Nanobodies against b7h3 and uses thereof
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-07-27
- Publication Date
- 2026-08-11
AI Technical Summary
[0005]本发明要解决的技术问题为:现有针对B7H3的抗体主要为鼠单克隆抗体,分子量大、组织穿透性差、不易工程化改造等问题
[0029]This invention uses human B7H3 as the target antigen and screens 15 anti-B7H3 specific nanobodies using phage display technology. These nanobodies specifically bind to the B7H3 antigen, exhibiting high specificity and affinity, and also possess advantages such as small molecular weight, high stability, ease of modification, and high solubility. Furthermore, this invention tandemly combines the anti-B7H3 nanobodies with the anti-CD3 antibody OKT3 to prepare a B7H3/CD3 bispecific antibody. In vitro and in vivo experiments show that it has good anti-tumor activity. The B7H3/CD3 bispecific antibody of this invention can be used in the preparation of anti-tumor drugs, exhibiting broad-spectrum anti-tumor effects.
Smart Images

Figure CN119371533B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically relating to an anti-B7H3 nanobody and its uses. Background Technology
[0002] B7H3 (CD276) is an important immune checkpoint molecule in the B7-CD28 family. It is a single-pass type I transmembrane protein, and the amino acid sequences of human and mouse B7H3 proteins share 88% similarity. Human B7H3 is located on chromosome 15, and its extracellular domain (29–456 aa) contains two tandemly repeated immunoglobulin-like variable regions (IgV region) and immunoglobulin-like constant regions (IgC region). Mouse B7H3 is located on chromosome 9, and its extracellular domain (29–248 aa) contains only one IgV region and one IgC region. Studies have found that B7H3 exists in two isoforms (2Ig-B7H3 and 4Ig-B7H3). The 2Ig-B7H3 form is expressed in both human and mouse cells and contains the IgV1–IgC21 region; the 4Ig-B7H3 form exists only in human cells and contains the IgV1–IgC21–IgV2–IgC22 region. The receptor for B7H3 remains unknown, thus its regulatory physiological functions are unclear. However, soluble B7H3 (sB7H3) can bind to T, NKT, and NK cells, and its binding level increases with T cell activation. Studies have shown that B7H3 can stimulate T cell proliferation, enhance the induction of cytotoxic T lymphocytes, and increase IFN-γ secretion; however, other studies have shown that B7H3, as a T cell co-inhibitory molecule, can significantly inhibit cytokine secretion during T cell activation, and knockout or blockage of B7H3 can promote the pathogenesis of experimental autoimmune encephalomyelitis. Studies have shown that B7H3 protects tumor cells by binding to NK cells and inhibiting NK-mediated cytotoxicity, and it may also participate in the occurrence of acute and chronic transplant rejection and the regulation of mucosal surface lymphocyte activity. In addition, recent studies have shown that overexpression of B7H3 is associated with poor prognosis in cancer patients and the proliferation, migration, and immunosuppression of tumor cells, but its receptor or ligand has not yet been discovered, and its specific biological functions remain inconclusive.
[0003] Multiple clinical samples were tested and found that B7H3 was expressed at low levels or not expressed in most normal tissues, but highly expressed in a variety of tumor tissues, such as head and neck tumors, craniopharyngioma, prostate cancer, glioma, squamous cell carcinoma of the skin, melanoma, intestinal adenocarcinoma, gastric adenocarcinoma, pancreatic cancer, clear cell carcinoma of the kidney, breast cancer, liver cancer, bladder cancer, cervical cancer, skin cancer, neuroblastoma, medulloblastoma, ovarian cancer, lung adenocarcinoma and other solid tumors, as well as hematologic malignancies such as acute myeloid leukemia (Majzner RG et al. CAR T Cells Targeting B7-H3, a Pan-Cancer Antigen, Demonstrate Potent Preclinical Activity Against Pediatric Solid Tumors and Brain Tumors. Clin Cancer Res. 2019 Apr15; 25(8):2560-2574; Yang M et al. Tandem CAR-T cells targeting CD70 and B7-H3 exhibit potent preclinical activity against multiple solid tumors). Tumors. Theranostics. 2020 Jun 18; 10(17):7622-7634; Tyagi A, et al. Evidence supporting a role for the immune checkpoint protein B7-H3 in NK cell-mediated cytotoxicity against AML. Blood. 2022 May 5; 139(18):2782-2796; Nehama D et al. Kontos F, et al. B7-H3: An Attractive Target for Antibody-based Immunotherapy. Clin Cancer Res. 2021 Mar 1; 27(5):1227-1235). As a pan-tumor antigen and a potential immunosuppressive regulatory molecule, B7H3 has become one of the hot topics in anti-tumor research. Currently, the main biopharmaceuticals under development targeting B7H3 for immunotherapy include engineered antibodies, antibody-drug conjugates (ADCs), antibody-drug conjugates (RDCs), and CAR-T therapy. These drugs have shown good anti-tumor activity in clinical or preclinical studies. Therefore, B7H3 has become a potential drug target with unclear functions.
[0004] In view of this, the present invention is proposed. Summary of the Invention
[0005] The technical problem to be solved by this invention is that existing antibodies against B7H3 are mainly mouse monoclonal antibodies, which have problems such as large molecular weight, poor tissue penetration, and difficulty in engineering modification.
[0006] The technical solution of this invention to solve the above-mentioned technical problem is as follows: An anti-B7H3 nanobody is provided. The anti-B7H3 nanobody comprises heavy chain variable regions of CDR1, CDR2, and CDR3, wherein the amino acid sequences of CDR1 to CDR3 are any one of the following:
[0007] As shown in SEQ ID NO: 1-3; or as shown in SEQ ID NO: 5-7; or as shown in SEQ ID NO: 9-11; or as shown in SEQ ID NO: 13-15; or as shown in SEQ ID NO: 17-19; or as shown in SEQ ID NO: 21-23; or as shown in SEQ ID NO: 25-27; or as shown in SEQ ID NO: 29-31; or as shown in SEQ ID NO: 33-35; or as shown in SEQ ID NO: 37-39; or as shown in SEQ ID NO: 41-43; or as shown in SEQ ID NO: 45-47; or as shown in SEQ ID NO: 49-51; or as shown in SEQ ID NO: 53-55; or as shown in SEQ ID NO: 57-59.
[0008] The aforementioned anti-B7H3 nanobody also includes a backbone region, and the structure of the VHH chain of the nanobody is: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4.
[0009] Furthermore, in the above-mentioned anti-B7H3 nanobody, the amino acid sequence of the VHH chain of the nanobody is any one of SEQ ID NO:4, SEQ ID NO:8, SEQ ID NO:12, SEQ ID NO:16, SEQ ID NO:20, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NO:32, SEQ ID NO:36, SEQ ID NO:40, SEQ ID NO:44, SEQ ID NO:48, SEQ ID NO:52, SEQ ID NO:56 or SEQ ID NO:60.
[0010] Furthermore, the amino acid sequences of the aforementioned anti-B7H3 nanobody CDR1 are as shown in SEQ ID NO:1, CDR2 in SEQ ID NO:2, CDR3 in SEQ ID NO:3, and VHH in SEQ ID NO:4; or the amino acid sequences of CDR1 in SEQ ID NO:5, CDR2 in SEQ ID NO:6, CDR3 in SEQ ID NO:7, and VHH in SEQ ID NO:8; or the amino acid sequences of CDR1 in SEQ ID NO:9, CDR2 in SEQ ID NO:10, CDR3 in SEQ ID NO:11, and VHH in SEQ ID NO:12; or the amino acid sequences of CDR1 in SEQ ID NO:13, CDR2 in SEQ ID NO:14, CDR3 in SEQ ID NO:15, and VHH in SEQ ID NO:16; or the amino acid sequence of CDR1 in SEQ ID NO:16. NO:17, the amino acid sequence of CDR2 is as shown in SEQ ID NO:18, the amino acid sequence of CDR3 is as shown in SEQ ID NO:19, and the amino acid sequence of VHH is as shown in SEQ ID NO:20; or the amino acid sequence of CDR1 is as shown in SEQ ID NO:21, the amino acid sequence of CDR2 is as shown in SEQ ID NO:22, the amino acid sequence of CDR3 is as shown in SEQ ID NO:23, and the amino acid sequence of VHH is as shown in SEQ ID NO:24; or the amino acid sequence of CDR1 is as shown in SEQ ID NO:25, and the amino acid sequence of CDR2 is as shown in SEQ ID NO:26; or the amino acid sequence of CDR3 is as shown in SEQ ID NO:27, and the amino acid sequence of VHH is as shown in SEQ ID NO:28; or the amino acid sequence of CDR1 is as shown in SEQ ID NO:29, the amino acid sequence of CDR2 is as shown in SEQ ID NO:30, the amino acid sequence of CDR3 is as shown in SEQ ID NO:31, and the amino acid sequence of VHH is as shown in SEQ ID NO:32; or the amino acid sequence of CDR1 is as shown in SEQ ID NO:33, and the amino acid sequence of CDR2 is as shown in SEQ ID NO:34. NO:34, the amino acid sequence of CDR3 is as shown in SEQ ID NO:35, the amino acid sequence of VHH is as shown in SEQ ID NO:36; or the amino acid sequence of CDR1 is as shown in SEQ ID NO:37, the amino acid sequence of CDR2 is as shown in SEQ ID NO:38, the amino acid sequence of CDR3 is as shown in SEQ ID NO:39, and the amino acid sequence of VHH is as shown in SEQ ID NO:40.The amino acid sequence of CDR1 is shown in SEQ ID NO:41, the amino acid sequence of CDR2 is shown in SEQ ID NO:42, the amino acid sequence of CDR3 is shown in SEQ ID NO:43, and the amino acid sequence of VHH is shown in SEQ ID NO:44; or the amino acid sequence of CDR1 is shown in SEQ ID NO:45, the amino acid sequence of CDR2 is shown in SEQ ID NO:46, the amino acid sequence of CDR3 is shown in SEQ ID NO:47, and the amino acid sequence of VHH is shown in SEQ ID NO:48; or the amino acid sequence of CDR1 is shown in SEQ ID NO:49, the amino acid sequence of CDR2 is shown in SEQ ID NO:50, the amino acid sequence of CDR3 is shown in SEQ ID NO:51, and the amino acid sequence of VHH is shown in SEQ ID NO:52; or the amino acid sequence of CDR1 is shown in SEQ ID NO:53, the amino acid sequence of CDR2 is shown in SEQ ID NO:54, the amino acid sequence of CDR3 is shown in SEQ ID NO:55, and the amino acid sequence of VHH is shown in SEQ ID NO:56; or the amino acid sequence of CDR1 is shown in SEQ ID NO:44. The amino acid sequences of CDR2 (NO:57) and CDR3 (SEQ ID NO:58), and VHH (SEQ ID NO:60) are shown in SEQ ID NO:59 and SEQ ID NO:60, respectively.
[0011] The antibody sequences are shown in Table 1 below:
[0012] Table 1 Antibody amino acid sequence
[0013]
[0014]
[0015]
[0016] Furthermore, the aforementioned anti-B7H3 nanobody is at least one of monovalent nanobody, multivalent nanobody, multispecific nanobody, or fusion nanobody.
[0017] The multispecific nanobody is an anti-B7H3 / CD3 bispecific antibody.
[0018] Furthermore, the present invention also provides an isolated polynucleotide encoding the above-mentioned nanobody.
[0019] Furthermore, the nucleotide sequences of the isolated polynucleotides are shown in SEQ ID NO:61-75.
[0020] The present invention also provides a recombinant vector containing the above-isolated polynucleotides.
[0021] The present invention also provides a host cell containing the above-described recombinant vector.
[0022] The host cell is at least one of prokaryotic host cells, eukaryotic host cells, or bacteriophages. The prokaryotic host cells include *Escherichia coli*, *Streptomyces*, *Bacillus subtilis*, or *Mycobacterium*; the eukaryotic host cells include animal cells, plant cells, or fungi; the animal cells are selected from mammalian cells, insect cells, or *C. elegans*; the mammalian cells are selected from any one of 293 cells, 293T cells, 293FT cells, CHO cells, COS cells, mouse L cells, LNCaP cells, 633 cells, Vero cells, BHK cells, CV1 cells, HeLa cells, MDCK cells, Hep-2 cells, and Per6 cells; the fungi are selected from any one of *Saccharomyces cerevisiae*, *Pichia pastoris*, *Saccharomyces hansenii*, *Candida*, *Kluyveromyces lactis*, *Aspergillus nidus*, *Schizosaccharomyces cerevisiae*, and *Yeroida muscaria*.
[0023] The present invention also provides an immunoconjugate or pharmaceutical composition comprising the above-mentioned anti-B7H3 nanobody.
[0024] The immune conjugate further includes a therapeutic agent, which includes at least one of the following: immune checkpoint-related agents, toxins, factors, drugs, radionuclides, kinase inhibitors, or cytotoxic agents.
[0025] The pharmaceutical composition further includes at least one of a pharmaceutical excipient, a carrier, or a diluent.
[0026] Furthermore, the present invention also provides the use of the above-mentioned anti-B7H3 nanobody, isolated polynucleotide, or host cell in the preparation of medicaments for the prevention, diagnosis, or treatment of tumors.
[0027] Furthermore, the tumors include at least one of the following: head and neck tumors, craniopharyngioma, prostate cancer, glioma, squamous cell carcinoma of the skin, melanoma, intestinal adenocarcinoma, gastric adenocarcinoma, pancreatic cancer, clear cell carcinoma of the kidney, breast cancer, liver cancer, bladder cancer, cervical cancer, skin cancer, neuroblastoma, medulloblastoma, ovarian cancer, lung adenocarcinoma, or acute myeloid leukemia.
[0028] The present invention has the following beneficial effects:
[0029] This invention uses human B7H3 as the target antigen and screens 15 anti-B7H3 specific nanobodies using phage display technology. These nanobodies specifically bind to the B7H3 antigen, exhibiting high specificity and affinity, and also possess advantages such as small molecular weight, high stability, ease of modification, and high solubility. Furthermore, this invention tandemly combines the anti-B7H3 nanobodies with the anti-CD3 antibody OKT3 to prepare a B7H3 / CD3 bispecific antibody. In vitro and in vivo experiments show that it has good anti-tumor activity. The B7H3 / CD3 bispecific antibody of this invention can be used in the preparation of anti-tumor drugs, exhibiting broad-spectrum anti-tumor effects. Attached Figure Description
[0030] Figure 1 In this embodiment of the invention, the purity of recombinant protein B7H3-His was analyzed using SDS-PAGE.
[0031] Figure 2 In this embodiment of the invention, the anti-B7H3 antibody titer in camel serum is detected using indirect ELISA.
[0032] Figure 3 In this embodiment of the invention, IFA analysis is used to analyze the binding of anti-B7H3 nanobody to B7H3 antigen;
[0033] Figure 4 In this embodiment of the invention, FACS analysis was used to determine the binding specificity of the anti-B7H3 nanobody to B7H3.
[0034] Figure 5 In this embodiment of the invention, RTCA was used to analyze the in vitro killing activity of the B7H3 / CD3 bispecific antibody against B7H3-HeLa cells.
[0035] Figure 6 This embodiment of the invention utilizes an NCG mouse xenograft model to evaluate the in vivo antitumor effect of the B7H3 / CD3 bispecific antibody. A shows the binding results of the anti-B7H3 nanobody to acute myeloid leukemia (AML) cells MV-4-11; B shows the survival analysis of the AML xenograft model mice. Detailed Implementation
[0036] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.
[0037] This invention provides an anti-B7H3 nanobody comprising heavy chain variable regions of CDR1, CDR2, and CDR3, wherein the amino acid sequences of CDR1 to CDR3 are any of the following: as shown in SEQ ID NO: 1 to 3; or as shown in SEQ ID NO: 5 to 7; or as shown in SEQ ID NO: 9 to 11; or as shown in SEQ ID NO: 13 to 15; or as shown in SEQ ID NO: 17 to 19; or as shown in SEQ ID NO: 21 to 23; or as shown in SEQ ID NO: 25 to 27; or as shown in SEQ ID NO: 29 to 31; or as shown in SEQ ID NO: 33 to 35; or as shown in SEQ ID NO: 37 to 39; or as shown in SEQ ID NO: 41 to 43; or as shown in SEQ ID NO: 45 to 47; or as shown in SEQ ID NO: 49 to 51; or as shown in SEQ ID NO: 53 to 55; or as shown in SEQ ID NO: 57 to 59.
[0038] The anti-B7H3 nanobody also includes a backbone region, the structure of which is: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4.
[0039] The nanobody is at least one of monovalent nanobody, multivalent nanobody, multispecific nanobody, or fusion nanobody.
[0040] The monovalent nanobody is an antigen-specific nanobody obtained by screening a nanobody library using specific antigens. Because it has a large number of hydrophilic residues on its surface, it can maintain a strict monomeric structure and can bind to its antigen with high specificity and high affinity in this monomeric form only.
[0041] The multivalent nanobody is a polymer of a monovalent antibody that recognizes the same epitope and has a higher antigen affinity than the corresponding monovalent nanobody.
[0042] The aforementioned multispecific antibodies are polymers of monovalent antibodies that recognize different epitopes. They can bind to different targets or different epitopes of the same target, exhibiting higher antigen recognition capabilities than monovalent antibodies. Nanobodies, on the other hand, have a simple structure and can be polymerized together through short linker sequences, thus transforming them into multivalent and multispecific forms.
[0043] Furthermore, the present invention also provides an isolated polynucleotide encoding the above-mentioned nanobody.
[0044] Furthermore, the nucleotide sequences of the isolated polynucleotides are shown in SEQ ID NO:61-75.
[0045] The nucleotide sequence encoding antibody Nb1, SEQ ID NO: 61
[0046] CAGGTGCAGCTGCAGGAGTCTGGGGGAGGCTCGGTGCAGGCTGGAGGGTCTCTGAGACTCTCC
[0047] TGTGCAGCCTCTGGATACACCTACAGTAGCTACTGGATGGGCTGGTTCCGCCAGGCTCCAGGGA
[0048] AGGAGCGCGAGGGGGTCGCAGCTATTTATACTCGTGGTGGTACCACATACTATGCCGACTCCGT
[0049] GAAGGGCCGATTCACCATCTCCCAAGACAACGCCAAGAACACGGTGTATCTGCAAATGAACAG
[0050] CCTGAAACCTGAGGACACTGCCATGTACTACTGTGCGGCAGATACGAAAGTGGGGGGTTGGGTACGGAATAACCCCGCCGGAATTGGTTACTGGGGCCAGGGGACCCAGGTCACCGTCTCCTCA。
[0051] The nucleotide sequence encoding antibody Nb10, SEQ ID NO: 62
[0052] CAGGTGCAGCTGCAGGAGTCTGGGGGAGGCTCGGTGCAGGCTGGAGGGTCTCTGAGACTCTCC
[0053] TGTGCAGCCTCTGGAATCACCTACGACAGCTATGCCATGGCCTGGTTCCGCCAGGCTCCAGGAA
[0054] AACAGCGCGAGGGCGTCGCAAGTCTTTACACTCGTGCTGGTACCACATACTATGCCGACTCCGT
[0055] AAAGGGCCGATTCACCATCTCCCACGACAACGCCAAGAACACGGTGTATCTGCAAATGAACAG
[0056] CCTGAAACCTGAGGACACCGCTATGTACTACTGTGCGACAGATCGAGTCTTCTGGGGTACTTCGTCCCTCCAGAGGACCCGCTATAACGTCTGGGGCCGTGGGACCCAGGTCACCGTCTCCTCA。
[0057] SEQ ID NO: 63 Nucleotide sequence encoding antibody Nb12
[0058] CAGGTGCAGCTGCAGGAGTCTGGGGGAGACTCGGTGCAGGCTGGAGGGTCTCTGAGACTCTCC
[0059] TGTGCAGCCTCTGGAATCACCTACAACTGCTACTCCATGGCCTGGTTCCGCCAGGCTCCAGGAA
[0060] AGGAGCGCGAGGGCGTCGCAAGTCTTTATACTTGTGCTGGTACCACATACTATGCCGACTCCAT
[0061] AAAGGGCCGATTCACCATCTCCCACGACAACGCCAAGAACACGGTGTATCTGCAAATGAACAG
[0062] CCTGAAACCTGAGGACACTGCCATGTACTACTGTGCGACAGATCGAGTCTTCTGGGGTACTTCGTCCCTCCAGAGGACCCGCTATAATTACTGGGGCCGTGGGACCCAGGTCACCGTCTCCTCA。
[0063] SEQ ID NO: 64 Nucleotide sequence encoding antibody Nb15
[0064] CAGGTGCAGCTGCAGGAGTCTGGGGGAGGCGCGGTGCAGGCTGGAGGGTCTCTGAGACTCTCC
[0065] TGTGTAGCCTCTGGATACGCCTACAGTAGAAACTGGGTGGGCTGGTTCCGCCAAACTCCAGGGA
[0066] AGGAGCGCGAGGCGGTCGCAGCTATTTATACTGGTGGTGGCAGCACATACTATGCCGACTCCGT
[0067] GAAGGGCCGATTCACCATCTCCCAAGACAACGCCAAGAACACGGTGTATCTGCAAATGAACAG
[0068] CCTGATACCTGAGGACACTGCCATATACTACTGTGCGGCAGATCCGGCTGTCGGGGCTTGGGTTTCCGGGGACCCTTCTCGCCGCTTGAAGTACTGGGGCCAGGGGACCCAGGTCACCGTCTCCTCA。
[0069] The nucleotide sequence encoding antibody Nb25, SEQ ID NO: 65
[0070] CAGGTGCAGCTGCAGGAGTCTGGGGGAGACTCGGTGCAGGCTGGAGGGTCTCTGAGACTCTCC
[0071] TGTGCAGCCTCTGGAATCACCTACAGCAGCTACTCCATGGCCTGGTTCCGCCAGGCTCCAGGAA
[0072] AGGAGCGCGAGGGGGTCGCAAGTATTCATAGTCCTTCTGGTACCACATACTATGCCGACTCCAT
[0073] AAAGGGCCGATTCACCATCGCCCACGACAACGCCCTGAACACGGTGTATCTGGAAATGAACAG
[0074] CCTGAAACCTGAGGACACTGCCATGTACTACTGTGCGGCAGATCGAGTCTTCTGGGGTACTTCGTCCCTCCAGAGGACCCGCTATAAGTACTGGGGCCGTGGGACCCAGGTCACCGTCTCCTCA。
[0075] The nucleotide sequence encoding antibody Nb52, SEQ ID NO: 66
[0076] CAGGTGCAGCTGCAGGAGTCTGGGGGAGGCTCGGTGCAGGCTGGAGGGTCTCTGAGACTCTCC
[0077] TGTGCAGCCTCTACTTACACCTATAACATGGGCTGGTTCCGCCAGGCTCCAGGGAAGGAGCGCG
[0078] AGGGGGTCGCAGCGTTTTATTCCAGAGGTACTAGGGTCTATGCCGACTCCGTGAAGGGCCGATT
[0079] CACCATCTCCCGTGACAACGCCAAGAACACGCTGTATCTAGACATTGACATGCTGAGACCTGAC
[0080] GACGCTGCCATGTACTACTGTGCGGCTGCCACGGAGTTGATTGGTACTGCTCCGTTAGATGCGAGGACGTATAAGTACTGGGGCCAGGGGACCCAGGTCACCGTCTCCTCA。
[0081] The nucleotide sequence encoding antibody NbH59 of SEQ ID NO: 67
[0082] CAGGTGCAGCTGCAGGAGTCTGGGGGAGGCTCGGTGCAGGCTGGAGGGTCTCTGAGACTCTCC
[0083] TGTGCAGCCCCTGGAAGCATCTATAGTAGGATGTGGATGGGCTGGTTCCGCCAGGCTCCAGGG
[0084] AAGGAGCGCGACGCGGTCGCAGCTATTTATACTGCTGCTGGTAGCACATACTATGCCGACTCCG
[0085] TGAAGGGCCGATTCACCATCTCCCAAGACAACGCCAAGAATACGGTGTATCTGCAAATGAACA
[0086] GCCTGAAACCTGAGGACACTGCCATGTACTACTGTGCGGCAGATCCCGCCGTGGGATCATGGGTTGGCTCACGCCCCCTAGGGAGCGTGCGCTGGGGCCAGGGGACCCAGGTCACCGTCTCCTCA。
[0087] Nucleotide sequence encoding antibody Nb60, SEQ ID NO: 68
[0088] CAGGTGCAGCTGCAGGAGTCTGGGGGAGGCTCGGTGCAGGCTGGAGGGTCTCTGAGACTCGCC
[0089] TGTGCAGCCTCTGGATACAGTCTAAGTAGCGATTTCGTGGCCTGGTTCCGCCAGGCTTCAGGGA
[0090] AGGATCGCGAAGACGTCGCAGGTATTTATCCTGGTGGTAGTATGGCACACTATGCCGACGCCGT
[0091] GAAGGGCCGATTCACCATCTCCCGAGACAACACCAAGAACATGGTGTATCTGCAAATGAACAG
[0092] CCTGAAACCTGAAGACACCGCCATGTACTACTGTGCATCACGGTTTCTTCCCAAGACCGGTCGAACGTGGGACCCGCTCAATTTTGCTTACTGGGGCCAGGGGACCCAGGTCACCGTCTCCTCA。
[0093] Nucleotide sequence encoding antibody Nb64, SEQ ID NO: 69
[0094] CAGGTGCAGCTGCAGGAGTCTGGGGGAGGCTCGGTGCAGGCTGGAGGGTCTCTGAGACTCTCC
[0095] TGTGCAGCCTCTGGATACACCTTCAGTCGCCACTGGATGGGCTGGTTCCGCCAGGCTCCAGGGA
[0096] AGGAGCGCGAGGGGGTCGCAGCTATTTATACTAATGGTGGTAGCACATACTATGCCGACTCCGT
[0097] GAAGGGCCGGTTCACCATCTCCCAAGACAACGCCAAGAACACGGTATTTCTGCAAATGAATAG
[0098] CCTGAAACCTGAGGACACTGCCATGTACTACTGTGCGGCAGATTTAGCTGTTGGTAGTTGGCTG
[0099] AGACAGGGGGGCCCGTTGAGAATTGGTTACTGGGGCCAGGGGACCCAGGTCACCGTCTCCTCA。
[0100] The nucleotide sequence encoding antibody Nb70, SEQ ID NO: 70
[0101] CAGGTGCAGCTGCAGGAGTCTGGGGGAGGCTCGGTGCAGGCTGGAGGCACTCTGAGACTCTCC
[0102] TGTGCAGCCTCTGGATACACCTTAAGTAGCAATTTCGTGGGCTGGTTCCGCCAGGCTTCAGGGA
[0103] AGGTCCGCGAAGAGGTCGCAGGTATCTATCCCGGTGATAGTCTTACGCACTATGCCGACGCCGT
[0104] GAAGGGCCGATTCACCATCTCCCGAGACAACGTCAAGAACACGGTGTATCTGCAAATGAACAG
[0105] CCTGAAACCTGAGGACACCGCCATGTACTACTGTGCGACACGGTTTCACCCCAAGACCAGTCGAACGTGGGACCCGCCCAACTTTGGTTACTGGGGCCAGGGGACCCAGGTCACCGTCTCCTCA。
[0106] The nucleotide sequence encoding antibody Nb90, SEQ ID NO: 71
[0107] CAGGTGCAGCTGCAGGAGTCTGGGGGAGGCTTGGTGCAGCCTGGGGGGTCTCTGAGACTCCCC
[0108] TGTGTAGCCTCTGGAATCACCCACATCGACTACTCCATGGCCTGGTTCCGCCAGGCTCCAGGAA
[0109] AGGAGCGCGAGGGGGTCGCAAGTATTCACGCTCGTAGCGGTACGACATACTATGCCAACTCCG
[0110] TACAGGGCCGATTCACCATCTCCCACGACAAGGCCAAGAACACGGTGTATCTGGAAATGAACA
[0111] GCCTGAAACCTGAGGACACTGCCATGTACTACTGTGCGGCAGATCGAGTCTACTGGGGTACTTCGTCCCTCCAGAGGACCCGCTATAACTACTGGGGCCGTGGGACCCAGGTCACCGTCTCCTCA。
[0112] The nucleotide sequence encoding antibody NbH1, SEQ ID NO: 72
[0113] CAGGTGCAGCTGCAGGAGTCTGGGGGAGGCTCGGTGCAGGCTGGAGGGTCTCTGAGACTCTCC
[0114] TGTACAGCCTCTGGATTTACCGACAGTAGCTACTGGATGGGCTGGTTCCGCCAGGTTCCAGGAA
[0115] AGGAGCGCGAGGGGGTCGCAACTATTTATACTCAGCTTGGTACCACATACTATGCCGACTCCGT
[0116] GAAGGGCCGATTCACCATCTCCCAAGACAACGCCAAGAACACGGTGTATCTGCAAATGAACAG
[0117] CCTTAAACCTGAGGACACTGCCATGTACTACTGTGCGGCAGATAGGAAAGTGATGTATTGGGTACAGAATAACCCCGCCGGGATTGGTTACTGGGGCCAGGGGACCCAGGTCACCGTCTCCTCA。
[0118] SEQ ID NO: 73 Nucleotide sequence encoding antibody NbH51
[0119] CAGGTGCAGCTGCAGGAGTCTGGGGGAGGCTCGGTGCAGGCTGGAGGGTCTCTGAGACTCTCC
[0120] TGTGCAGCCTCTGGAATCACCTACAACAGCTACTCCATGGCCTGGTTCCGCCAGGCTCCAGGAA
[0121] AGGAGCGCGAGGGCGTCGCAAGTCTTTACACTCTTGCTGGTACCACATACTATGCCGACTCCGT
[0122] AAAGGGCCGATTCACCATCTCCCACGACAACGCCAAGAACACGGTGTATCTGCAAATGAACAG
[0123] CCTGAAACCTGAGGACACTGCTATGTACTACTGTGCGACAGATCGAGTCTTCTGGGGTACTTCGTCCCTCCAGAGGACCCGCTATAACGTCTGGGGCCAGGGGACCCAGGTCACCGTCTCCTCA。
[0124] SEQ ID NO: 74 Nucleotide sequence encoding antibody NbH68
[0125] CAGGTGCAGCTGCAGGAGTCTGGGGGAGGATCGGTGCAGGCTGGAGGGTCTCTGAGACTCTCC
[0126] TGTGCAGCCTCTGGATACATCGACAGTAGCAACTGGATGGGCTGGTTCCGCCAGGCTCCAGGG
[0127] AAGGAGCGCGAGGGGGTCGCAGCCATTTATGCTGATATTGGTACGACATACTATGCCGACTCC
[0128] GTGCAGGGCCGATTCACCATCTCGCAAGACACCGCCAAGAACACGGTATATCTGCAAATGAAC
[0129] GCACTGAAACCTGACGACACTGCCGCGTACTACTGTGCGATAGGGAGGAAGGGTGGGCGCTTGG
[0130] TACAACTCCCGTTTCCGATCGTCAATTACTTACTGGGGCCGGGGAACCCAGGTCACCGTCTCCTCA.
[0131] SEQ ID NO: 75 encodes the nucleotide sequence of antibody NbH73.
[0132] CAGGTGCAGCTGCAGGAGTCTGGGGGAGGCTCGGTGCAGGCTGGAGGGTCTCTGAGACTCTCC
[0133] TGTGCAGCCTCTGCAGACACCTACAGTCAGAACTTCATGACGTGGTTCCGCCAGGCTGCAGGGA
[0134] AGGAGCGGGAGGGGGTCGCAAGTGTTTATACTGGTAGTGGTGCCACAGTCTATGCCGACTCCG
[0135] TGAAGGGCCGATTCACCATCTCCCGAGACAACGCCGAGAACACGGTGTATCTACAAATGAACA
[0136] GCCTGAAAACCTGAGGACACTGCCATGTACTATTGTGCGGCAAAACTTGTCAGTGGTCGCTGGTTGACGGGGACCTATACCTACTGGGGCCAGGGGGACCCAGGTCACCGTCTCCTCA.
[0137] The present invention also provides a recombinant vector containing the above-isolated polynucleotides.
[0138] The recombinant vector is an expression vector or a cloning vector, preferably an expression vector.
[0139] This invention also provides a host cell containing the recombinant vector as described in any of the foregoing embodiments.
[0140] This invention also provides an immunoconjugate or pharmaceutical composition comprising the anti-B7H3 nanobody or the antibody described in any of the foregoing embodiments.
[0141] In some embodiments, the immune conjugate further includes a therapeutic agent.
[0142] In some embodiments, the therapeutic agent includes at least one of: immune checkpoint-related agents, toxins, factors, drugs, radionuclides, kinase inhibitors, and cytotoxic agents.
[0143] In some embodiments, the pharmaceutical composition includes at least one of a pharmaceutical excipient, a carrier, and a diluent.
[0144] In a preferred embodiment of the present invention, the carrier is a pharmaceutically acceptable carrier, which includes, but is not limited to, one or a combination of polyvinylpyrrolidone and its derivatives, polyvinyl alcohol and its derivatives, methylcellulose and its derivatives, ethylcellulose and its derivatives, hydroxypropylcellulose and its derivatives, starch and its derivatives, polyethylene glycol and its derivatives, lactose, sucrose, mannitol, trehalose, sorbitol, dextrin, microcrystalline cellulose, acrylic resin, dicalcium phosphate, calcium stearate, sodium stearoyl fumarate, silicon dioxide, titanium dioxide, talc, and indigo.
[0145] The excipients include at least one polar organic solvent and at least one thickener.
[0146] Diluents may be selected from pharmaceutically acceptable water or salt.
[0147] Furthermore, the present invention also provides the use of the above-mentioned anti-B7H3 nanobody, isolated polynucleotide, or host cell in the preparation of medicaments for the prevention, diagnosis, or treatment of tumors.
[0148] Furthermore, the tumors include at least one of the following: head and neck tumors, craniopharyngioma, prostate cancer, glioma, squamous cell carcinoma of the skin, melanoma, intestinal adenocarcinoma, gastric adenocarcinoma, pancreatic cancer, clear cell carcinoma of the kidney, breast cancer, liver cancer, bladder cancer, cervical cancer, skin cancer, neuroblastoma, medulloblastoma, ovarian cancer, lung adenocarcinoma, or acute myeloid leukemia.
[0149] The “treatment” described in this invention includes curing, improving, or alleviating a patient’s condition or pathological characteristics, or inhibiting the deterioration of the condition.
[0150] The features and performance of the present invention will be further described in detail below with reference to embodiments.
[0151] Example 1: Construction, expression, and purification of the B7H3-His protein eukaryotic expression vector.
[0152] 1.1 Carrier Construction
[0153] Using a plasmid containing the full-length B7H3 gene (gene number NM_001024736.2) as a template, primers were designed to amplify the B7H3 extracellular domain (ECD) gene. The ECD gene was then ligated into the pVax-His vector, which had been digested with restriction endonucleases PstⅠ and XbaⅠ, via homologous recombination. The vector was transformed into DH5α competent cells, plated on kanamycin-resistant plates, and incubated overnight at 37°C. Single clones were picked and sequenced for identification. Plasmids were extracted from successfully constructed clones through amplification culture.
[0154] 1.2 Expression and purification of recombinant proteins
[0155] The recombinant plasmid pVax-B7H3(ECD)-His, containing the extracellular region of the B7H3 gene, was successfully transfected into HEK293T cells. After transient transfection for 8 hours, the medium was replaced with fresh 293 freestyle medium and cultured for 5 days. The culture supernatant was collected, and the high-purity recombinant protein B7H3-His was obtained by affinity chromatography using an NTA-Ni column. The results are as follows. Figure 1 As shown.
[0156] Example 2: Screening and preparation of anti-B7H3 protein nanobodies
[0157] 2.1 Protein emulsification and animal immunity
[0158] Purified 1 mg of B7H3-His recombinant protein was emulsified with an equal volume of Freund's complete adjuvant and administered subcutaneously to Bactrian camels in Alashan via the neck for the first immunization. Subsequently, every two weeks, 1 mg of B7H3-His recombinant protein was emulsified with incomplete Freund's adjuvant for three consecutive immunizations, followed by peripheral blood collection via the jugular vein. B7H3-His recombinant protein was coated at a rate of 200 ng / well in 96-well ELISA plates. Camel serum was serially diluted before and after immunization, and the antibody titer against B7H3 protein in the serum was detected by indirect ELISA. Results are as follows: Figure 2 As shown, the antibody titer against B7H3-His protein was 1:256,000, indicating a good immunization effect and laying the foundation for subsequent library construction.
[0159] 2.2 Construction and panning of VHH phage antibody library
[0160] 2.2.1 Isolation of peripheral blood lymphocytes
[0161] On day 7 post-immunization, 200 mL of peripheral anticoagulated blood was aseptically collected via the jugular vein. The blood was first diluted with an equal volume of PBS, then separated into 7.5 × 10⁻⁶ cells using Ficoll-Paque Plus lymphocyte separation medium (catalog 17144002, Cytiva) and lymphocyte separation tubes via centrifugation. 8 Peripheral blood lymphocytes were collected, and the obtained lymphocytes can be directly used to extract total RNA or frozen at -80°C for later use.
[0162] 2.2.2 VHH gene amplification
[0163] First, total RNA from lymphocytes was extracted according to the instructions (catalog 74134, RNeasy Plus MiniKit, QIAGEN). Then, cDNA was obtained by reverse transcription using RNA as a template using a reverse transcription kit (catalog 18080051, SuperScriptⅢ First-Strand Synthesis System, Invitrogen). Using cDNA as a template, the VHH gene was amplified by nested PCR. The primers used for the first round of PCR were CALL001 (nucleotide sequence as shown in SEQ ID NO: 76) and CALL002 (nucleotide sequence as shown in SEQ ID NO: 77). The approximately 700bp band was separated and recovered by agarose gel electrophoresis. Then, the recovered 700bp product was used as a template for the second round of PCR amplification. The primers used for the second round of PCR were VHH-FOR (nucleotide sequence as shown in SEQ ID NO: 78) and VHH-REV (nucleotide sequence as shown in SEQ ID NO: 79). The 400bp band was separated and recovered by agarose gel electrophoresis. The primer sequences are shown in Table 2 below.
[0164] Table 2 Primer sequences required for VHH gene amplification
[0165] Primer name Serial Number Primer sequence (5'-3') CALL001 SEQ ID NO: 76 GTCCTGGCTGCTCTTCTACAAGG CALL002 SEQ ID NO: 77 GGTACGTGCTGTTGAACTGTTCC VHH-FOR SEQ ID NO: 78 CAGGTGCAGCTGCAGGAGTCTGGGGGAGR VHH-REV SEQ ID NO: 79 CTAGTGCGGCCGCTGAGGAGACGGTGACCTGGGT
[0166] 2.2.3 Construction of VHH phage display vector
[0167] The 400bp product recovered in 2.2.2 and the phage display vector pMECS were both digested with Pst I and Not I and then recovered, and then ligated using T4 DNA ligase.
[0168] 2.2.4 Harvesting of ligation products from electroporation of TG1 competent cells and phage antibody libraries
[0169] The ligation product from section 2.2.3 was added to E. coli TG1 competent cells and electroporated to allow it to enter TG1 cells. Immediately after electroporation, SOC medium was added and the cells were incubated at 37°C and 200 rpm for 1 h. The cells were then plated on LB / AMP-GLU plates and incubated at 37°C for 6–8 h. The bacterial colony was collected and 1 / 3 volume of 50% glycerol was added to obtain the prepared phage library.
[0170] 2.2.5 Determination of phage library diversity and library capacity
[0171] The electroconversion product was diluted 10-fold and then plated on LB / Amp-Glu plates. After incubation at 37°C for 12 h, the number of transformants was calculated, and the final library size was 1.73 × 10⁻⁶. 10 Phage library.
[0172] 2.2.6 Screening of nanobodies specifically targeting B7H3 protein
[0173] Using the prepared phage library as the antibody source, three rounds of screening were conducted using phage display technology. First, purified B7H3-His recombinant protein (2 μg / mL) was coated onto a 96-well microplate. The next day, the plate was blocked with 3% skim milk powder at 37°C for 1 hour. 1×10⁻⁶ ppm of the protein was added to each well. 10 Recombinant phages containing nanobodies were incubated at 37°C for 1 hour, washed five times with PBST, and then eluted with 0.1M glycine (pH 1.5) to remove phages bound to B7H3-His. The elution was neutralized with 1M Tris-HCl (pH 8.0). The elution buffer was then used to infect the host bacterium TG1 and cultured on a large scale. Three rounds of screening were performed. From the plates selected in the third round of screening, 192 clones were randomly selected for further culture. Monoclonal ELISA was used to identify nanobodies specifically binding to the B7H3 protein. The results showed that 128 of the 192 selected clones were positive (P / N > 3.0, where P represents the OD450 value of the B7H3 well and N represents the OD450 value of the control well). Sequencing analysis of the positive clones yielded 15 specific anti-B7H3 nanobodies.
[0174] Example 3: Preparation of specific nanobodies against B7H3 protein
[0175] The VHH gene was amplified using the plasmid containing the nanobody gene from step 2.2.6 as a template and constructed into the eukaryotic expression vector pcDNA3.1-hFc via homologous recombination. After sequencing confirmed that the plasmid was correct, it was extracted and transfected into HEK293T cells. After 5 days of expression, the supernatant was collected and purified by affinity chromatography using an NTA-Ni column to obtain the recombinant nanobody.
[0176] Example 4: IFA detection of binding between anti-B7H3 nanobody and cellular-level B7H3 antigen
[0177] The anti-B7H3 nanobody recombinant protein (Nbs-hFc) prepared in Example 3, the anti-B7H3 positive control antibody 8H9 (Ahmed M et al., Humanized Affinity-matured Monoclonal Antibody 8H9 Has Potent Antititumor Activity and Binds to FG Loop of Tumor Antigen B7-H3. J BiolChem. 2015 Dec 11; 290(50):30018-29), and the isotype control antibody were co-incubated with HeLa cells overexpressing B7H3 molecules (B7H3-HeLa) at 37°C for 1 h. After washing three times with PBS, the cells were then incubated with Alexa Fluor. TM The 594 Goat anti-human IgG (H+L) (ThermoFisher) secondary antibody (1:500) was used for detection. The results were observed, imaged, and recorded using a fluorescence microscope. Figure 3 As shown, the anti-B7H3 nanobody recombinant protein (Nbs-hFc) in this invention has good binding activity with B7H3 at the cellular level.
[0178] Example 5: FACS detection of the binding specificity of anti-B7H3 nanobody
[0179] The anti-B7H3 nanobody recombinant protein (Nbs-hFc), the anti-B7H3 positive control antibody 8H9, and the isotype control antibody prepared in Example 3 were co-incubated with B7H3-HeLa cells, wild-type HeLa cells, wild-type A375 cells, and A375 cells with B7H3 knockout molecules (A375-B7H3-KO) at 37°C for 1 h. After washing three times with PBS, the cells were incubated using Alexa Fluor. TM The secondary antibody 647 Goat anti-human IgG (H+L) (ThermoFisher) (1:600) was used for detection, and the results were analyzed using flow cytometry. Figure 4 As shown, the recombinant anti-B7H3 nanobody protein (Nbs-hFc) of this invention exhibits good binding activity with B7H3-HeLa cells, wild-type HeLa cells, and wild-type A375 cells, but does not bind with A375-B7H3-KO cells, indicating that the anti-B7H3 nanobody prepared in this invention has good specific binding activity with the B7H3 antigen.
[0180] Example 6: Biacore detection of the affinity between nanobodies and B7H3 protein.
[0181] The binding affinity of the recombinant anti-B7H3 nanobody to the B7H3-mFc antigen coated on a CM5 chip (catalog 29104988, Cytiva) was detected using a Biacore 8k instrument. The results are shown in Table 3. The affinity between the recombinant anti-B7H3 nanobody and the B7H3 protein was between 10 and 10. -12 M~10 -9 M are all high-affinity antibodies.
[0182] Table 3. In vitro binding affinity and kinetics analysis of anti-B7H3 nanobodies to B7H3 protein.
[0183] Antibody number Antibody name Binding rate ka(1 / Ms) Dissociation rate kd(1 / s) Affinity KD(M) 1# Nb1 2.52E+06 2.89E-03 1.15E-09 3# Nb10 1.45E+06 9.31E-04 6.40E-10 4# Nb12 4.17E+06 1.64E-03 3.94E-10 6# Nb15 3.25E+06 6.39E-03 1.97E-09 8# Nb25 3.65E+06 2.10E-03 5.76E-10 11# Nb52 1.94E+05 2.75E-07 1.41E-12 12# NbH59 6.00E+06 5.90E-03 9.84E-10 13# Nb60 9.99E+05 2.73E-04 2.74E-10 14# Nb64 3.07E+06 9.09E-03 2.97E-09 16# Nb70 1.67E+06 8.89E-04 5.31E-10 17# Nb90 1.13E+06 6.10E-04 5.37E-10 18# NbH1 1.75E+06 7.77E-04 4.44E-10 19# NbH51 3.16E+06 7.02E-04 2.22E-10 20# NbH68 1.76E+06 8.06E-04 4.58E-10 21# NbH73 6.12E+05 3.86E-04 6.30E-10
[0184] Example 7: RTCA detection of the in vitro killing activity of B7H3 / CD3 bispecific antibody against B7H3-HeLa cell line.
[0185] The 15 nanobodies provided in this invention were tandemly constructed into eukaryotic expression vectors with the single-chain antibody OKT3 scFv (Table 4, SEQ ID NO: 80) against CD3 molecules using a G4S linker, transfected into HEK293T cells for expression, and purified using a Ni column.
[0186] Table 4. Sequence information of anti-CD3 molecular antibody OKT3 scFv
[0187]
[0188] B7H3-HeLa cells were slowly added to a 96-well plate of a label-free killer assay (RTCA) at a density of 5000 cells per well (100 μL / well, replicates). The plates were cultured until the cell index reached 1.0–2.0. T cells and B7H3 / CD3 bispecific antibody (0.01 μg / mL) were then added at an E:T ratio of 5:1 for co-culture. The instrument was then started for further analysis. Results are as follows: Figure 5 As shown, compared with the blank group and the irrelevant control group, the cell index of the above 15 B7H3 / CD3 bispecific antibodies (anti-CD19scFv antibody sequence refers to the approved product Tisagenlecleucel) was close to 0 after co-culturing for 50 h, indicating that the above anti-B7H3 / CD3 bispecific antibodies all have good killing activity against B7H3-HeLa cells.
[0189] Example 8: Detection of antitumor activity of B7H3 / CD3 bispecific antibody in an AML model
[0190] The anti-B7H3 nanobody recombinant protein (Nbs-hFc) prepared in Example 3 and the anti-B7H3 positive control antibody 8H9 were co-incubated with acute myeloid leukemia (AML) cells MV-4-11 at 37°C for 1 hour. After washing three times with PBS, the cells were then incubated using Alexa Fluor. TM The results of testing with 647 Goat anti-human IgG (H+L) (ThermoFisher) secondary antibody (1:600) showed that the recombinant anti-B7H3 nanobody protein (Nbs-hFc) of this invention was positive for binding to MV-4-11 cells. Figure 6 A).
[0191] MV-4-11-luciferase cells were divided into groups of 2 × 10⁶ cells per cell. 6 Cells were injected into 6-8 week old NCG mice via tail vein. Tumor growth was monitored using an in vivo imaging system. After tumor formation, the mice were randomly divided into 17 groups of 3 mice each. A blank control group (PBS), an experimental group (B7H3 / CD3 bispecific antibody), and an irrelevant control group (CD19-CD3 bispecific antibody) were established. The bispecific antibody was administered intraperitoneally every 2 days for 7 consecutive days at a dose of 2.5 mg / kg. The blank control group received the same volume of PBS. During the first administration, each mouse in the experimental group (B7H3 / CD3 bispecific antibody) and the irrelevant control group (CD19-CD3 bispecific antibody) received 1 × 10⁻⁶ cells via tail vein. 7 Each mouse in the experimental group (B7H3 / CD3), the unrelated control group (CD19-CD3), and the blank control group (PBS) was injected with the same volume of PBS via the tail vein. The survival status of each mouse in the experimental group (B7H3 / CD3), the unrelated control group (CD19-CD3), and the blank control group (PBS) was observed and statistically analyzed over a period of 40 days. Survival curves were plotted using the Kaplan-Meier method, and the results are as follows: Figure 6 As shown in Figure B, all mice in the blank control group (PBS) and the irrelevant control group (CD19-CD3 bispecific antibody) died 16 days after tumor inoculation, while the mice in the 15 B7H3 / CD3 bispecific antibody groups prepared in this invention had a 100% survival rate 40 days after tumor inoculation. This indicates that the 15 B7H3 / CD3 bispecific antibodies prepared in this invention all have good anti-tumor activity in the mouse xenograft model of AML.
[0192] The experimental results above show that the 15 anti-B7H3 nanobodies obtained in this invention all possess excellent antigen-binding activity and specificity, and are all high-affinity antibodies. The B7H3 / CD3 bispecific antibody formed by combining the anti-B7H3 nanobodies of this invention with the anti-CD3 molecule antibody OKT3 scFv exhibits good killing activity against tumor cells both in vitro and in vivo, and can be used to prepare drugs for the prevention or treatment of tumors.
Claims
1. A nanobody against B7H3, characterized in that: The heavy chain variable region contains CDR1, CDR2 and CDR3, and the amino acid sequences of CDR1 to CDR3 are shown in SEQ ID NO: 57 to 59.
2. The anti-B7H3 nanobody according to claim 1, characterized in that: It also includes a backbone region, and the structure of the VHH chain of the nanobody is: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4.
3. The anti-B7H3 nanobody according to claim 1, characterized in that: The amino acid sequence of CDR1 is shown in SEQ ID NO:57, the amino acid sequence of CDR2 is shown in SEQ ID NO:58, the amino acid sequence of CDR3 is shown in SEQ ID NO:59, and the amino acid sequence of VHH is shown in SEQ ID NO:
60.
4. The anti-B7H3 nanobody according to claim 1, characterized in that: The anti-B7H3 nanobody is at least one of monovalent or multivalent nanobody.
5. A bispecific antibody against B7H3 / CD3, characterized in that, The bispecific antibody is constructed by tandemly linking the anti-B7H3 nanobody as described in any one of claims 1-4 with the single-chain antibody OKT3, which has an anti-CD3 molecule with an scFv amino acid sequence as shown in SEQ ID NO: 80, using a G4S linker.
6. An isolated polynucleotide encoding the anti-B7H3 nanobody according to any one of claims 1-4.
7. The isolated polynucleotide according to claim 6, characterized in that: The nucleotide sequence of the isolated polynucleotide is shown in SEQ ID NO:
75.
8. A recombinant vector containing the isolated polynucleotide as described in claim 6 or 7.
9. A host cell comprising the recombinant vector of claim 8.
10. Use of the anti-B7H3 / CD3 bispecific antibody of claim 5 in the preparation of a medicament for the prevention or treatment of tumors; wherein the tumor is acute myeloid leukemia.
Citation Information
Patent Citations
High affinity nanobodies targeting b7h3 (CD276) for treating multiple solid tumors
CA3156761A1
B7-h3 nanobody and preparation method therefor and use thereof
WO2021068871A1