to the needs of personalized treatment;

[0044] 5) Easy to produce: This delivery system is based on plasmid vectors, which are easy to produce and purify industrially. Compared with other siRNA delivery methods, it greatly reduces the difficulty and cost of production. Attached Figure Description

[0045] Figure 1 The diagram shown is a design of a self-assembled plasmid in one embodiment of this application (the self-assembled plasmid includes the targeting peptide MSP and siRNA). GDF-8 ).

[0046] Figure 2As shown in one embodiment of this application, in vivo self-assembled siRNA GDF-8 A flowchart.

[0047] Figure 3 The image shows the detection results of mature siRNA in intracellular and supernatant exosomes 24 hours after 293T cells were transfected with a gene loop, as described in one embodiment of this application.

[0048] Figure 4 This is shown as an embodiment of the present application, where 293T cells are used to screen for effective siRNA gene loops; wherein...

[0049] Figure 4 A is the experimental flowchart;

[0050] Figure 4 B represents the fluorescence expression results of the overexpression plasmid GDF8-GFP;

[0051] Figure 4 C represents the expression level and statistical results of GDF8 protein.

[0052] Figure 5 This embodiment of the application illustrates the screening of effective siRNA gene loops in C2C12 cells; wherein...

[0053] Figure 5 A is the experimental flowchart;

[0054] Figure 5 B represents the expression and statistical results of GDF8 protein in cells after transfection with the siRNA gene loop;

[0055] Figure 5 C represents the effect of the siR4 gene loop obtained from predifferentiation transfection screening on myotube formation and the statistical results.

[0056] Figure 6 The image shows the identification results of serum exosomes in one embodiment of this application.

[0057] Figure 7 The image shows the results of the inhibitory effect of mouse liver and serum-derived exosomes on GDF-8 expression in vitro after injection of the gene loop, according to one embodiment of this application; wherein,

[0058] Figure 7 A shows the detection process and results of liver-derived exosomes;

[0059] Figure 7 B represents the detection process and results of serum-derived exosomes.

[0060] Figure 8 This embodiment of the present application illustrates the detection process of PKH26-labeled in vivo self-assembled exosomes and their in vivo tracing; wherein,

[0061] Figure 8 A describes the detection process for liver-derived exosomes;

[0062] Figure 8 B represents the detection process for serum-derived exosomes.

[0063] Figure 9 The image shows the detection results of PKH26-labeled in vivo self-assembled exosomes and their in vivo tracing in one embodiment of this application; wherein,

[0064] Figure 9 A represents the detection results of liver-derived exosomes;

[0065] Figure 9 B represents the detection result of serum-derived exosomes.

[0066] Figure 10 The image shows the treatment results of WT mice after a short-term injection of siRNA gene loop over 2 weeks, as illustrated in one embodiment of this application; wherein,

[0067] Figure 10 A is the experimental flowchart;

[0068] Figure 10 B represents the weight change curve;

[0069] Figure 10 C represents the wet weight statistics of the tibialis anterior (TA) muscle;

[0070] Figure 10 D represents the statistical results of the mouse grip strength test;

[0071] Figure 10 E is an anatomical view of a mouse.

[0072] Figure 11 This is shown as an embodiment of the present application, illustrating the therapeutic molecular phenotype of WT mice after a short-term 2-week injection of siRNA gene loops; wherein...

[0073] Figure 11 A represents the overall immunohistochemical results of the GDF8 in the tibialis anterior muscle (TA);

[0074] Figure 11 B represents the expression and statistical results of GDF8 protein in the tibialis anterior muscle (TA) after siRNA gene loop injection;

[0075] Figure 11 C represents the expression results of GDF8 mRNA and downstream genes.

[0076] Figure 12 This embodiment illustrates the functional validation of in vivo self-assembled exosomal siRNAs in mice with LLC cancer-induced muscle atrophy; wherein...

[0077] Figure 12 A shows a comparison of statistical data on tumor-free weight, percentage of tibialis anterior (TA) muscle weight, and grip strength in each group of LLC cancer-induced muscle atrophy mice.

[0078] Figure 12 B shows the anatomical appearance of the mice in each group;

[0079] Figure 12 C represents the expression results of GDF8 protein in mice in each group after injection of siRNA gene loop. Detailed Implementation

[0080] To make the objectives, technical solutions, and advantages of this application clearer, a more detailed description is provided below. However, it should be understood that the description herein is merely for explaining this application and is not intended to limit its scope.

[0081] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of this application. All reagents and instruments used herein are commercially available, and the characterization methods involved can be found in relevant descriptions in the prior art, and will not be repeated here.

[0082] To further understand this application, the following detailed description is provided in conjunction with the preferred embodiments.

[0083] Example 1

[0084] A delivery system for targeting and inhibiting GDF8 includes: RNA capable of inhibiting GDF8 gene expression and a delivery vector; the delivery vector carrying RNA capable of inhibiting GDF8 gene expression and a targeting element self-assemble in a mammalian organ tissue to form a composite structure; the composite structure seeks out and delivers RNA capable of inhibiting GDF8 gene expression into the target tissue through the targeting element, thereby inhibiting the expression of GDF8 in the target tissue.

[0085] RNAs capable of inhibiting GDF8 gene expression include: promoter elements and at least one of siRNAs capable of inhibiting GDF8 gene expression and encoding siRNAs.

[0086] The nucleotide sequence of the siRNA that can inhibit GDF8 gene expression is any one of SEQ ID No. 1 to SEQ ID No. 4;

[0087] SEQ ID No. 1:

[0088] TAATGATTGTTTCCGTGGTAGGTTTTGGCCACTGACTGACCTACCACG AACAATCATTA;

[0089] SEQ ID No. 2:

[0090] TAGAAAGTCAGACTCTGTAGGGTTTTGGCCACTGACTGACCCTACAG ACTGACTTTCTA;

[0091] SEQ ID No. 3:

[0092] AACATTTGGGCTTGCCATCCGGTTTTGGCCACTGACTGACCGGATGG CGCCCAAATGTT;

[0093] SEQ ID No.4:

[0094] TCAATACTCTGCCAAATACCAGTTTTGGCCACTGACTGACTGGTATTT CAGAGTATTGA.

[0095] The nucleotide sequences encoding the sense strand of the siRNA that can inhibit GDF8 gene expression are any one of SEQ ID No. 5 to SEQ ID No. 8;

[0096] SEQ ID No.5: CUACCACGAACAAUCAUUA;

[0097] SEQ ID No.6:CCUACAGACUGACUUUCUA;

[0098] SEQ ID No.7: CGGAUGGCGCCCAAAUGUU;

[0099] SEQ ID No. 8: UGGUAUUUCAGAGUAUUGA.

[0100] The nucleotide sequences encoding the antisense strand of siRNA that can inhibit GDF8 gene expression are any one of SEQ ID No. 9 to SEQ ID No. 12;

[0101] SEQ ID No.9: UAAUGAUUGUUUCCGUGGUAG;

[0102] SEQ ID No.10: UAGAAAGUCAGACUCUGUAGG;

[0103] SEQ ID No.11: AACAUUUGGGCUUGCCAUCCG;

[0104] SEQ ID No. 12: UCAAUACUCUGCCAAAUACCA.

[0105] The complex structure is an exosome.

[0106] The targeting element includes one, two, or more targeting sequences.

[0107] The target sequence was selected as MSP muscle-targeting peptide, and the specific sequence is shown in SEQ ID No. 13.

[0108] SEQ ID No. 13: ASSLNIA;

[0109] The nucleotide sequence encoding the MSP muscle-targeting peptide is shown in SEQ ID No. 14.

[0110] SEQ ID No. 14: gccagcagcctgaacatcgcc.

[0111] The delivery vector is a plasmid vector or a viral vector.

[0112] Viral vectors include at least one of retroviral vectors, lentiviral vectors, adenovirus vectors, and adeno-associated virus vectors.

[0113] This application also provides the application of the above-described targeted GDF8 inhibitory delivery system in the preparation of products for treating muscular dystrophy.

[0114] Products used to treat muscular dystrophy include reagents that inhibit GDF8 gene expression and drugs that have preventive and / or therapeutic effects on muscular dystrophy.

[0115] Muscular atrophy is a tumor-induced muscular atrophy, preferably a muscular atrophy induced by Lewis lung cancer cells.

[0116] Example 2

[0117] In vitro assembly and validation of a targeted siRNA self-assembly system:

[0118] 1. Design and effectiveness of self-assembly system:

[0119] according to Figure 1The design diagram shows the construction of an siRNA self-assembly system. According to the design, after the system is introduced into mammalian tissues and cells, it can utilize the mammalian's own miRNA processing and secretion mechanism to self-assemble into exosomes (core gene loops) containing siRNA. In addition, by adding muscle-targeting peptide (MSP) and co-expressing it with the exosome membrane Lamp2b protein, the exosome membrane surface simultaneously expresses the MSP-targeting peptide, which is then secreted into the circulatory system and enriched in muscle cells through targeting elements.

[0120] First, each element was constructed, and the effectiveness of each element was verified in vitro using 293T tool cells (HEK-293T). The transcription efficiency of the self-assembly system for siRNA was detected, and it was tested whether the siRNA was effectively encapsulated into the cell supernatant exosomes.

[0121] The empty vector was treated with restriction endonucleases, and the linear vector was recovered. The GDF8 siRNA sequence was then inserted into the pre-miR-155 backbone using T4 ligase to form an siRNA expression element, which was then ligated into the vector. The FLAG-Lamp2b and MSP-Lamp2b sequences were used as targeting elements and ligated into the vector. The resulting ligation products were transformed and plated on antibiotic plates. Single clones were picked the following day, and sequencing was performed to confirm the correctness of the plasmid sequence.

[0122] Figure 3 The results showed that after the designed mature siRNA sequences targeting GDF8 (SEQ ID No. 1-SEQ ID No. 4) were loaded into gene loops, in vitro experiments screened out gene loops that could effectively inhibit GDF8 expression. The results showed that normal expression of the four mature siRNAs could be detected when cells were collected 24 hours after transfection.

[0123] Among them, CMV-MSP-siR-4 was most stably expressed in cells and supernatant exosomes, and the knockdown effect was most significant in 293T cells.

[0124] Figure 4 This demonstrates how transfecting a GDF8 overexpression plasmid (expressing GFP fluorescent protein) with a siRNA gene loop in 293T cells can be used to screen for effective siRNA gene loops. Figure 4 A); The results showed that all four siRNA gene loops could effectively inhibit the fluorescence intensity of GFP expression in 293T cells, among which the siR4 gene loop had the strongest inhibitory effect. Figure 4 B), Western blot results also show that the siR4 gene loop has a significantly better inhibitory effect on GDF8 expression than other siRNA gene loops. Figure 4 C).

[0125] 2. Gene loop screening:

[0126] 293T tool cells were transiently transfected with a GDF8 overexpression plasmid, followed by transfection with four designed siRNA gene loops (with different mature siRNA sequences). The inhibitory effects of different gene loops on transiently overexpressed GDF8 mRNA (qRT-PCR) and protein expression (Western blot) were detected. The four gene loops were then transfected using the muscle cell line C2C12. Figure 5 This study further verified the inhibitory effect of the gene loop on the expression of endogenous GDF8 mRNA and protein in muscle cells.

[0127] Further validation in the muscle cell line C2C12 is as follows: Figure 5 As shown in Figure A, when different siRNA gene loops were directly transfected into myotube cells differentiated for 3 days, it was found that the siR4 gene loop had a significantly better inhibitory effect on endogenous GDF8 in C2C12 myotube cells than other siRNA gene loops. Figure 5 B). Furthermore, pre-differentiation transfection with the siR4 gene significantly increased the number of myotubes formed. Figure 5 C). These results demonstrate that the siR4 gene loop can effectively inhibit GDF8 expression in vitro, thereby effectively promoting myogenesis.

[0128] Subsequent identification and functional verification experiments all used the siR4 gene loop, which had the best performance.

[0129] 3. Exosome identification:

[0130] Twelve hours after injecting mice with the gene loop at a dose of 5 mg / kg, exosomes were extracted from mouse serum. Nanoparticle Tracking Analysis (NTA) revealed no significant differences in the content and particle size distribution of exosomes among the three groups. Electron microscopy showed that the exosomes had intact morphological structures with no significant differences. Finally, Western blot analysis of exosome marker proteins showed no significant differences in the content of these marker proteins among the three groups. Figure 6 This demonstrates that injecting gene loops does not affect the secretion of exosomes.

[0131] Example 3

[0132] Functional validation of exosomal siRNAs assembled in vivo:

[0133] Mice were injected with the gene loop at a dose of 5 mg / kg, and their livers were extracted at 6 and 12 hours, respectively. Figure 7 A) and serum ( Figure 7B) Exosomes were co-cultured with C2C12 myotube cells, and the expression level of GDF-8 in the cells was detected by Western blot after 24 hours.

[0134] from Figure 7 It can be seen that exosomes derived from mouse liver and serum after injection of the gene loop can inhibit the expression of GDF-8 in vitro.

[0135] Tracing of self-assembled exosomes in vivo:

[0136] Mice were injected with the gene loop at a dose of 5 mg / kg, and their livers were extracted at 6 and 12 hours, respectively. Figure 8 A) and serum ( Figure 8 B) Exosomes were labeled in vitro with PKH26 lipophilic dye and then injected into recipient mice via tail vein injection. The skeletal muscle of the mice was stained and observed 24 hours later.

[0137] from Figure 8 and Figure 9 It can be seen that the liver after adding the targeted peptide MSP ( Figure 9 A) and serum ( Figure 9 B) Exosomes can be effectively delivered to skeletal muscle (TA).

[0138] Functional validation of in vivo self-assembled exosomal siRNAs in wild-type mice:

[0139] Mice were injected with the gene loop at a dose of 5 mg / kg, every other day, for two weeks. Figure 10 A). During the treatment, the patient's weight was monitored. A grip strength test was performed one day after the last injection, and the tibialis anterior (TA) muscle was weighed. The results indicated that the CMV-MSP-siRNA injection... GDF-8 A group of mice body weight ( Figure 10 B), TA weight ( Figure 10 C) and grip ( Figure 10 D) all showed a significant increase, and photographs of their muscles also clearly showed a significant increase in the circumference of their hind leg calf muscles. Figure 10 E). Immunohistochemistry of mouse TA ( Figure 11 A) and Western blot experiments ( Figure 11 B) also indicates that CMV-MSP-siRNA GDF-8 The level of GDF-8 in the TA tissue of a group of mice was significantly reduced. RT-qPCR detection of gene expression in mouse TA tissue revealed significantly reduced expression levels of GDF-8 and its downstream genes. Figure 11 C).

[0140] from Figure 10 and Figure 11It can be seen that CMV-MSP-siRNA GDF-8 It showed significant effects in short-term treatment of WT mice.

[0141] Functional validation of in vivo self-assembled exosomal siRNAs in LLC cancer mice:

[0142] With 1×10 5 LLC tumor cells were implanted into the axilla of mice, and gene loop injections were administered three days later, followed by injections every other day for one month. A grip strength test was performed one day after the last injection, and the tibialis anterior (TA) muscle was weighed. The results showed that the CMV-MSP-siRNA injection... GDF-8 In one group of mice, the body weight, TA weight, and grip strength after tumor removal were significantly increased. Figure 12 A), and photographs of its muscles also clearly show a significant increase in the circumference of its calf muscles. Figure 12 B). Western blot experiments on mouse TA tissue also showed that CMV-MSP-siRNA GDF-8 The level of GDF-8 in the TA of a group of mice was significantly reduced. Figure 12 C).

[0143] from Figure 12 It can be seen that CMV-MSP-siRNA GDF-8 It showed significant therapeutic effects in LLC-induced muscle atrophy.

[0144] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of this application should be included within the protection scope of this application.

Claims

1. A delivery system for targeting and inhibiting GDF8, characterized in that, The delivery system includes: RNA capable of inhibiting GDF8 gene expression and a delivery vector; the delivery vector carrying RNA capable of inhibiting GDF8 gene expression and a targeting element self-assemble in mammalian organs and tissues to form a composite structure, the composite structure using the targeting element to find and deliver RNA capable of inhibiting GDF8 gene expression into the target tissue, thereby inhibiting the expression of GDF8 in the target tissue; The RNA capable of inhibiting GDF8 gene expression includes: promoter elements and at least one of siRNA capable of inhibiting GDF8 gene expression and encoding siRNA; The nucleotide sequence of the siRNA that can inhibit GDF8 gene expression is any one of SEQ ID No. 1 to SEQ ID No. 4; The nucleotide sequences of the positive strand of the siRNA encoding the GDF8 gene that can inhibit GDF8 gene expression are any one of SEQ ID No. 5 to SEQ ID No. 8; The nucleotide sequences encoding the antisense strand of siRNA that can inhibit GDF8 gene expression are any one of SEQ ID No. 9 to SEQ ID No.

12.

2. The delivery system for targeting and inhibiting GDF8 according to claim 1, characterized in that, The composite structure is an exosome.

3. The delivery system for targeting and inhibiting GDF8 according to claim 1, characterized in that, The targeting element includes one, two, or more targeting sequences.

4. The delivery system for targeting and inhibiting GDF8 according to claim 1, characterized in that, The delivery vector is a plasmid vector or a viral vector.

5. The delivery system for targeting and inhibiting GDF8 according to claim 4, characterized in that, The viral vector includes at least one of retroviral vectors, lentiviral vectors, adenovirus vectors, and adeno-associated virus vectors.

6. The use of a delivery system for targeting and inhibiting GDF8 according to any one of claims 1-5 in the preparation of a product for treating muscular dystrophy.

7. The application according to claim 6, characterized in that, The products for treating muscular dystrophy include reagents that inhibit GDF8 gene expression and drugs that have preventive and / or therapeutic effects on muscular dystrophy.

8. The application according to claim 7, characterized in that, The muscle atrophy disease mentioned is a tumor-induced muscle atrophy condition.

9. The application according to claim 7, characterized in that, The muscle atrophy disease mentioned is a type of muscle atrophy induced by Lewis lung cancer cells.

Images