Method for preparing beauveria bassiana protoplast by using driselase

Abstract

The invention provides a method for preparing beauveria bassiana protoplast by using driselase. The method comprises the following steps: obtaining beauveria bassiana hyphae, and washing with a NaCl solution; mixing the washed beauveria bassiana hyphae with an enzymatic hydrolysate according to a ratio of 1g: 50mL, and carrying out oscillation enzymolysis; after the enzymolysis is finished, carrying out post-treatment on the enzymatic hydrolysate to prepare the beauveria bassiana protoplast; wherein the concentration of the driselase in each gram of the enzymatic hydrolysate is 5-20 g / L. Under the optimal enzymolysis condition, the yield of the protoplast of the beauveria bassiana reaches 2.56 * 107 / mL, and compared with the prior art, the yield of the protoplast of the beauveria bassiana is increased by about 2.56 times.

Description

Technical Field

[0001] The invention belongs to the field of bioengineering, and in particular relates to a method for preparing Beauveria bassiana protoplasts by using collapsing enzyme. Background Art

[0002] R-(+)-2-(4-hydroxyphenoxy) propionic acid (D-HPPA) is an important chiral intermediate for the synthesis of aryloxyphenoxy propionate (APP) herbicides. At present, the industrial production of this intermediate mainly adopts chemical methods, and its production process has the disadvantages of complex operation, multiple reaction steps, harsh reaction conditions, many by-products, large environmental pollution and low yield. The biocatalytic method has the advantages of stereoselectivity, mild reaction conditions, safety and health, environmental friendliness, high product purity, and easy separation and extraction of products. Therefore, the realization of biological preparation of key chiral intermediates of aryloxyphenoxy propionic acid herbicides has huge economic and social benefits.

[0003] Beauveria bassiana can carry out a variety of biocatalytic reactions, including methylation, glycosylation, hydroxylation and other biocatalytic reactions. Among them, the hydroxylation reaction of Beauveria bassiana has been applied to the industrial production of steroidal and hormone drugs, and has achieved remarkable success. The use of the hydroxylation reaction of Beauveria bassiana to synthesize D-HPPA with D-PPA as a substrate can not only overcome the shortcomings of traditional chemical methods and fermentation methods, but also has the advantages of being green, efficient, simple and convenient. Matthias et al. specifically converted the substrate D-PPA into the product D-HPPA through the extracellular heme alcohol peroxidase of Agrocybe oleracea, with a conversion rate of 60%. BASF in Germany used Beauveria bassiana to carry out biocatalytic reactions to synthesize D-HPPA, and its conversion rate could reach 99% in a substrate D-PPA concentration of 50g / L. The research and development of efficient and green synthesis technology for chiral pesticides and their intermediates is inseparable from efficient and stable molecular manipulation methods. However, there is still a problem of poor enzymatic hydrolysis effect in the preparation process of Beauveria bassiana protoplasts. Summary of the invention

[0004] In order to solve the problem that the enzymatic hydrolysis effect is still poor in the preparation process of Beauveria bassiana protoplasts in the prior art, the present invention applies the cleavage enzyme to the preparation of Beauveria bassiana protoplasts, and provides a method for preparing Beauveria bassiana protoplasts using the cleavage enzyme, and the prepared Beauveria bassiana protoplasts. On this basis, the present invention also provides a method for constructing a genetically engineered strain of Beauveria bassiana that produces D-HPPA.

[0005] The technical scheme adopted by the present invention is: a method for preparing protoplasts of Beauveria bassiana by using a collider, comprising: obtaining mycelia of Beauveria bassiana and washing them with a NaCl solution; mixing the washed mycelia of Beauveria bassiana with an enzymatic hydrolysis solution in a ratio of 1g:50mL, and performing oscillation enzymatic hydrolysis; after the enzymatic hydrolysis is completed, post-treating the enzymatic hydrolysis solution to obtain protoplasts of Beauveria bassiana; wherein the concentration of the collider in the enzymatic hydrolysis solution is 5-20g / L.

[0006] In order to solve the problem of poor enzymolysis effect in the preparation process of Beauveria bassiana protoplasts, the inventor team tried to use lysozyme, lysozyme, cellulase, chitinase, glucanase, driselase, snail enzyme, yatalase enzyme to enzymolyze Beauveria bassiana, and found that only driselase and yatalase enzymes have enzymolysis effects on mycelia. However, the enzymolysis effect of the two enzymes on mycelia after compounding is not as good as the single enzyme enzymolysis effect of driselase. On this basis, the present invention explores the optimal enzymolysis conditions of driselase, and uses the protoplasts obtained by the method as competent cells to construct a genetically engineered bacterium in Beauveria bassiana.

[0007] Preferably, the concentration of the hydrolyzate in the enzymatic solution is 15 to 20 g / L, more preferably 15 g / L.

[0008] Preferably, the Beauveria bassiana includes Beauveria bassiana, Beauveria microspora, and Beauveria bassiana.

[0009] Preferably, the method for obtaining Beauveria bassiana hyphae comprises: culturing Beauveria bassiana at 120-180 r / min and 25-35° C. for 3-5 days to obtain a bacterial solution containing Beauveria bassiana hyphae; filtering the bacterial solution and then washing it with a 0.7-1M NaCl solution to obtain Beauveria bassiana hyphae. The concentration of the NaCl solution is more preferably 0.8M.

[0010] Preferably, the temperature of the shaking enzymolysis is 25-35°C, more preferably 28-30°C.

[0011] Preferably, the rotation speed of the oscillating enzymolysis is 120-180 r / min, more preferably 150 r / min.

[0012] Preferably, the temperature of the shaking enzymolysis is 1 to 3 h, more preferably 2.5 to 3 h.

[0013] Preferably, the method for post-treating the enzymatic hydrolysate comprises: washing and filtering the enzymatic hydrolysate with an STC solution, resuspending the precipitate in an STC solution after centrifugation, and obtaining the protoplasts of Beauveria bassiana. The preferred STC solution is: 1.2M sorbitol, 10mM Tris (pH7.5), 50mM CaCl2. The preferred centrifugation is 4°C, 2000xg.

[0014] The invention also provides the Beauveria bassiana protoplasts prepared by the method.

[0015] The present invention also provides an application of the collider enzyme in preparing Beauveria bassiana protoplasts, the application comprising: obtaining Beauveria bassiana hyphae and washing them with a NaCl solution; mixing the washed Beauveria bassiana hyphae with an enzymatic hydrolysis solution in a ratio of 1 g:50 mL, and performing oscillation enzymatic hydrolysis; after the enzymatic hydrolysis is completed, post-treating the enzymatic hydrolysis solution to obtain Beauveria bassiana protoplasts; wherein the concentration of the collider enzyme in the enzymatic hydrolysis solution is 5 to 20 g / L.

[0016] The present invention also provides a method for constructing a genetically engineered bacterium of Beauveria bassiana producing D-HPPA, comprising: constructing an expression plasmid containing a VHB gene, wherein the VHB gene is regulated by a promoter GPDA; introducing the expression plasmid containing the VHB gene into a protoplast of Beauveria bassiana ZJB23323 to construct a genetically engineered bacterium of Beauveria bassiana; wherein the protoplast of Beauveria bassiana ZJB23323 is prepared by the method for preparing protoplast of Beauveria bassiana using a crash enzyme. Wherein, Beauveria bassiana ZJB23323 has been disclosed in patent CN116590153A.

[0017] Preferably, the expression plasmid containing the VHB gene is introduced into the protoplasts of Beauveria bassiana ZJB23323 by PEG-CaCl2-mediated chemical transformation. The screening method for Beauveria bassiana transformants is resistance screening, and the resistance gene is the glufosinate resistance gene Bar (GenBank accession number X17220). The specific transformation method includes: adding 100uL of protoplast suspension and 10ug of expression plasmid containing VHB gene to a transformation tube, gently mixing, standing on ice for 15 to 20 minutes, adding 50uL of 60% PEG6000, standing on ice for 15 to 20 minutes, adding 500uL of 60% PEG6000 and 1mL STC solution, and adding the transformation system to 10mL of MYG semi-solid culture medium cooled to room temperature and containing 200ug / mL of glufosinate resistance and 0.5% agar powder, shaking and pouring onto a MYG plate with the same glufosinate resistance concentration, culturing at 28°C for 4 to 5 days to obtain transformants.

[0018] The constructed D-HPPA-producing Beauveria bassiana genetically engineered bacteria are applied to the preparation of D-HPPA by microbial fermentation. The application includes: using the wet bacterial bodies obtained by fermentation culture of the D-HPPA-producing Beauveria bassiana genetically engineered bacteria as a catalyst, using D-PPA as a substrate, forming a reaction system in a buffer solution, and synthesizing D-HPPA.

[0019] Beneficial effects of the present invention: In order to solve the problem of poor enzymatic hydrolysis effect in the preparation process of Beauveria bassiana protoplasts, the inventor team tried to use lysozyme, lysozyme, cellulase, chitinase, glucanase, driselase, snailase, and yatalase to hydrolyze Beauveria bassiana, and found that only driselase and yatalase had enzymatic hydrolysis effects on mycelium. However, the enzymatic hydrolysis effect of the two enzymes on mycelium after being combined was not as good as that of driselase alone. On this basis, the present invention explored the optimal enzymatic hydrolysis conditions of driselase. Under the optimal enzymatic hydrolysis conditions, the protoplast yield of Beauveria bassiana reached 2.56*10 7 / mL, compared with the method of preparing protoplasts using cellulase: snail enzyme: lysozyme by Li Shujiang, Zhu Tianhui and others, the yield of protoplasts increased by about 2.56 times. On the basis of this method, the present invention also provides a method for constructing genetically engineered bacteria in Beauveria bassiana that produces D-HPPA, by enhancing the oxygen utilization rate of Beauveria bassiana to improve the conversion efficiency of substrate D-PPA, after static biofilm fermentation, the H-PPA yield can reach 25g / L or more on the tenth day, which is slightly higher than the starting strain, providing a new idea for mining potential genes to prepare competent cells by overexpression. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is a morphological picture of the Beauveria bassiana protoplasts obtained in Example 1 of the present invention under a 40× optical microscope.

[0021] Figure 2 This is a gel image showing the verification of the PUC19-VHB transformant in Example 2 of the present invention.

[0022] Figure 3 This is a fermentation diagram of the PUC19-VHB transformant in Example 2 of the present invention. DETAILED DESCRIPTION

[0023] The following is an explanation of the embodiments of the present invention by specific specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied by other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that, in the absence of conflict, the features in the following embodiments and embodiments can be combined with each other. In the embodiments of the present invention, the methods used are all conventional methods unless otherwise specified, and the reagents used can be obtained from commercial sources.

[0024] Example 1: Preparation of Beauveria bassiana protoplasts using lysase under different enzymatic conditions

[0025] The protoplasts of Beauveria bassiana were prepared using the collider enzyme according to the conditions shown in Table 1. The specific steps are as follows.

[0026] (1) Beauveria bassiana was inoculated into a 250 mL conical flask, cultured at 150 rpm and 28°C for 3-5 days to obtain mycelium in a liquid environment, filtered through four layers of gauze, and then rinsed with 0.8 M NaCl solution for 3-5 times for later use;

[0027] (2) Preparation of enzymatic hydrolysis solution: The concentration of the lysase in the enzymatic hydrolysis solution was 5, 10, 15, and 20 g / L respectively;

[0028] (3) 1 g of the mycelium prepared in step (1) and 10 mL of the enzymatic hydrolysate of different concentrations prepared in step (2) were mixed in 50 mL centrifuge tubes, and placed on a shaker at 150 r / min for 1, 1.5, 2, 2.5, and 3 h, respectively. The enzymatic hydrolysis temperatures were 24, 26, 28, and 30 ° C, respectively.

[0029] (4) After the enzymatic hydrolysis is completed, the enzymatic hydrolyzate is rinsed on a sterile magic filter cloth with an STC solution (1.2 M sorbitol, 10 mM Tris (pH 7.5), 50 mM CaCl2). After rinsing twice, the mixture is centrifuged at 4°C / 2000 x g and the precipitate is resuspended in the STC solution to obtain Beauveria bassiana protoplasts.

[0030] The obtained Beauveria bassiana protoplasts were counted using a snowball plate counter, and the results are shown in Table 1. Protoplast number (pieces / mL) = (total number of protoplasts in 100 small grids / 100) × 400 × 1000 × dilution factor.

[0031] Table 1. Preparation of Beauveria bassiana protoplasts using colliderase under different enzymatic conditions

[0032]

[0033] According to methods 1, 2, 8, and 4, when the driselase concentration is less than 15 g / L, the number of protoplasts gradually increases with the increase of the driselase concentration, but after the concentration rises to 20 g / L, the number of protoplasts decreases instead of increases. According to methods 5 to 9, it can be seen that too long enzymatic hydrolysis time (3 h) will not continue to improve the enzymatic hydrolysis effect, and the number of protoplasts obtained is slightly lower than that under 2.5 h conditions. Considering the effect of temperature increase on bacterial activity, the maximum enzymatic hydrolysis temperature is set to 30 ° C. Therefore, it can be seen from Table 1 that the optimal enzymatic hydrolysis conditions are a driselase concentration of 15 g / L, an enzymatic hydrolysis time of 2.5 h, and an enzymatic hydrolysis temperature of 30 ° C.

[0034] Comparative Example 1: Preparation of Beauveria bassiana protoplasts using different enzymes under the same enzymatic hydrolysis conditions

[0035] According to the steps of Example 1, under the enzymatic hydrolysis conditions of method 13, 15 g / L of lysozyme, lysozyme, cellulase, chitinase, glucanase, snailase, and yatalase were used to enzymatically hydrolyze Beauveria bassiana. The results are shown in Table 2, where lysozyme, lysozyme, cellulase, chitinase, glucanase, and snailase had no enzymatic hydrolysis effect on the hyphae of Beauveria bassiana. The enzymatic hydrolysis effect of yatalase and lysozyme in different proportions was far inferior to that of yatalase or lysozyme alone. Among them, the enzymatic hydrolysis effect of lysozyme alone was much better than that of yatalase, and the protoplast yield reached 2.56*10 under the conditions of method 13. 7 Pieces / mL.

[0036] Table 2. Preparation of Beauveria bassiana protoplasts using different enzymes under the same enzymatic conditions

[0037] method Enzymes <![CDATA[Number of protoplasts (10 7 cells / mL)]]> Method 14 Lysozyme 0 Method 15 Lytic enzyme 0 Method 16 Cellulase 0 Method 17 Chitinase 0 Method 18 Glucanase 0 Method 19 Snail enzyme 0 Method 20 yatalase enzyme 1.04 Method 20 16g / L Lyatalase + 4g / Lyatalase 0.19 Method 21 12g / L Lyatalase + 8g / Lyatalase 0.0825 Method 22 8g / L Lyatalase + 12g / Lyatalase 0.06 Method 23 4g / L Lyatalase + 16g / Lyatalase 0.12

[0038] Comparative Example 2: Preparation of Beauveria bassiana protoplasts by conventional methods

[0039] The traditional method uses common enzymes such as lysozyme, lytic enzyme, cellulase, chitinase, glucanase, and snailase to prepare the protoplasts of Beauveria bassiana. Among them, Li Shujiang, Zhu Tianhui and others used cellulase, snailase, and lysozyme to prepare protoplasts, with a ratio of 5:2.5:2.5 (mg / mL), enzymolysis temperature of 32°C, and enzymolysis time of 3h. The highest protoplast yield reached 1*10 7 Compared with the methods of Li Shujiang, Zhu Tianhui and others, the method for preparing protoplasts of the present invention uses a single enzyme to achieve a protoplast yield that is 2.56 times (method 13) and 2.44 times (method 8), and has the advantages of shorter enzymolysis time and lower enzymolysis temperature, and the lower enzymolysis temperature (28-30°C) can reduce the effect of high temperature on bacterial activity.

[0040] Example 2: Construction of a genetically engineered strain of Beauveria bassiana producing D-HPPA

[0041] (1) Construction of an expression plasmid containing the VHB gene: The PUC19 plasmid containing the ampicillin resistance gene was used to construct the overexpression plasmid PUC19-VHB, the promoter of the target gene VHB from Fusariumfujikuroi was GPDA, the screening method for Beauveria bassiana transformants was resistance screening, and the resistance gene was the glufosinate resistance gene Bar (GenBank accession number X17220). The primers used in the construction process are shown in Table 3. Among them, the PCR reaction system was 50uL in total: Fusariumfujikuroi978# whole genome template 2uL, 2×PhantaMix Buffer 25uL, upstream and downstream primers 2uL each, dNTPMix 1uL, PhantaMix Super-Fidelity 1uL, ddH2O 50uL (the reagents used in the PCR reaction were purchased from Novozyme Biotech Co., Ltd.). The PCR reaction conditions were: 95°C for 10 min, (95°C for 30 s, 60°C for 30 s, 72°C for 1 min, 30 cycles), and extension at 72°C for 10 min.

[0042] Table 3. Primer list

[0043] Primers sequence AF GCCGGTCTTGCGATGCAACGTATCTTATTTAAAGTGCGTTG GPDA-R GGTGATGTCTGCTCAAGCG BF TATTCTACCCAAGCATCCAAATGAGCCCAGAACGACGC BR ATCGCAAGACCGGCAA trpc-R TTGGATGCTTGGGTAGAATAGG VHB-F TGAGCAGACATCACCATGCTGGACCAGCAGACATTAATATT VHB-R CCCTCTTGCTCAATCATTACTCCACGGCCTGAGCATA YF TGCATCTAGATATCGGATCC Y-VHB-R CACAATGGGATAGTGGGC

[0044] (2) The expression plasmid PUC19-VHB was introduced into the protoplasts of Beauveria bassiana ZJB23323 prepared by method 8 of Example 1 to obtain a genetically engineered strain of Beauveria bassiana producing D-HPPA. Beauveria bassiana ZJB23323 has been disclosed in patent CN116590153A and is deposited in the China Center for Type Culture Collection, with a deposit number of CCTCC NO: M2023584, a deposit date of April 21, 2023, and an address of Wuhan University, Wuhan, China, 430072. The PUC19-VHB plasmid constructed above was transformed and integrated by PEG-CaCl2-mediated chemical transformation: 100uL protoplast suspension and 10ug prepared PUC-VHB plasmid were added to the transformation tube, gently mixed, let stand on ice for 20min, 50uL 60% PEG6000 was added, let stand on ice for 20min, 500uL 60% PEG6000 and 1mL STC solution were added and mixed thoroughly, and the transformation system was added to 10mL MYG semi-solid medium (MYG medium: maltose 5g / L, yeast powder 5g / L, glucose 10g / L, sucrose 171g / L, agar powder 15g / L) cooled to room temperature and with 200ug / mL of glufosinate resistance and 0.5% agar powder, shaken well and poured onto a MYG plate with the same glufosinate resistance concentration, and cultured at 28°C for 4-5 days to obtain transformants. The transformants were sent to Qingke Company for sequencing, and the sequencing primers were: YF / Y-VHB-R. The gel image of PUC19-VHB transformant verification is shown in Figure 2 .

[0045] (3) The constructed D-HPPA-producing Beauveria bassiana genetically engineered bacteria are applied to the preparation of D-HPPA by microbial fermentation. The genetically engineered bacteria of the D-HPPA-producing Beauveria bassiana and the wet cells obtained by fermentation culture of the starting strain are used as catalysts, and D-PPA is used as a substrate to form a reaction system in a buffer solution to synthesize D-HPPA.

[0046] Seed solution: Scrape an appropriate amount of spore powder from an agar plate containing 50 g / LPPA and culture it in a fermentation medium on a shaker for 3-5 days.

[0047] Liquid volume: 20mL / 250mL small shake bottle.

[0048] Transfer inoculum volume: 10%, 2mL per bottle.

[0049] Fermentation medium formula: 50g / L R-PPA, 40g / L glucose, 10g / L yeast powder, 0.977g / L anhydrous magnesium sulfate, 0.755g / L anhydrous calcium chloride, 1.8g / L dipotassium hydrogen phosphate, 0.75g / L potassium dihydrogen phosphate, 50ml / L trace elements (2000mg / LEDTA-2Na, 600mg / L ferrous sulfate heptahydrate, 200mg / L zinc sulfate, 150mg / L manganese sulfate, 30mg / L boric acid, 20mg / L cobalt chloride hexahydrate, 40mg / L cupric chloride dihydrate, 40mg / L nickel chloride hexahydrate, 5mg / L sodium molybdate dihydrate).

[0050] After inoculation, the culture was statically cultured in a fermentation room at 28°C. On the fourth and seventh days of fermentation, 3 mL and 5 mL of glucose solution (400 g / L) were added respectively. On the tenth day of fermentation, samples (engineered bacteria v1, v2, v3, v10, v11, v12) were taken for treatment and the H-PPA production was detected by HPLC.

[0051] HPLC detection method:

[0052] (1) Preparation of mobile phase: Prepare a phosphoric acid solution with a pH of 2.0 using ultrapure water and mix it with chromatography-grade acetonitrile at a ratio of 6:4 (V:V). Filter the prepared mobile phase with a 0.22 μm organic filter membrane and degas by ultrasonication before use.

[0053] (2) HPLC conditions: the chromatographic column was an Elite C18 column Hypersil ODS 25 μm (4.6 mm × 250 mm); the mobile phase was a phosphoric acid aqueous solution (pH = 2): acetonitrile = 6:4 (V:V); the flow rate was 1 mL / min; the detector was DAD; the detection wavelength was 220 nm; the injection volume was 5 μL; and the column temperature was 30 °C.

[0054] After static biofilm fermentation, the H-PPA production of individual engineered strains, such as v2, v10, and v11, reached 25 g / L or above on the tenth day, which was slightly higher than that of the starting strain wt (23 g / L), providing a new idea for exploring potential genes and preparing competent cells through overexpression.

[0055] The embodiments described above are merely descriptions of preferred implementations of the present invention and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope of the present invention.

Claims

1. A method for preparing Beauveria bassiana protoplasts using lysogenycin, characterized in that: include: Obtain Beauveria bassiana hyphae and rinse with NaCl solution; The washed Beauveria bassiana mycelium was mixed with the enzymatic hydrolysate at a ratio of 1 g: 50 mL, and the mixture was subjected to enzymatic hydrolysis by shaking; After the enzymatic hydrolysis is completed, the enzymatic hydrolyzate is post-treated to obtain the protoplasts of Beauveria bassiana; The concentration of the disintegrating enzyme in each gram of enzymatic hydrolysate is 5 to 20 g / L.

2. The method according to claim 1, characterized in that The Beauveria bassiana include Beauveria bassiana, Beauveria microspora and Beauveria brucei.

3. The method according to claim 1, characterized in that The method for obtaining Beauveria bassiana mycelium comprises: Beauveria bassiana is cultured at 120-180 r / min and 25-35°C for 3-5 days to obtain a bacterial solution containing Beauveria bassiana hyphae; After filtering the bacterial solution, the solution was rinsed with a 0.7-1 M NaCl solution to obtain Beauveria bassiana hyphae.

4. The method according to claim 1, characterized in that The temperature of the shaking enzymolysis is 25-35°C.

5. The method according to claim 1, characterized in that The rotation speed of the shaking enzymolysis is 120-180 r / min.

6. The method according to claim 1, characterized in that The temperature of the shaking enzymolysis is 1 to 3 hours.

7. The method according to claim 1, characterized in that The method for post-treating the enzymatic solution comprises: The enzymatic hydrolysate was washed and filtered with an STC solution, and the precipitate was resuspended in an STC solution after centrifugation to obtain the protoplasts of Beauveria bassiana.

8. The Beauveria bassiana protoplasts prepared by the method according to any one of claims 1 to 7.

9. The use of collapsing enzyme in the preparation of Beauveria bassiana protoplasts, characterized in that: The applications include: Obtain Beauveria bassiana hyphae and rinse with NaCl solution; The washed Beauveria bassiana mycelium was mixed with the enzymatic hydrolysate at a ratio of 1 g: 50 mL, and the mixture was subjected to enzymatic hydrolysis by shaking; After the enzymatic hydrolysis is completed, the enzymatic hydrolyzate is post-treated to obtain the protoplasts of Beauveria bassiana; The concentration of the disintegrating enzyme in the enzymatic hydrolysis solution is 5 to 20 g / L.

10. A method for constructing a genetically engineered strain of Beauveria bassiana that produces D-HPPA, characterized in that: include: Constructing an expression plasmid containing a VHB gene, wherein the VHB gene is regulated by a promoter GPDA; The expression plasmid containing the VHB gene was introduced into the protoplasts of Beauveria bassiana ZJB23323 to construct a genetically engineered strain of Beauveria bassiana; Wherein, the protoplasts of Beauveria bassiana ZJB23323 are prepared by the method described in any one of claims 1 to 7.

Images