Luugt175 gene for regulating flax petal shape and application thereof

Abstract

The application provides a LuUGT175 gene for regulating the petal shape of flax and application, relates to the field of plant biotechnology, and provides a regulating gene for the petal shape of flax, the regulating gene is LuUGT175, and the sequence number of the regulating gene is like SEQ ID NO:01. It is proved by specific examples in the application that the glycosyltransferase LuUGT175 of flax can participate in the regulation of the petal shape of flax, overexpression of the glycosyltransferase LuUGT175 leads to different degrees of petal loss of the overexpression strain of flax, the originally round petals appear irregular deep laceration, and the deep laceration does not reach the base. The petal has been one of the key improvement targets in horticultural research, and the improvement of petal traits can improve the ornamental value of plants, and the application will bring significant economic benefits to horticultural production. The application provides a new glycosyltransferase LuUGT175 overexpression body which can lead to deep laceration of the petal of flax, and further produce multi-petal flowers with extremely high ornamental value.

Description

Technical Field

[0001] This invention relates to the field of plant biotechnology, and in particular to the LuUGT175 gene that regulates the morphology of flax petals and its applications. Background Technology

[0002] Flower development is a crucial stage in plant development, essential for survival and reproduction. During evolution, plants have developed complex floral and inflorescence structures, which influence normal reproduction and human utilization of plants. Therefore, a significant portion of plant research revolves around flower development. Flower development is a key process in completing a plant's life cycle. The transition from vegetative to reproductive growth is a dual response to environmental and genetic factors. To ensure the normal reproduction of offspring, higher plants must flower under optimal environmental conditions. Flower development consists of three stages: flower induction, flower initiation, and floral organ development (Cho et al., 2017). Plants sense flowering signals through changes in the external environment and endogenous hormones, stimulating the shoot apical meristem (SAM) to transform into the inflorescence meristem (IM). Subsequently, under the influence of floral meristem identity genes and floral organ identity genes, the inflorescence meristem forms a complete flower (Yang et al., 2002). F-box proteins are one of the largest protein superfamilies in plants. They possess an N-terminal F-box domain composed of 40–60 amino acid residues, which binds to Skp1, Cullinl(CUL1) / Cdc53, and Rbxl / Rocl / Hrtl to form the Skp1-Cullinl-F-box (SCF) complex, participating in ubiquitination. The C-terminus is the substrate-binding region, containing various domains including Kelch, LRR, and FBD domains. The C-terminus of F-box proteins determines their substrate recognition specificity; depending on the bound substrate, F-box proteins play different roles (Mo et al., 2021). Therefore, the SCF complex formed by F-box proteins participates in various aspects of the plant life cycle, such as seed germination, flower development, self-incompatibility, biotic and abiotic stresses, and photomorphogenesis (Zhang et al., 2019).

[0003] Flax (Linum usitatissimum L.) is an annual herbaceous plant belonging to the genus Linum in the family Linaceae. Its inflorescence is a cymose inflorescence, characterized by slender pedicels and five pale blue petals. Current research on flax mainly focuses on fiber quality and functional nutrients in its seeds, with a significant lack of research on flower development. Flax is one of the few species that naturally produces blue flowers. The blue flowers of flax exhibit a distinct color gradient and are aesthetically pleasing, possessing high ornamental and research value. Flax has a short growth cycle, relatively short stature, high genetic transformation efficiency, and is easy to cultivate in the laboratory, making it an ideal research material. Research on flax petal development can enrich the study of petal development in ornamental horticultural plants. Summary of the Invention

[0004] The purpose of this invention is to explore the regulatory mechanism of the glycosyltransferase gene LuUGT175 in flax flower development, and to provide new insights into the regulation of LuUGT175 gene in plant petal development.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] A regulatory gene for flax petals, the regulatory gene being LuUGT175, the sequence number of which is shown in SEQ ID NO: 01.

[0007] This application also provides a molecule for regulating flax petals, said molecule comprising one of the gene LuUGT175, a protein encoded by LuUGT175, or an overexpression variant of the gene LuUGT175.

[0008] This application also provides the application of the LuUGT175 gene, the protein encoded by the LuUGT175 gene, and the overexpression of the LuUGT175 gene in regulating the morphology of flax petals.

[0009] This application also provides a method for producing flax petals with morphological regulation, comprising the following steps:

[0010] S1: Constructing a LuUGT175 gene overexpression vector;

[0011] S2: Genetic transformation of flax.

[0012] Preferably, the primers in S1 are designed as follows:

[0013] LuUGT175-F cggggtaccATGGACGTAAAATCAAACCATACTGCT LuUGT175-R ccaatgcattggttctgcagTTATAAGGCACTTGATTTCTTCCATAT .

[0014] This application demonstrates through specific embodiments that the flax glycosyltransferase LuUGT175 can participate in regulating flax petal morphology. Overexpression of LuUGT175 leads to varying degrees of petal loss in overexpressing flax lines, resulting in irregularly deep lobes in the originally rounded petals, with the lobes not reaching the base. Petals have always been a key target for improvement in horticultural research. Improving petal traits can enhance the ornamental value of plants. The implementation of this invention will bring significant economic benefits to horticultural production. This invention provides a novel overexpression of the glycosyltransferase LuUGT175 that can induce deep lobes in flax petals, thereby producing highly ornamental multi-petaled flowers. Attached Figure Description

[0015] Figure 1 This is an electrophoresis image of the PCR product of the target fragment in Example 1 of the present invention. Note: 1 represents the PCR product of the target fragment; M represents the Yisheng DL2000 DNA Marker.

[0016] Figure 2 Examples 1-6 of this invention are electrophoresis images of single colonies selected from *E. coli* after transformation of the ligation product. Note: M is the Yisheng DL2000 DNA Marker.

[0017] Figure 3 This is a diagram illustrating the construction of the LuUGT175 overexpression vector in Example 1 of this invention. Note: Lus10005950 is the gene code for LuUGT175.

[0018] Figure 4 This is for PCR verification of the LuUGT175 overexpression line in Example 1 of this invention. Note: Hygromycin gene (HPT) is used as a marker gene, and the product size is 610 bp.

[0019] Figure 5 The whole plant morphology of wild-type (WT), overexpression plants OE-2 and OE-14 in Example 1 of this invention.

[0020] Figure 6 The petal morphology of wild-type (WT), overexpression plants OE-2 and OE-14 in Example 1 of this invention.

[0021] Figure 7 The petal cells of wild-type (WT), overexpressing plants OE-2 and OE-14 in Example 2 of this invention were observed under a microscope (OM×400), a scanning electron microscope (SEM×300), and a transmission electron microscope (TEM×1.0K).

[0022] Figure 8 Microscopic observation (OM×400, OM×1000) of the external morphology of pollen grains from wild-type (WT), overexpressing plants OE-2 and OE-14 in Example 3 of this invention.

[0023] Figure 9 GUS staining analysis of the LuUGT175 promoter in flax buds, petals, and capsules in Example 4 of this invention. Note: A: 1 day after budding; B: 2 days after budding; C: 3 days after budding; D: 4 days after budding; E: 5 days after budding; F: 1 day after flowering; G: 5 days after flowering; H: 10 days after flowering; I: 15 days after flowering; J: 20 days after flowering.

[0024] Figure 10 This shows the expression of LuUGT175 in the flowers of wild-type (WT) and overexpressing plants (OE-14) of flax after budding, as described in Examples 4 and 5 of this invention.

[0025] Figure 11 This is the expression pattern of key genes for flower development in the transgenic line in Example 5 of this invention. Detailed Implementation

[0026] The present invention will be further described in detail below with reference to specific embodiments.

[0027] A regulatory gene for flax petals, the regulatory gene being LuUGT175, the sequence number of the regulatory gene being shown in SEQ ID NO: 01, and the amino acid sequence of the protein encoded by the LuUGT175 gene being shown in SEQ ID NO: 02.

[0028] This application also provides a molecule for regulating flax petals, said molecule comprising one of the gene LuUGT175, a protein encoded by LuUGT175, or an overexpression variant of the gene LuUGT175.

[0029] Application of LuUGT175 gene, LuUGT175 encoded protein and LuUGT175 gene overexpression in regulating flax petal morphology.

[0030] This application also provides a method for producing flax petals with morphological regulation, comprising the following steps:

[0031] S1: Construct a LuUGT175 gene overexpression vector;

[0032] S2: Genetic transformation of flax.

[0033] The above content will be described below with reference to specific embodiments:

[0034] Example 1: Construction of overexpression vector:

[0035] Please see Figure 1 , Figure 2 and Figure 3The LuUGT175 gene is 1455 bp in length, contains one exon, has no introns, and encodes 485 amino acids.

[0036] The target gene fragment was obtained by double digestion of the correctly sequenced intermediate cloning vector pBSK-UGTs, followed by electrophoresis and recovery of the fragment. The target vector fragment was then obtained by double digestion of pCAMBIA1301 with the same enzymes, followed by electrophoresis and recovery of the fragment.

[0037] The vector fragment contains a 35S promoter that drives gene expression. The target gene fragment pCAMBIA1301 was ligated using T4 ligase, and the ligation system was transformed into *E. coli* DH5α competent cells and plated on LB agar. Single colonies were picked, expanded on LB liquid medium, plasmids were extracted, and positive clones were verified by PCR and restriction enzyme digestion. The recombinant eukaryotic expression vector PCAMBIA1301-UGTs was transformed into *Agrobacterium tumefaciens* GV3101, and positive colonies were selected for incubation.

[0038] S1-1: Primer Design

[0039] LuUGT175-F cggggtaccATGGACGTAAAATCAAACCATACTGCT LuUGT175-R ccaatgcattggttctgcagTTATAAGGCACTTGATTTCTTCCATAT

[0040] S1-2: Target fragment amplification:

[0041]

[0042] S1-3: Target Fragment Glue Recovery

[0043] DNA was purified and recovered using a gel extraction kit (Tiangen, DP209) for the target fragment. For specific instructions, please refer to the instruction manual.

[0044] S1-4: Linearization and recovery of the target carrier

[0045] The final vector plasmid pCAMBIA1301S was linearized by digestion with TaKaRa restriction endonucleases (Kpnl+PstI). Recovery was performed in the same manner as the previous step.

[0046] S1-5: Target fragment ligation vector

[0047] The clip uses Hieff Plus One Step Cloning Kit (catalog number: 10911ES20) - For specific cloning methods, please refer to the instruction manual.

[0048]

[0049] S1-6: Microbial identification:

[0050]

[0051] Example 2: Genetic transformation of flax:

[0052] Flax seeds were treated with 75% ethanol for 1 min, then with 0.1% mercuric chloride for 8 min, rinsed 5-6 times with sterile water, and placed in germination medium LU1. They were then cultured at 25°C in the dark for 3-5 days. After germination, they were transferred to an 8-hour light source for further culture. Using sterile flax seedlings aged 5-10 days, hypocotyls were cut into 3-5 mm segments, soaked in Agrobacterium tumefaciens solution (OD value 0.6) for 20 minutes, then the solution was blotted dry and placed on co-culture medium LU2-Co at 25°C in the dark for 2-3 days. After washing with 500 mg / L Carb solution for 30 min, the seedlings were placed on selection medium LU3H5 and cultured under light for 8 hours. Subculture was performed every 2 weeks. When resistant shoots reached approximately 5-7 mm in length, they were transferred to rooting medium LU4H5 for rooting culture, which took approximately 14 days to develop (see Table 1 for medium formulations).

[0053] Table 1. Flax genetic transformation medium formulation

[0054]

[0055] Example 3: Identification of positive plants

[0056] Using the hygromycin gene (HPT) as the target gene,

[0057] Primers (HPT379F: CTTAGCCAGACGAGCGGGTTC; HPT992R: CGGTTTCCACTATCGGCGAGTA) were designed to verify the transformation of positive plants by PCR, and the product size was 610 bp.

[0058] The PCR procedure is as follows:

[0059] PCR kit: Colony 2XT5 SuperPCRMix (Colony) Catalog No. TSE005

[0060]

[0061] PCR program

[0062]

[0063]

[0064] Example 4: Observation of the external morphology of petals using scanning electron microscopy

[0065] The morphology of epidermal cells in mature petals was observed using a scanning electron microscope (SEM). The specific experimental steps are as follows:

[0066] (1) Dehydration: Plant materials fixed in FAA solution were selected in 70% ethanol and then placed in a series of ethanol gradients of 80%, 95%, 100% and 100% concentrations for dehydration, each gradient for 20 min;

[0067] (2) Displacement: The material was placed in anhydrous ethanol:isoamyl acetate series mixed solutions ([V]:[V]=2:1, 1:1, 1:2), pure isoamyl acetate (I), and pure isoamyl acetate (II) for 20 min per gradient;

[0068] (3) Drying: The material was dried using a K850 critical point dryer with CO2.

[0069] (4) Attaching the sample to the stage: Use double-sided conductive adhesive to attach the material to the sample stage of appropriate size;

[0070] (5) Sputtering gold: Using an ion sputtering apparatus to sputter gold coating onto the material;

[0071] (6) Observation and photography: Observation and photography were carried out using a JSM-6390LV scanning electron microscope (JEOL Corporation, Japan).

[0072] Example 5: 7. Observation of the internal structure of petals using transmission electron microscopy

[0073] The ultrastructure of mature petal tissue was observed using transmission electron microscopy (TEM). The experimental steps are as follows:

[0074] (1) Cleaning: Take out the material observation part from the 2% GA 2% PA (glutaraldehyde-paraformaldehyde) solution and clean it 3 times with 20Mm / L phosphate buffer, 15min each time;

[0075] (2) Fixation: Place the material in a 1% osmium tetroxide solution and place the whole material in an ice box for 3-4 hours;

[0076] (3) Dehydration: The material was washed three times with phosphate buffer for 15 min each time, and then treated with a series of ethanol solutions with concentration gradients of 10%, 30%, 50%, 70%, 80%, 95%, 100%, and 100% for 1 h per gradient.

[0077] (4) Displacement: The material was subjected to a series of solutions of anhydrous ethanol: propylene oxide ([V]:[V] = 2:1, 1:1, 1:2), pure propylene oxide (I), pure propylene oxide (II), propylene oxide: epoxy resin ([V]:[V] = 2:1, 1:1, 1:2), pure epoxy resin (I), and pure epoxy resin (II) for 2 hours per gradient;

[0078] (5) Embedding: Pour Epon into the embedding plate, place the material and adjust the position, and let it stand at room temperature for 12 hours;

[0079] (6) Polymerization: The embedded plate was placed at 37℃ for 12 hours, the material position was adjusted, and the plate was placed at 45℃ for 12 hours and at 60℃ for 24 hours.

[0080] (7) Trimming: Fix the embedded block on the trimming table and cut off the excess material around it;

[0081] (8) Sectioning: Sections were prepared using a Leica EMUC6 microtome with a thickness of 2 μm;

[0082] (9) Slicing: Use a diamond scalpel to slice the slices to a thickness of 60 nm. Attach the sliced ​​slices to the support film in the center of the single-hole copper mesh and use filter paper to absorb the water for later use.

[0083] (10) Staining: Stain with uranium acetate (30 min) and lead citrate (40 min). After washing with double-distilled water, absorb the water with clean filter paper strips, collect and air dry for later use.

[0084] (11) Observation and photography: Observation and photography were performed using a Hitachi HT-77000 (60kV) transmission electron microscope.

[0085] Example 6: Observation of petal cell morphology and pollen morphology using an optical microscope

[0086] The morphology of mature petal cells and pollen was observed using an optical microscope (OM). The experimental steps are as follows:

[0087] 1. Take one glass slide and one coverslip, and wipe them clean with a soft cloth. Since the coverslip is very thin, be careful when wiping it. You can use your left thumb and forefinger to hold the edge of the coverslip, lay the gauze flat on your right palm, and gently hold the coverslip from the top and bottom. Apply even pressure and wipe slowly and gently so as not to break the coverslip.

[0088] 2. Use a dropper to draw 1-2 drops of water and place them in the center of the glass slide.

[0089] 3. Use tweezers to tear off the petals (dipping them in pollen grains) and place them in a small drop of water on a glass slide, trying to avoid shrinking the material.

[0090] 4. Use tweezers to pick up a clean coverslip. First, place one side of the coverslip at an angle to contact the small water droplet, and then slowly lower the coverslip to cover the entire observation material. During the operation, prevent the coverslip from falling suddenly to avoid air bubbles, which would hinder the observation effect.

[0091] 5. The prepared slide should be perfectly filled with water between the coverslip and the slide. If there is insufficient water, use a dropper to drip a small amount of water from one edge of the coverslip and absorb it with absorbent paper on the other side to ensure the space between the coverslip and the slide is filled with water. If there is excess water, use absorbent paper to remove it.

[0092] 6. Adjust the microscope magnification for observation and photography.

[0093] Example 7: GUS staining analysis

[0094] Prepare sterile centrifuge tubes (2 ml) containing 1 ml of GUS dye solution on a laminar flow hood. Using sterile forceps and a scalpel, cut the roots, stems, and leaves of GUS promoter and empty vector-positive seedlings and place them into the centrifuge tubes containing the GUS dye solution, ensuring the material is submerged in the liquid. After cutting each sample with forceps and a scalpel blade, sterilize with an alcohol lamp at high temperature to prevent cross-contamination, then incubate overnight at 37°C on a shaking table at 150 rpm. Then, remove the GUS dye solution, add 1 ml of 70% anhydrous ethanol for decolorization, and place the samples flat on a shaking table at 100 rpm at room temperature. Add fresh 70% anhydrous ethanol hourly until the green color of the flax tissue is completely removed, and the tissue background is typically white. Remove the flax tissue and photograph it.

[0095] Example 8: Real-time quantitative PCR

[0096] qRT-PCR was performed using Tiangen SuperReal PreMix Plus (SYBR Green) on a 7500 Real-Time PCR System (BIO-RAD, USA). Each reaction solution contained 10 μL of 2× SuperReal PreMix Plus (SYBR Green), 0.4 μL of 50× ROX Reference Dye, 2 μL of cDNA template, 0.6 μL each of forward and reverse primers, and 6.4 μL of sterile distilled water. The reaction program was 95℃ for 15 min; 95℃ for 10 s, 60℃ for 32 s, for 40 cycles, based on 2... -ΔΔCt The method calculates the relative expression level of genes. ΔΔC T =(C T,target -C T,internalcontrol ) timex -(C T,target -C T,internalcontrol )time0 (Livakand Schmittgen. 2001). Data analysis and plotting were performed using GraphPad Prism9 software. All qRT-PCR experiments were conducted with three biological replicates. LuGAPDH was used as an internal control gene. The primer sequences for all genes required for the experiments are shown in Table 2.

[0097] Table 2 Primer names and sequences required for quantitative real-time PCR

[0098] LuGAPDH AGGTTCTTCCCGCTCTCAAT CCTCCTTGATAGCAGCCTTG LusUGT175 GCAGAGTGATCGGAAGGGAA ACAACGCCCTACTAGACGAG Lus10013532 TGGCTGCGAACTCAAACC CCCAGTGGTGGCAGGAAT Lus10031960 CGCTAAGGTCTCCATCAT TATCGACGCCAAGTGTTC Lus10026679 GAGGTTGCCCTTATTGTC GCCTTCAGCCTGTTGTAC Lus10007983 TTCTTGCCAATGATACTGA CTGGAGCGGATATGTTTA Lus10029719 GGCTGTGGGATGCTAAAC GGCGCTTGTTCTCATCTTCAGCCAT Lus10033187 TCGCCAGGTCACTTACTC TGGTCCAGATGTCTACGC Lus10002763 CAGAGCGATTCGAGGGAG TGCCGATTCGTGGTGTTC Lus10004638 CAACAGGCAAGTCACATT TCACCATACTGGAGGAGC Lus10005080 CTGTCCGTACTCTGTGATG CTCTTTAGCAGGTTTGTTG Lus10034662 AAAATCAACAGGCAGGTC TCGGTGGAGTAATCAAAG Lus10006715 ATCAAGTTACAGCACGAA TCTGTCTCAACCTCCATAC Lus10016732 ACTACACCATTGCGAAGATA CGAAAGATGTGGGAGACG Lus10022427 ATCAAGCACAACCAGCAA GGCTCCGTTACGATGAAA Lus10007755 CCTTCAGCGTACTGGGACA CCTCAAACTCCTGGGAACAT Lus10018690 GCCGCCTTCATCTACAAC TGAGATTCGGTGCCAGAG

[0099] Experimental results:

[0100] Experimental Result 1:

[0101] Please see Figure 1 , Figure 2 and Figure 3 In this application, an overexpression vector of LuUGT175 was constructed and transformed into flax plants. After screening with a medium containing kanamycin resistance, 42 independent resistant overexpression T0 generation lines were obtained, and 15 overexpression lines were identified by PCR. Figure 4 ). Analysis was conducted on transgenic plants from different T4 generations with distinct phenotypes. No significant changes were observed in the roots, stems, and leaves of the transgenic plants. Figure 5 ), while the development of floral organs is abnormal ( Figure 6 A, B). After the wild-type flax flowers bloom, the pedicels are slender, with 5 petals, a rounded corolla, and the petals split at the base. The stamens grow close to the pistil in the center of the flower. Figure 6 B) The overexpression lines OE-2 and OE-14 exhibit varying degrees of petal loss, with the originally rounded petals developing irregular deep lobes. In particular, OE-14 shows that the deep lobes on the petals cause the original 5 petals to become 9-10 narrow petals. However, the deep lobes do not reach the base of the petals, so the base of the petals remains 5 separate petals. From generation T0 to generation T4 and above, the petal deformity phenotype shows stable inheritance.

[0102] Experimental Result 2: Electron Microscopic Observation of the External Morphology and Internal Structure of Petals

[0103] To further explore the causes of petal deformities in LuUGT175 overexpression lines, the petals of wild-type and overexpression flax lines were observed using optical microscopy (400x), scanning electron microscopy (300x), and transmission electron microscopy (1000x). Figure 7Observation of the epidermal cell structure of flax petals using optical microscopy and scanning electron microscopy revealed that the epidermal cells of wild-type materials were clearly visible, with each cell having a relatively complete and very regular morphology. However, the epidermal cells of the overexpression lines OE-2 and OE-14 exhibited irregular morphology and varying degrees of wrinkling, with a small number of cells severely wrinkled and resembling paper sheets. Under 1000x transmission electron microscopy, the internal structure of petals in both wild-type and overexpression lines showed that petal cells contained large central vacuoles with smooth vacuolar membranes and intact, regularly shaped nuclei distributed near the cell membrane. However, the cell walls of wild-type petal cells were significantly thicker than those of the overexpression lines (OE-2 and OE-14). Wild-type petal cells contained numerous starch-like granules distributed along the cell wall, some singly and others clustered together, while the petal cells of the overexpression lines contained only a small number of starch-like granules dispersed along the large vacuoles in the cytoplasm.

[0104] Experimental Result 3: Observation of pollen morphology using an optical microscope

[0105] Pollen grains are an important part of the floral organs of plants, and their morphological characteristics are of great significance for plant classification and identification. Observation under an optical microscope can reveal characteristics such as the shape, size, surface ornamentation, and germination pores of pollen grains. Therefore, the pollen morphology of wild-type and overexpression lines of flax was observed using optical microscopes at 400x and 1000x magnification. Figure 8 The aim was to investigate whether overexpression lines, when petal deformities occurred, led to changes in pollen morphology. Optical microscopy revealed that both wild-type and overexpression lines produced spherical pollen grains, but the surface of wild-type pollen grains was smoother, while the surface of overexpression line pollen grains showed reticulate patterns. Further observation of the germination pores revealed that wild-type pollen grains were trisulcate, but the grooves were relatively shallow. The overexpression line OE-2 was also trisulcate, but the grooves were relatively deep. Interestingly, no obvious germination pores were observed on the surface of the overexpression line OE-14.

[0106] Experimental Result 4: Analysis of the Expression Pattern of LuUGT175

[0107] Since overexpression lines of LuUGT175 consistently exhibited a typical and heritable petal deformity phenotype until the T4 generation, we hypothesized that the LuUGT175 gene is an important characteristic gene involved in floral organ formation, playing a role in the early stages of petal formation. To investigate the expression level of the LuUGT175 gene in flax reproductive organs, the promoter region 2kb upstream of the LuUGT175 gene was fused with a GUS reporter gene, and the promoter-GUS vector was transformed into flax. Floral organs and capsules at different developmental stages of positive plants were collected. GUS staining analysis showed that the LuUGT175 gene was highly expressed at the upper part of the sepals from the budding stage, expressed in the petals at the early budding stage (2 days after budding), with the highest expression level at 4 days after budding, and decreased after the flax flower was fully open (6 days after budding). Figure 9 AE). GUS staining results of capsules at different developmental stages showed that the LuUGT175 gene was strongly expressed in the residual stigma and sepals of the capsule. Figure 9 FJ). Simultaneously, quantitative PCR analysis was performed on floral organs of wild-type and overexpressing (OE-14) lines at 1 day, 2 days, 3 days, 4 days, and 5 days post-budding. Figure 10 Based on this, it is inferred that the LuUGT175 gene is very likely involved in the development of floral organs.

[0108] Experimental Result 5: Expression of Key Genes in Flower Development

[0109] Fifteen genes closely related to plant flower development were screened, and quantitative real-time PCR analysis was performed on wild-type and overexpression lines at different stages of flower development. The results showed that, except for Lus10007983, Lus10013532, Lus10034662, and Lus10022427, the expression levels of the other 11 genes in the overexpression lines at different stages of flax flower development were higher than those in the wild-type lines. In particular, Lus10029719, Lus10033187, Lus10004638, Lus10005080, Lus10006715, Lus10016732, and Lus10018690 were significantly higher in the transgenic lines at different stages of flax flower development than in the wild-type lines. The expression levels of Lus10029719, Lus10006715, Lus10016732, and Lus10018690 were significantly higher than those of the wild type in the overexpression lines 5 days after budding. At this time, Lus10029719 was 38-fold higher than the wild type, Lus10006715 was 17.4-fold higher, Lus10016732 was 9.1-fold higher, and Lus10018690 was 19.3-fold higher. Figure 11The expression levels of the above four genes increased continuously in overexpressing plants as the flower developed, and the expression trend was similar to that of LuUGT175 in overexpressing plants. Figure 10 Therefore, it is inferred that these four genes interact with LuUGT175 and jointly regulate petal shape.

[0110] In summary, this application demonstrates that the flax glycosyltransferase LuUGT175 can participate in regulating flax petal morphology. Overexpression of LuUGT175 leads to varying degrees of petal loss in overexpressing flax lines, resulting in irregularly deep lobes in the originally rounded petals, with the lobes not reaching the base. Petals have always been a key target for improvement in horticultural research. Improving petal traits can enhance the ornamental value of plants. The implementation of this invention will bring significant economic benefits to horticultural production. This invention provides a novel overexpression of the glycosyltransferase LuUGT175 that can induce deep lobes in flax petals, thereby producing highly ornamental multi-petaled flowers.

Claims

1. The application of the LuUGT175 gene in regulating flax petal morphology, characterized by, The sequence of the LuUGT175 gene is shown in SEQ ID NO:

01. The regulation of flax petal morphology refers to the process of overexpressing the LuUGT175 gene to induce irregular deep lobes in flax petals that do not reach the base of the petals, thus forming multi-petaled flowers.

Images