Chilo suppressalis gene csfer1, coding product thereof and application in preventing and treating chilo suppressalis

Abstract

This invention discloses a rice stem borer gene. CsFer1 This gene, along with its encoded product and its application in controlling the rice stem borer, CsFer1 A DNA sequence with SEQ ID No. 1 was obtained. This gene sequence is a complete coding frame of 699 nucleotides, encoding a small molecular weight protein containing 232 amino acid residues. Studies have found that this gene is related to the growth and development of the rice stem borer. (Construction) CsFer1 The RNAi vector was transferred into rice and expressed in transgenic rice. CsFer1 The dsRNA of the gene can enhance the resistance of rice to the rice stem borer. This invention will be widely used in crop breeding, especially in insect-resistant rice breeding.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a rice stem borer gene CsFer1 and its encoded product, and its application in the control of rice stem borers. Background Technology

[0002] Rice (Oryza sativa L.) is one of the most important food crops in China and even globally. Every year, rice yields are severely affected by pests, resulting in huge losses, and in years of severe infestation, there is even no harvest at all. Therefore, how to increase food production by reducing pests is an urgent problem that humanity must face today.

[0003] The rice stem borer (Chilodon grandiflorus) is widely distributed globally, affecting multiple countries across Eurasia. In my country, its damage extends from north (e.g., Heilongjiang Province) to south (e.g., Hainan Island). Depending on climatic conditions, the number of generations of the rice stem borer increases from north to south, reaching more than three generations. The rice stem borer has a wide host range and is difficult to control. Due to factors such as the renewal of rice varieties, changes in rice cultivation methods, and the emergence of pesticide resistance, the severity of its damage in my country continues to rise. Control of the rice stem borer has traditionally relied primarily on chemical pesticides. However, because the occurrence and damage of the rice stem borer are highly irregular, it is difficult to determine the optimal time for effective control, leading to significant resistance to many pesticides. In an integrated pest management system for the rice stem borer, planting insect-resistant rice varieties is one of the most economical and effective methods for controlling the pest, ultimately achieving sustainable control.

[0004] RNA interference (RNAi) refers to the phenomenon where exogenous or endogenous dsRNA (double-stranded RNA, dsRNA) specifically silences the expression of target genes. Numerous reports have documented the use of RNAi technology for functional studies of insect genes. In recent years, domestic and international researchers have attempted to use transgenic plants to express related gene dsRNAs to silence corresponding target genes in feeding insects, thereby affecting their survival, development, and reproduction, with the ultimate goal of controlling pests. Recently, this technology has begun to be implemented in the field with promising results. Specifically, expressing dsRNAs of genes related to piercing-sucking pests such as the brown planthopper (hexosetransporter gene, NlHT1; carboxypeptidase gene, Nlcar; and trypsin-like serine protease, Nltry) in transgenic rice can reduce the transcription level of target genes to some extent, but the lethal effect on the brown planthopper is not significant.

[0005] To date, no target gene related to the rice stem borer has been cloned domestically or internationally that can be used to apply this technology. The rice stem borer can be controlled by silencing this gene through transgenic rice. Summary of the Invention

[0006] Purpose of the invention: The technical problem to be solved by the present invention is to provide a gene CsFer1 of the rice stem borer, its fragment or its expression product.

[0007] Another technical problem that this invention aims to solve is to provide the protein encoded by the rice stem borer gene CsFer1.

[0008] Another technical problem that this invention aims to solve is to provide expression cassettes, recombinant vectors, or cells.

[0009] The technical problem to be solved by this invention is to provide the application of the rice stem borer gene CsFer1, its fragment or expression product, the protein, the expression cassette, recombinant vector, recombinant strain, and recombinant cell in the control of rice stem borer or in plants that have obtained insect-resistant functions.

[0010] Another technical problem that this invention aims to solve is to provide a method for obtaining plants with insect-resistant functions.

[0011] Another technical problem that this invention aims to solve is to provide a method for identifying and obtaining plants with insect-resistant functions.

[0012] Technical solution: To solve the above-mentioned technical problems, the present invention provides the rice stem borer gene CsFer1, its fragment or its expression product, wherein the nucleotide sequence of the CsFer1 gene, its fragment or its expression product is selected from (a) or (b):

[0013] (a) The nucleotide sequence is shown in SEQ ID NO.1 or SEQ ID NO.13;

[0014] (b) It has 80% to 90% homology with the nucleotide sequence shown in SEQ ID NO.1 or SEQ ID NO.13.

[0015] The present invention also includes the protein encoded by the rice stem borer gene CsFer1, wherein the protein is selected from (1) or (2):

[0016] (1) A protein with an amino acid sequence as shown in SEQ ID NO.2;

[0017] (2) A protein derived from SEQ ID NO.2 by substituting, deleting or adding one or more amino acid residues of the amino acid residue sequence of SEQ ID NO.2 and having the same activity as the amino acid residue sequence of SEQ ID NO.2.

[0018] The present invention also includes expression cassettes, recombinant vectors, recombinant strains, recombinant cells or their expression products, which contain the rice stem borer gene CsFer1 or a fragment thereof.

[0019] The recombinant vector includes a silencing vector, an interfering vector, or a knockdown vector. Preferably, the interfering vector includes pCAMBIA1301-RNAi-CsFer1.

[0020] The present invention also includes the rice stem borer gene CsFer1, its fragment or expression product, the protein or expression cassette, recombinant vector, recombinant strain or cell, and the application of the recombinant vector in the control of rice stem borer or the cultivation of insect-resistant plants.

[0021] The method for controlling the rice stem borer includes feeding the rice stem borer with the rice stem borer gene CsFer1, its fragment, or its expression product.

[0022] Preferably, the expression product includes a dsRNA fragment expressing the CsFer1 gene.

[0023] The present invention also includes a method for cultivating plants with insect-resistant functions, the method comprising introducing into a plant a substance containing the rice stem borer gene CsFer1, a fragment thereof or its expression product, the expression cassette, a recombinant vector, a recombinant strain or recombinant cell, and the recombinant vector; preferably, the method causes the plant to express a dsRNA fragment of the CsFer1 gene.

[0024] The plants mentioned include, but are not limited to, rice, and may also be other green plants.

[0025] The method includes steps such as genetic modification, hybridization, backcrossing, or asexual reproduction.

[0026] A method for identifying plants with insect-resistant functions, wherein the plant is a plant containing the gene or a plant obtained by the method, comprising the following steps: identifying whether the plant obtained by the method contains the rice stem borer gene CsFer1 or a fragment thereof or its expression product; preferably, identifying whether the plant expresses a dsRNA fragment of the CsFer1 gene.

[0027] This invention obtained the full-length CsFer1 gene through transcriptome sequencing analysis of the salivary glands of the rice stem borer; then, using the CsFer1 gene fragment as a template, the corresponding dsRNA was synthesized, and the gene expression level of CsFer1 in the rice stem borer, as well as the corresponding body weight and borer-burrowing ability, were analyzed by feeding the target fragment dsRNA. The rice stem borer gene CsFer1 was transformed into rice using transgenic technology, so that the transgenic rice expressed the dsRNA fragment of the CsFer1 gene.

[0028] Beneficial Effects: Compared with existing technologies, this invention has the following advantages: This invention obtains a novel rice stem borer gene, CsFer1, whose gene sequence consists of a complete coding frame of 599 nucleotide bases, encoding a small molecular weight protein containing 232 amino acid residues. Experimental studies have shown that this gene is related to the growth and development of the rice stem borer. Furthermore, an RNAi vector for CsFer1 was constructed and transformed into rice. Expression of the dsRNA of the CsFer1 gene in transgenic rice can enhance the rice's resistance to the rice stem borer. This invention will have wide applications in crop breeding, especially in rice insect-resistant breeding. This invention utilizes this transgenic technology to demonstrate that transgenic rice infused with the CsFer1 gene has excellent insect resistance to the rice stem borer. The isolation and cloning of this gene will play a significant role in promoting insect-resistant crop breeding, especially rice stem borer resistance breeding. Attached Figure Description

[0029] Figure 1 This is an electrophoresis image of the full-length CsFer1 gene of the rice stem borer. In the image, lane 1 is the PCR electrophoresis result of the rice stem borer, and M is the marker.

[0030] Figure 2 This is a bar chart showing the inhibitory effect of feeding CsFer1 dsRNA on the expression level of rice stem borers. In the figure, dsCsFer1 refers to rice stem borers fed with CsFer1 dsRNA bacterial culture (OD600=0.8); dsGFP refers to rice stem borers fed with GFP dsRNA bacterial culture (OD600=0.8); asterisks indicate that there is a highly significant difference in CsFer1 gene expression level between the dsCsFer1 group and the dsGFP group (**, P< 0.01, Student's t-tests). The bars represent the mean plus standard error (n=10).

[0031] Figure 3This is a graph showing the effect of feeding CsFer1 dsRNA on the body weight of rice stem borers. The dsRNA group refers to rice stem borers fed with CsFer1 dsRNA bacterial solution (OD600=0.8); dsGFP refers to rice stem borers fed with GFP dsRNA bacterial solution (OD600=0.8). An asterisk indicates a highly significant difference in body weight between the dsCsFer1 group and the dsGFP group (**, P < 0.01, Student's t-tests). The bar chart represents the mean plus standard error (n=5).

[0032] Figure 4 This is a bar chart showing the effect of feeding CsFer1 dsRNA on the time of rice borer penetration. In the figure, dsGFP refers to rice borers fed with CsFer1 dsRNA bacterial solution (OD600=0.8); dsGFP refers to rice borers fed with GFP dsRNA bacterial solution (OD600=0.8); asterisks indicate that there is a significant difference in the time of rice borer penetration between the dsCsFer1 group and the dsGFP group (*, P<0.05, Student's t-tests). The bars represent the mean plus standard error (n=10).

[0033] Figure 5 This is a schematic diagram of the plasmid structure of a rice genetic transformation vector containing the CsFer1 gene.

[0034] Figure 6 This is a bar chart showing the inhibitory effect of transgenic rice expressing CsFer1 dsRNA on the CsFer1 gene expression level in rice stem borers. In the chart, irCsFer1-3: CsFer1 gene expression level in rice stem borers fed with transgenic rice line irCsFer1-3 expressing CsFer1 dsRNA; irCsFer1-7: CsFer1 gene expression level in rice stem borers fed with transgenic rice line irCsFer1-7 expressing CsFer1 dsRNA; WT: CsFer1 gene expression level in rice stem borers fed with non-transgenic rice. The letters in the chart indicate a significant difference in CsFer1 gene expression levels between rice stem borers fed with transgenic lines (irCsFer1-3 or irCsFer1-7) and WT rice (*, P < 0.05, one-way ANOVA followed by Duncan's multiple range). test), the bar chart is the mean plus standard error (n=10);

[0035] Figure 7This is a graph showing the effect of feeding on transgenic rice expressing CsFer1 dsRNA on the pupation rate of the rice stem borer. In the graph, irCsFer1-3: pupation rate of the rice stem borer fed on transgenic rice line irCsFer1-3 expressing CsFer1 dsRNA; irCsFer1-7: pupation rate of the rice stem borer fed on transgenic rice line irCsFer1-7 expressing CsFer1 dsRNA; WT: pupation rate of the rice stem borer fed on non-transgenic rice. The letters in the graph indicate that there is a significant difference in pupation rate between the transgenic lines (irCsFer1-3 or irCsFer1-7) and WT rice (*, P < 0.05, one-way ANOVA followed by Duncan's multiple range test). The bars represent the mean plus standard error (n=10).

[0036] Figure 8 This is a graph showing the effect of feeding on transgenic rice expressing CsFer1 dsRNA on the body weight of rice stem borers. In the graph, irCsFer1-3: the body weight of rice stem borers fed on transgenic rice line irCsFer1-3 expressing CsFer1 dsRNA for seven days; irCsFer1-7: the body weight of rice stem borers fed on transgenic rice line irCsFer1-7 expressing CsFer1 dsRNA for seven days; WT: the body weight of rice stem borers fed on non-transgenic rice for seven days. The letters in the graph indicate that there is a significant difference in the body weight of rice stem borers fed on transgenic lines (irCsFer1-3 or irCsFer1-7) and WT rice for seven days (*, P < 0.05, one-way ANOVA followed by Duncan's multiple range test). The bars represent the mean plus standard error (n=10). Detailed Implementation

[0037] The embodiments of the present invention will be described in detail below with reference to examples. However, those skilled in the art will understand that the following examples are for illustrative purposes only and should not be considered as limiting the scope of the invention. Unless otherwise specified in the examples, conventional conditions or conditions recommended by the manufacturer are followed. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.

[0038] This invention utilizes a high-throughput sequencing method to obtain transcriptome data from a *Taxodium difficile* salivary gland transcriptome library, initially yielding the full-length CsFer1 CDS sequence. First, a pair of primers, CsFer1-CDS-F and CsFer1-CDS-R, were designed at the 5' and 3' untranslated regions of the CDS sequence. Then, *Taxodium difficile* RNA was extracted and reverse transcribed into cDNA. Using this cDNA as a template, conventional PCR was performed using CsFer1-CDS-F and CsFer1-CDS-R primers to obtain the full-length CsFer1 CDS sequence, which was ligated into the pMD19-T cloning vector, transformed into *E. coli* competent cells (TG1), cultured, and sequenced (Nanjing Genscript Biotech). The sequencing results were compared and validated with the obtained full-length CsFer1 CDS sequence from the transcriptome. Subsequently, a 367bp fragment was selected from the CsFer1 CDS sequence to design and synthesize dsRNA. RNAi was then performed on the target gene using a feeding method to detect its inhibitory effect on the target gene expression level and its influence on the body weight and boring ability of the rice stem borer. A transgenic rice mutant expressing the CsFer1 gene dsRNA was obtained using transgenic technology. Bioassays demonstrated that this transgenic rice exhibited excellent insect resistance. The isolation, cloning, and biological function analysis of this gene will play a significant role in promoting insect-resistant crop breeding, especially in rice breeding for resistance to the rice stem borer. In this embodiment of the invention, PCR amplification and T4 ligase were performed using kits purchased from Takara, and homologous recombination was performed using kits purchased from Vazyme.

[0039] Example 1: Obtaining and sequence analysis of the CsFer1 gene

[0040] A gene expression database was obtained by sequencing the salivary gland transcriptome of the rice stem borer, and the CsFer1 gene was screened, yielding the preliminary full-length CsFer1 CDS sequence (SEQ ID NO.1). Salivary gland mRNA was extracted from the rice stem borer (Nanjing region) and reverse transcribed into cDNA. Using this cDNA as a template, primers CsFer1-CDS-F and CsFer1-CDS-R were designed based on the 5' and 3' untranslated regions of the CsFer1 gene. PCR amplification of the CDS sequence was performed. Figure 1 The full-length sequence was ligated into the pMD19-T cloning vector, transformed into E. coli competent cells (TG1), and four clones were selected and sent to Nanjing GenScript Biotech for sequencing. The CsFer1 gene DNA sequence was obtained, as shown in SEQ ID No. 1 of the sequence listing. Based on the open reading frame (ORF) of this sequence, the amino acid sequence of the protein encoded by this gene was deduced, as shown in SEQ ID No. 2.

[0041] SEQ ID NO.1:

[0042] atgaaggtgt tattgagtac agtgatgtgc ctcctggccg ctacaggcgc gttggctgca

[0043] gacgcgtgtt accaagatgt gtctctggac tgtggacagg catccaccag cttggctttg

[0044] ccccgttgta atgccgtgta cggggagtat ggaagacacg gaaacgtcgc cacagagttg

[0045] caagcatacg cgaacctaca cttggaaagg tcgtacgaat atttgctgtc tgctgcgtac

[0046] ttcaataact atcagaccaa cagagctggg ttcagtaagc tgttcaagaa gctttcggat

[0047] caggcttggg agaagaccat cgacctcatc aagcatgtga ctatgagggg tgatgaaatg

[0048] aacttcagcc agcgtagcac ccagaaaccg ctggagcgca agaactatac ggtggaactt

[0049] catgaattgg agtctttggc caaagctttg gacacgcaga aggagctcgc ggaacgcgcc

[0050] ttctacatcc accgtgaagc caccaggaat agccctcatc ttcatgatcc tgagatcgcc

[0051] caatatctgg aggaagagtt cgttgaggac caatcgaaga caattcgcga aatagctggc

[0052] cacaccagcg acctcaagaa attcatcaca gctaataacg ggcaagacct ttcattggc

[0053] actcttctta ttcgacgagt acctccaaaa aaccgtttaa

[0054] SEQ ID No. 2:

[0055] MKVLLSTVMC LLAATGALAA DACYQDVSLD CGQASTSLAL

[0056] PRCNAVYGEY GRHGNVATEL QAYANLHLER SYEYLLSAAY

[0057] FNNYQTNRAG FSKLFKKLSD QAWEKTIDLI KHVTMRGDEM

[0058] NFSQRSTQKP LERKNYTVEL HELESLAKAL DTQKELAERA

[0059] FYIHREATRN SPHLHDPEIA QYLEEEFVED QSKTIREIAG

[0060] HTSDLKKFIT ANNGQDLSLA LFLFDEYLQK TV*

[0061] The specific steps are as follows:

[0062] 1) Extraction, quality control, and first-strand synthesis of total cDNA from the salivary glands of the rice stem borer;

[0063] 2) The CsFer1 CDS fragment was synthesized from the first strand of total cDNA by PCR;

[0064] Upstream primer (SEQ ID No. 3): 5'-ATGAAGGTGTTATTGAGTACAGTGA-3'

[0065] Downstream primer (SEQ ID No. 4): 5'-TTAAACGGTTTTTTGGAGGTACTCG-3'

[0066] PCR amplification system (Takara): 10 μL buffer, 1 μL 10 μM upstream primer, 1 μL 10 μM downstream primer, 1 μL template cDNA, 0.2 μL 5 U / μL Taq enzyme, 6.8 μL double-distilled water.

[0067] PCR amplification conditions: 98℃×3min→(98℃×30sec→55℃×30sec→72℃×30sec)×35 cycles→72℃×10min, to obtain specific PCR amplification products (see figure). Figure 1 .

[0068] 3) Construction of pMD19-CsFer1 cloning vector and analysis of gene bases

[0069] The specific PCR amplification product was cloned into the Takara pMD19-T vector to obtain the pMD19-CsFer1 vector, which was then transformed into TG1 E. coli via heat shock. The TG1 bacterial culture containing the pMD19-CsFer1 vector was sent to Nanjing GenScript Biotech for sequencing. Sequence alignment analysis was performed using NCBI BLAST (http: / / www.ncbi.nlm.nih.gov / BLAST / ), yielding the sequence SEQ ID No. 1 in the sequence listing. The gene of this cDNA was named CsFer1. Based on the open reading frame (ORF) of this sequence, the amino acid sequence of the protein encoded by this gene was deduced, as shown in SEQ ID No. 2.

[0070] Example 2: Synthesis of CsFer1 dsRNA in the rice stem borer and its RNAi effect

[0071] Target fragments were designed using siDirect (http: / / sidirec2.rnai.jp / ), and specific primers dsCsFer1-T7-F, dsCsFer1-T7-R, dsGFP-T7-F, and dsGFP-T7-R were designed based on the restriction sites on the pET-2p plasmid (gifted by the Xinjiang Academy of Agricultural Sciences, article source: Evaluation of the effectiveness of dsRNA extraction methods for four prokaryotic double-stranded RNAs, DOI: 10.6048 / j.issn.1001-4330.2021.04.013). Vectors expressing CsFer1 dsRNA and GFP dsRNA were constructed and then transformed into HT115 competent cells to obtain bacterial solutions containing dsCsFer1 and dsGFP. Third-instar rice stem borer larvae were placed in feed soaked in dsCsFer1 or dsGFP bacterial solutions for long-term rearing. First, we examined the effect of feeding rice stem borers with dsRNA on the expression level of the CsFer1 gene in their bodies.

[0072] The specific steps are as follows:

[0073] 1) Using the pMD19-CsFer1 and GFP plasmid (gifted by Zhejiang University) cloning vector constructed in Example 1 as templates, the 367 bp CsFer1 gene fragment and the 357 bp GFP gene fragment with the same CsFer1 dsRNA sequence were amplified by PCR using primers (dsCsFer1-T7-F and dsCsFer1-T7-R) with designed restriction sites.

[0074] CsFer1 fragment: (SEQ ID NO.13) CTGCGTACTTCAATAACTATCAGACCAACAGAGCTGGGTTCAGTAAGCTGTTCAAGAAGCTTTCGGATCAGGCTTGGGAAGACCATCGACCTCATCAAGCATGTGACTATGAGGGGTGATGAAATGAACTTCAGCCAGCGTAGCACCCAGAAACCGCTGGAGCGCAAGAACTATACGG TGGAACTTCATGAATTGGAGTCTTTGGCCAAAGCTTTGGACACGCAGAAGGAGCTCCGGAACGCGCCTTCTACATCCACCGTGAAGCCACCAGGAATAGCCCTCATCTTCATGATCCTGAGATCGCCCAATATCTGGAGGAAGAGTTCGTTGAGGACCAATCGAAGACAATTCGCGAAATAGCTGG

[0075] Gfp fragment (SEQ ID NO.14)

[0076] CAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTC AAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGA

[0077] PCR amplification primers:

[0078] dsCsFer1-T7-F (SEQ ID No.5):

[0079] 5'- CTCCCGGCCGCCATGGCGGCCGCCTGCGTACTTCAATAACTATCAGACCA -3'

[0080] dsCsFer1-T7-R (SEQ ID No. 6):

[0081] 5'-GTACCAATCGAATTCACTAGTCCAGCTATTTCGCGAATTGTC -3'

[0082] dsGFP-T7-F (SEQ ID No.7):

[0083] 5'-CTCCCGGCCGCCATGGCGGCCGCCAGCCGCTACCCGACCACATGA -3'

[0084] dsGFP-T7-R (SEQ ID No.8):

[0085] 5'-GTACCAATCGAATTCACTAGTTCGCCGATGGGGGTGTTTCTGCTGG -3'

[0086] The PCR amplification system (kit purchased from Takara) was the same as in Example 1.

[0087] PCR amplification conditions: CsFer1: 98℃×3min→(98℃×30sec→65℃×30sec→72℃×30sec)×35 cycles→72℃×10min

[0088] GFP: 98℃×3min→(98℃×30sec→65℃×30sec→72℃×40sec)×35 cycles→72℃×10min.

[0089] 2) The PCR products were excised and recovered. Using the recovered products as templates, the CsFer1 / GFP gene fragment was inserted into the pET-2p vector using homologous recombination (a kit purchased from Vazyme). This yielded the RNAi expression vector pET-2p-CsFer1 and the expression vector pET-2p-GFP containing the CsFer1 / GFP gene fragment.

[0090] 3) Expression vectors pET-2p-CsFer1 and pET-2p-GFP were transformed into HT115 competent cells by heat shock, and single colonies were screened on double-antibody plates (kanamycin 50 μg / mL, tetracycline 10 μg / mL). The dsCsFer1 and dsGFP bacterial cultures with correct sequences were mixed with LB double-antibody medium (kanamycin 50 μg / mL, tetracycline 10 μg / mL) at a volume ratio of 1:1000 and cultured at 37 ℃ and 200 rpm in an incubator until OD600=0.8 for use.

[0091] 4) Expand the bacterial culture to 250 mL, centrifuge at 5000 g for 10 min, discard the supernatant, and completely suspend the bacterial pellet with 0.01 volume of PBS buffer to prepare dsRNA feeding culture. Cut the artificial feed for rice stem borer into 10 mm x 10 mm x 5 mm pieces, immerse the feed pieces in the bacterial culture for 10 min, remove and air dry the surface liquid for later use.

[0092] 5) First-day larvae of the third instar of the rice stem borer were selected and reared individually in 24-well plates. They were fed diets soaked in dsCsFer1 and dsGFP bacterial solutions, respectively. The diets were freshly prepared and replaced daily. On days 2 and 5 after feeding, 10 samples were randomly collected from each treatment, and total RNA was extracted and reverse transcribed into the first strand of cDNA. Using the quantitative primers below, the effect of feeding CsFer1 dsRNA on the CsFer1 gene expression level in the rice stem borer was detected. Figure 2 ).

[0093] CsFer1 quantitative primers:

[0094] CsFer1-F (SEQ ID No.9): 5'- GCCACAGAGTTGCAAGCATA-3'

[0095] CsFer1-R (SEQ ID No.10): 5'-ACCGCTGGCTGAAGTTCATTT-3'

[0096] Internal reference elongation factor quantitative primers:

[0097] elongation factor -F (SEQ ID No.11): 5'- AAAATGGACTCGACTGAACCCC -3'

[0098] elongation factor -R (SEQ ID No.12): 5'-TCCTCCGTGCCAACCAGAAATA-3'

[0099] 6) Feed the same batch of identical-developing 3rd instar larvae of the rice stem borer with dsRNA according to the feeding method described above. Two treatments were set up in each experimental group: dsCsFer1 larvae soaked in CsFer1 dsRNA (OD600=0.8) bacterial solution or dsGFP larvae soaked in GFP dsRNA (OD600=0.8) bacterial solution were fed to the control group. Fresh bacterial solutions were prepared daily and the feed was changed accordingly. After 7 days of feeding, the larvae were randomly selected from each treatment group and their weight was recorded. Each treatment was replicated 5 times, and 10 larvae were selected for each replicate.

[0100] 7) Feed dsRNA to third-instar larvae of the same batch with consistent development according to the feeding method described above. Two treatments were set up in each group of experiments: dsCsFer1 (OD600=0.8) bacterial suspension or dsGFP (OD600=0.8) bacterial suspension as a control. After 2 days of feeding, the larvae were starved for 8 hours before being placed on healthy rice plants in the tillering stage for observation of their boring behavior, and the boring time was recorded. Each treatment was repeated 10 times, with 3 larvae per replicate.

[0101] The results showed that feeding dsRNA could indeed induce silencing of target genes in rice stem borers, resulting in sustained suppression of target gene expression. Figure 2 We also measured the weight changes and borer ability of rice stem borers fed with CsFer1 dsRNA for 7 days. The results showed that compared with feeding with GFP dsRNA, the weight gain and borer ability of rice stem borers after CsFer1 gene silencing were significantly reduced. Figure 3 and 4 ).

[0102] Example 3: Obtaining transgenic rice lines expressing CsFer1 dsRNA and detecting their resistance to rice stem borer.

[0103] Study on insect resistance function of transgenic CsFer1 dsRNA in rice: A rice genetic transformation vector containing the CsFer1 gene was constructed. The constructed expression vector was transformed into Agrobacterium using electroporation to obtain engineered Agrobacterium containing the expression vector. Rice callus was infected using our laboratory's mature Agrobacterium transgenic method. After resistance selection, callus tissue integrating the target gene was obtained. This tissue was then cultured in differentiation and rooting media to obtain transgenic rice expressing the CsFer1 gene dsRNA. Observation of the rice plants revealed no physiological defects, and normal generations were obtained. 1. Using the pMD19-CsFer1 cloning vector constructed in Example 1 as a template, PCR amplification was performed using a forward primer pair with restriction sites Cla I and KpnI (NEB, catalog numbers: R0141S and R3133S) and a reverse primer pair with restriction sites SmaI and SpeI (NEB, catalog numbers: R0141S and R3133S). The PCR amplification products of the forward and reverse fragments of the CsFer1 gene, which are identical to the CsFer1 dsRNA sequence amplified in Example 2, were obtained.

[0104] PCR forward and reverse primer pairs:

[0105] Forward fragment primer F: TCGTCGACGCTGCGTACTTCAATAACTATCAGACCA

[0106] Forward fragment primer R: ATGGTACCCCAGCTATTTCGCGAATTGTC

[0107] Reverse fragment primer F: ATCCCGGGGCTGCGTACTTCAATAACTATCAGACCA

[0108] Reverse fragment primer R: GCTCTAGACCAGCTATTTCGCGAATTGTC

[0109] The PCR amplification system and amplification conditions are the same as those in step 1) of Example 2.

[0110] 2. The PCR products of the above-mentioned forward and reverse fragments were extracted by gel extraction to obtain the recovered CsFer1 gene forward and reverse fragments. Using T4 ligase (following the instructions for the T4 DNA Ligase kit from Takara, catalog number: D2011A), the forward fragment of the CsFer1 gene was first inserted into the pCAMBIA1301-RNAi vector (Silencing OsSLR1 enhances the resistance of rice to the brown planthopper Nilaparvata lugens, a gift from Zhejiang University) after double digestion with Cla I and KpnI. The vector was then transformed into DH5α E. coli via heat shock, and the plasmid was extracted (Vazyme). The plasmid containing the forward CsFer1 fragment was then double-digested with SmaI and SpeI. The reverse fragment of the CsFer1 gene was then ligated to the digested plasmid containing the forward fragment using T4 ligase, ultimately obtaining the RNAi expression vector pCAMBIA1301-RNAi-CsFer1 containing both forward and reverse CsFer1 gene fragments. Figure 5 ).

[0111] 3. pCAMBIA1301-RNAi-CsFer1 was transfected into Agrobacterium EHA105 via electroporation to obtain an Agrobacterium engineered cell line. Rice callus tissue was then infected using the Agrobacterium transfection method. The rice callus was co-infected in NBDS1 medium containing hygromycin.

[0112] Cultured on [NBD (NB (agar broth medium) + 2 mg / L 2,4-D + 500 mg / L GLu + 500 mg / L Pro + 300 mg / L Casein + 30 g / L Sucrose + 3 g / L Phytagel) + 3 g / L Phytagel + Cef 200 mg / L + Hyg 30 mg / L, pH=5.8] for 20 days for the first selection. Once new resistant calluses have grown, they are detached from the parent culture and transferred to a new selection medium, NBDS2 (NBD + 3 g / L Phytagel + Cef 150 mg / L + Hyg 50 mg / L, pH=5.8). Each resistant callus constitutes a strain. After subculturing, resistant callus was cultured on predifferentiation medium MS-PG (MS + 2 mg / L BA + 5 mg / L ABA + 1 mg / L NAA + 30 g / L Sucrose + 10-20 g / L Sorbitol + 3 g / L Phytogel, pH 5.8) at 26-28℃ in the dark for 7-10 days. Then, it was transferred to differentiation medium MS-RG (MS + 2-3 mg / L BA + 0.1-0.5 mg / L NAA + 3 g / L Phytogel, pH 5.8) and cultured for 2-3 weeks under 16-hour light at 26-28℃. The callus first turned green and then differentiated into T0 generation plants.

[0113] 4. T1 generation seeds obtained from T0 generation transgenic plants were used to remove plants that did not contain CsFer1, and each plant was planted individually. T2 generation seeds were harvested, and the seeds from each individual plant were identified. Homozygous lines irCsFer1-3 and irCsFer1-7, which are transgenic with the CsFer1 gene, were obtained for subsequent biological functional analysis.

[0114] 5. Transgenic lines irCsFer1-3 and irCsFer1-7 and non-transgenic rice were subjected to rice stem borer infestation experiments. The expression level of the CsFer1 gene, pupation rate, and weight changes in the rice stem borers after they fed on the transgenic rice were compared to analyze the important role of CsFer1 in resistance to rice stem borers.

[0115] Bioassays showed that, compared with the control group of non-transgenic rice, the expression level of the CsFer1 gene was significantly reduced after the rice stem borer fed on transgenic rice expressing CsFer1 dsRNA. Figure 6 The pupation rate of the rice stem borer was significantly reduced. Figure 7 Weight gain also decreased significantly. Figure 8 ).

Claims

1. Application of the CsFer1 fragment of the rice stem borer gene in the control of rice stem borer, wherein the nucleotide sequence of the CsFer1 fragment of the rice stem borer gene is shown in SEQ ID NO.

13.

2. The application of recombinant vectors or recombinant strains containing the rice stem borer gene CsFer1 fragment in the control of rice stem borer, wherein the nucleotide sequence of the rice stem borer gene CsFer1 fragment is shown in SEQ ID NO.

13.

3. The application according to claim 2, characterized in that, The recombinant vector is an interference vector.

4. The application according to claim 3, characterized in that, The interference vector is pCAMBIA1301-RNAi-CsFer1.

5. The application according to any one of claims 1 to 4, characterized in that, The method for controlling rice stem borer includes feeding rice stem borers with dsRNA containing the rice stem borer gene CsFer1, and amplifying a gene fragment with the same dsRNA sequence as CsFer1 using primers with restriction enzyme sites. The nucleotide sequence of the gene fragment is shown in SEQ ID NO.13.

Images