A multiplex nucleic acid detection primer probe set, kit and detection method

Abstract

The application discloses a kind of multiplex nucleic acid detection primer probe group, kit and detection method, belong to gene detection technical field.The application provides a kind of multiplex nucleic acid detection primer probe group, including target primer, hairpin probe primer, universal fluorescent probe, universal crRNA, auxiliary target and report probe, can be combined with qPCR, ddPCR, CRISPR / Cas12a and melting curve analysis (MCA) technology, realizes nucleic acid specific and multiplex detection based on universal fluorescent probe or crRNA.The application further provides a kind of kit comprising the multiplex nucleic acid detection primer probe group, and corresponding detection method overcomes the problem that the number of single-tube detection targets is limited due to the limitation of fluorescence channel.

Description

Technical Field

[0001] This invention belongs to the field of gene detection technology, specifically relating to a multiplex nucleic acid detection primer and probe set, reagent kit, and detection method. Background Technology

[0002] Nucleic acid amplification technology is an indispensable tool in clinical diagnosis and biomedical research, used for assessing gene expression, identifying DNA variations, and detecting pathogens in patient samples. Real-time quantitative polymerase chain reaction (RT-qPCR) and digital PCR technologies have demonstrated excellent specificity and sensitivity in nucleic acid detection. However, these methods typically require target-specific fluorescent probes to ensure detection specificity, and the high cost of these probes increases analytical costs. Furthermore, because quantitative PCR instruments only have 5 to 6 fluorescence channels, the number of targets that can be detected simultaneously is limited, thus restricting detection multiplicity.

[0003] Previous universal detection techniques face challenges such as non-specific amplification, insufficient sensitivity and multiplexity, and incompatibility with digital PCR. Mediator probes, through Taq polymerase digestion, generate mediator primers, enabling specific and universal DNA detection in quantitative PCR (qPCR) or droplet digital PCR (ddPCR). MeltArray technology is a multiplex PCR method utilizing mediator probes and based on melting curve analysis (MCA). However, these detection methods do not fully utilize the mediator primers derived from the mediator probes, and modifications such as PO4 or C7NH2 at the 3' end of the mediator probe to prevent extension increase detection costs. Furthermore, the effectiveness of these methods depends on the efficient binding of amplicons and mediator probes in each amplification cycle to generate mediator primers. However, the continuous variation in amplicon concentration is detrimental to binding between the two in different cycles. Therefore, it is necessary to innovate a new technology for universal and multiplex DNA detection. Summary of the Invention

[0004] This invention provides a multiplex nucleic acid detection primer and probe set, kit, and detection method, which improves detection performance, reduces costs, and eliminates dependence on mediator probes.

[0005] This invention provides a multiplex nucleic acid detection primer and probe set, including target primers, hairpin probe primers, universal fluorescent probes, universal crRNA, auxiliary targets, and reporter probes;

[0006] The hairpin probe primer includes: a 3' end complementary to the template DNA of the nucleic acid to be tested, an intermediate sequence of 15-35 bases complementary to its own single-stranded amplicon, and a 5' end containing a protruding sequence of 10-25 bases.

[0007] The hairpin structure formed by the hairpin probe primer during the cooling step of PCR is degraded by Taq polymerase and generates secondary primers that are complementary to the auxiliary target or universal fluorescent probe.

[0008] The universal fluorescent probe is modified with luminescent and quenching groups at both ends or in the middle, and one segment of the universal fluorescent probe in the melting curve analysis is complementary to the secondary primer and can be extended and amplified to generate a certain length of double-stranded DNA.

[0009] The 3' end of the auxiliary target is complementary to the secondary primer, and the 5' end is complementary to the universal fluorescent probe or universal crRNA. The auxiliary target contains continuous bases or modifying groups at the 3' end or both ends to avoid nonspecific extension.

[0010] In one embodiment of the present invention, the hairpin probe primer is designed to be upstream or downstream of the amplification template.

[0011] In one embodiment of the present invention, the secondary primer includes a prominent sequence at the 5' end of the hairpin probe primer, and the 3' end also includes a portion of the bases of the intermediate sequence of the hairpin probe primer.

[0012] In one embodiment of the present invention, when multiplex nucleic acid detection is performed using qPCR or ddPCR, the sequence length of the universal fluorescent probe is 10 to 35 bases.

[0013] When using melting curve analysis for multiplex nucleic acid detection, the sequence length of the universal fluorescent probe is 30–150 bases.

[0014] In one embodiment of the present invention, the universal fluorescent probe is a synthetic single-stranded DNA or a modified DNA with altered hybridization affinity, including at least one of the following: locked nucleic acid, peptide nucleic acid, and DNA minor groove conjugate.

[0015] In one embodiment of the present invention, the universal fluorescent probe is cleaved by Taq enzyme to release a fluorescent signal, and the type of the universal fluorescent probe includes any one of the following: Taqman probe and double quenching probe.

[0016] The present invention also provides a multiplex nucleic acid detection kit, comprising the above-mentioned multiplex nucleic acid detection primer and probe set, hot-start polymerase, polymerase buffer, dNTPs and MgCl2.

[0017] The present invention also provides a method for multiplex nucleic acid detection, including amplification using the above-mentioned multiplex nucleic acid detection kit and target nucleic acid preparation system.

[0018] In one embodiment of the present invention, the multiplex nucleic acid detection method includes any one of the following: qPCR, ddPCR, CRISPR / Cas12a, or melting curve analysis.

[0019] In one embodiment of the present invention, the target nucleic acid includes any one of the following: extracted sample DNA containing rare mutant or wild-type genes, cDNA obtained by reverse transcription, synthetic plasmid DNA, or single-stranded DNA.

[0020] Beneficial effects: This invention provides a multiplex nucleic acid detection primer and probe set, including target primers, hairpin probe primers, universal fluorescent probes, universal crRNA, auxiliary targets, and reporter probes. Its working principle for detection is as follows: Figure 1 As shown, the new detection system is named the Hairpin Probe Primer Amplification System (HPPA), which can be combined with qPCR, ddPCR, CRISPR / Cas12a, and melting curve analysis (MCA) technologies to achieve nucleic acid-specific and multiplex detection based on universal fluorescent probes or crRNA. During amplification, the hairpin probe primer hybridizes with the template, initiating extension to generate a complementary strand. In subsequent cycles, the intermediate sequence hybridizes with the complementary sequence of its own DNA strand during the PCR cooling step, folding to form a hairpin structure. In the technical solution of this invention, the formed stable hairpin structure is cleaved by Taq polymerase during primer extension, continuously generating secondary primers in each cycle. These secondary primers have a portion of the intermediate sequence of the hairpin probe primer at their 3' ends. The auxiliary target is designed to match the endogenous secondary primers and the universal fluorescent probe. The released secondary primers bind to the auxiliary target, extending and cleaving the universal fluorescent probe (HPPAqPCR, ddPCR). Furthermore, the binding of universal crRNA to double-stranded DNA (with PAM sequences) amplified by secondary primers enables CRISPR / Cas12a-specific DNA detection based on universal crRNA (HPPACRISPR / Cas12a). Further, different secondary primers can extend at different positions on the fluorescent probe, generating fluorescent double-stranded DNA of varying lengths or melting temperatures (Tm), thus distinguishing different targets through a combination of fluorescence color and Tm value. This technique, known as HPPA melting curve analysis (HPPA-MCA), overcomes the challenge of limited fluorescence channels, which restricts the number of targets that can be detected per tube. Attached Figure Description

[0021] Figure 1 A schematic diagram illustrating the principle of a method for achieving specific and multiplex detection of nucleic acids based on universal probes or crRNA;

[0022] Figure 2 The results of HPPA qPCR and specific probe qPCR detection of HPV18 (A,B) and HPV16 (C,D) are shown in the figure. A and C are amplification curves, and B and D are linearity analysis.

[0023] Figure 3 The results of quantifying different cDNA targets using the HPPAddPCR system and comparing them with those of ddPCR using specific probes are shown in the figure.

[0024] Figure 4 The results of detecting different concentrations of HPV18 (A,B) and 16 (C,D) targets using the HPPACRISPR / Cas12a system are shown in the figure.

[0025] Figure 5 Visualization of HPV16 and 18 targets using the dual HPPACRISPR / Cas12a system and its application in clinical specimen testing.

[0026] Figure 6 The figure shows the results of HPPAMCA system detection of HPV16, 18, 31 and 33 targets. In the figure, A, B and C represent multiplex detection using linear probes, D and E represent multiplex detection using hairpin probes, and the arrows indicate the positions of secondary primers.

[0027] Figure 7 The figure shows the results of the HPPA-MCA system detecting multiple HPV targets based on multiple universal probes. The concentration of each target in the figure is 500 copies per reaction, and the arrows indicate different secondary primers generated by the amplification of different targets. Detailed Implementation

[0028] This invention provides a multiplex nucleic acid detection primer and probe set, including target primers, hairpin probe primers, universal fluorescent probes, universal crRNA, auxiliary targets, and reporter probes;

[0029] The hairpin probe primer includes: a 3' end complementary to the template DNA of the nucleic acid to be tested, an intermediate sequence of 15-35 bases complementary to its own single-stranded amplicon, and a 5' end containing a protruding sequence of 10-25 bases.

[0030] The hairpin structure formed by the hairpin probe primer during the cooling step of PCR is degraded by Taq polymerase and generates secondary primers that are complementary to the auxiliary target or universal fluorescent probe.

[0031] The universal fluorescent probe is modified with luminescent and quenching groups at both ends or in the middle, and one segment of the universal fluorescent probe in the melting curve analysis is complementary to the secondary primer and can be extended and amplified to generate a certain length of double-stranded DNA.

[0032] The 3' end of the auxiliary target is complementary to the secondary primer, and the 5' end is complementary to the universal fluorescent probe or universal crRNA. The auxiliary target contains continuous bases or modifying groups at the 3' end or both ends to avoid nonspecific extension.

[0033] The hairpin probe primers of this invention can be designed upstream or downstream of the amplification template, and the hairpin probe primers comprise a 3' end, an intermediate sequence, and a 5' end. In one embodiment, the 3' end of the hairpin probe primer is a primer sequence complementary to the template DNA; the intermediate sequence is a 15-35 base sequence complementary to its own single-stranded amplicon; and the 5' end is a 10-25 base overhang. The intermediate sequence of the hairpin probe primers of this invention can pair complementaryly with its own single-stranded template, thereby folding into a stable hairpin structure during the cooling step of PCR. The hairpin structure can be degraded by Taq polymerase during primer extension, generating secondary primers complementary to auxiliary target sequences or universal probes.

[0034] The secondary primers referred to in this invention are derived from the degradation of hairpin probe primers (hairpin amplicon) by Taq enzyme. In addition to containing the 5' protruding sequence of the complete hairpin probe primer, the 3' end of the secondary primer also contains one or two intermediate sequence bases.

[0035] The auxiliary target sequence described in this invention consists of two parts: a sequence complementary to the secondary primer at its 3' end and a sequence complementary to a universal fluorescent probe or crRNA at its 5' end. Furthermore, chemical modifications such as the addition of several A bases or phosphate groups at the 3' end or both ends of the auxiliary target sequence are employed to prevent potential non-specific extension. The auxiliary target sequence varies slightly depending on the detection method used. For example, in one embodiment using qPCR, the 3' end of the auxiliary target sequence is a sequence complementary to the secondary primer, with a length of 10–25 bases, and the 5' end is a sequence complementary to the universal fluorescent probe, with a length of 15–30 bases. In another embodiment, detection is performed using the CRISPR / Cas12a method. The 3' end of the auxiliary target sequence is a sequence complementary to the secondary primer, with a length of 10–25 bases, and the 5' end is a sequence consistent with the universal crRNA sequence (complementarily paired with the complementary strand of the auxiliary target), containing a PAM sequence (TTTG), with a total length of 15–35 bases. Furthermore, chemical modifications such as the addition of several A bases or phosphate groups to the 3' end or both ends of the auxiliary target are used to prevent possible non-specific elongation.

[0036] The universal fluorescent probe of this invention can have different lengths when different detection methods are used. For example, in qPCR and ddPCR, the sequence length of the universal fluorescent probe is 10 to 35 bases, with the two ends or the middle position modified by luminescent groups and quenching groups, respectively; in melting curve analysis (MCA), the sequence length of the universal fluorescent probe is 30 to 150 bases, with the two ends or the middle position modified by luminescent groups and quenching groups, respectively.

[0037] The universal fluorescent probe described in this invention can be a Taqman probe, a double quenching probe, etc., and is cleaved under the action of Taq enzyme to release a fluorescent signal. In this invention, a sequence of the secondary primer and the universal fluorescent probe are complementary and amplified to generate a double-stranded DNA of a certain length, which has a specific melting temperature (Tm).

[0038] The nucleotide sequence of the universal crRNA described in this invention is shown in SEQ ID No. 19: UAAUUUCUACUAAGUGUAGAUUUGGUCGUCUUCAGCAUGAGCUG;

[0039] The report probe used in this invention may vary slightly depending on the detection method. For example, when using a fluorescence detection method, the sequence of the report probe may be: FAM-TTATT-BHQ1; when using a test strip detection method, the sequence of the report probe may be SEQ ID No. 42: FAM-TTATTTTATTTTATT-Biotin.

[0040] The universal fluorescent probe or universal crRNA described in this invention allows for the use of multiple probes in a single reaction system. These probes have different sequences and are modified with various fluorescent and quenching groups. Different secondary primers generated during amplification of different targets will hybridize with and extend the probes, ultimately producing melting curves with different fluorescence and melting temperatures (Tm), thereby achieving ultramultiplex target detection. The universal fluorescent probe or universal crRNA described in this invention can be synthetic single-stranded DNA or modified DNA with altered hybridization affinity, including one or more of locked nucleic acids (LNA), peptide nucleic acids (PNA), or minor groove binders (MGB).

[0041] The present invention also provides a multiplex nucleic acid detection kit, comprising the above-mentioned multiplex nucleic acid detection primer and probe set, hot-start polymerase, polymerase buffer, dNTPs and MgCl2.

[0042] In one embodiment, when preparing the corresponding reaction system based on the detection kit of the present invention, the reaction system may include: a specific primer concentration of 0.01–2 μM, a universal fluorescent probe concentration of 0.01–1 μM, and an auxiliary target concentration of 0.01–1 μM. The reaction system also includes a hot-start polymerase, a polymerase buffer, dNTPs, MgCl2, and a suitable reaction program to perform PCR. The template for detection in the present invention is extracted sample DNA containing rare mutant or wild-type genes, cDNA obtained from reverse transcription, synthetic plasmid DNA, or single-stranded DNA, etc.

[0043] The present invention also provides a method for multiplex nucleic acid detection, including amplification using the above-mentioned multiplex nucleic acid detection kit and target nucleic acid preparation system.

[0044] In one embodiment of the present invention, the multiplex nucleic acid detection method includes any one of the following: qPCR, ddPCR, CRISPR / Cas12a, or melting curve analysis. In one embodiment of the present invention, the target nucleic acid includes any one of the following: extracted sample DNA containing rare mutant or wild-type genes, cDNA obtained by reverse transcription, synthetic plasmid DNA, or single-stranded DNA.

[0045] To further illustrate the present invention, the following detailed description of a multiplex nucleic acid detection primer and probe set, kit, and detection method provided by the present invention is provided in conjunction with embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0046] Example 1

[0047] A new nucleic acid detection system: HPPA qPCR for detecting HPV18 and 16, the steps are as follows:

[0048] The components of the efficient and universal detection system are shown in steps 1) to 5):

[0049] 1) Based on the HPV18 target, the nucleotide sequences of the upstream hairpin probe primer, target primer, universal fluorescent probe, and auxiliary target are shown in SEQ ID No. 1 to SEQ ID No. 4, respectively; the specific nucleotide sequences of each probe and primer from the 5' end to the 3' end are as follows:

[0050] SEQ ID No. 1: (Underlined text indicates 5' prominent sequence; italic text indicates middle sequence; underlined text indicates primer sequence);

[0051] SEQ ID No.2: AGGAACATTTTGTGAACAGGCA;

[0052] SEQ ID No.3: ROX-GGACTATGTCCGGGAACACAAAGA-BHQ2;

[0053] SEQ ID No. 4: aaaaTCTTTGTGTTCCCGGACATAGTCCaaaCCGTCACAGTCTGCTGATCTaaaaaa.

[0054] 2) Based on the HPV16 target, the nucleotide sequences of the upstream hairpin probe primer, target primer, and auxiliary target are shown in SEQ ID No. 5 to SEQ ID No. 7, respectively; the universal fluorescent probe is SEQ ID No. 3; the specific nucleotide sequences from the 5' end to the 3' end are as follows:

[0055] SEQ ID No. 5: (Underlined text indicates 5' prominent sequence; italic text indicates middle sequence; underlined text indicates primer sequence);

[0056] SEQ ID No.6:AATGACAGCTCAGAGGAGGAG;

[0057] SEQ ID No.7: aaaaTCTTTGTGTTCCCGGACATAGTCCaaaTGGTCACAGTCTGCTGATCTaaaaaa;

[0058] 3) The reaction volume was 30 μL, containing 2 mM MgCl2, 0.2 mM dNTPs, 0.25 μM each of the upstream hairpin probe primer and the target primer, 0.15 μM of the universal fluorescent probe, 0.1 μM of the auxiliary target, and 0.03 U / μL hot-start polymerase; 10 μL of HPV plasmid DNA template at different concentrations was diluted in 3 ng / μL of 293T cell line genomic DNA template. Specific probe qPCR and HPPA qPCR were performed in separate tubes.

[0059] The reaction procedure for specific probe qPCR is the same as that for HPPA qPCR. When using specific probe qPCR for detection, the HPV18 target is:

[0060] Upstream primer (SEQ ID No. 43): ACATGCAACACTTGTGCATC;

[0061] Target primer (SEQ ID No. 2): AGAACATTTTGTGAACAGGCA;

[0062] Specific probe (SEQ ID No. 44): FAM-CATTGTTCCATGCGCAGGAGGT-BHQ1;

[0063] HPV16 target:

[0064] Upstream primer (SEQ ID No. 45): ACACTTGCAACAAAAGGTTACA;

[0065] Target primer (SEQ ID No. 6): AATGACAGCTCAGAGGAGGAG;

[0066] Specific probe (SEQ ID No. 46): FAM-CAAGCAGAACCGGACAGAGCC-BHQ1;

[0067] The concentrations were as follows: upstream primers were all 0.3 μM; downstream primers were all 0.2 μM; and the probe was 0.08 μM.

[0068] 4) Perform qPCR amplification. The specific procedure is as follows: activate enzyme at 95℃ for 3 min; denature at 95℃ for 10 s, anneal and extend at 56℃ for 15 s, collect fluorescence at 74℃ for 20 s, and repeat for 55 cycles.

[0069] 5) qPCR amplification and signal acquisition were performed using the Shanghai Hongshi SLAN-96S qPCR system. The results are as follows: Figure 2 As shown, HPPA qPCR and specific probe qPCR have similar sensitivity and linearity, and both can detect target nucleic acids with high sensitivity.

[0070] Example 2

[0071] A novel nucleic acid detection system: HPPA ddPCR for detecting cDNA targets, with the following steps:

[0072] The components of the high-efficiency, universal probe detection system are shown in steps 1) to 6):

[0073] 1) Based on the EGFR target, the nucleotide sequences of the upstream hairpin probe primer, target primer, universal double quenching probe, and auxiliary target are shown in SEQ ID No. 8 to SEQ ID No. 11, respectively;

[0074] SEQ ID No. 8: (Underlined text indicates 5' prominent sequence; italic text indicates middle sequence; underlined text indicates primer sequence);

[0075] SEQ ID No.9: AACGTACTGGTGAAAACACCG;

[0076] SEQ ID No.10: VIC-GGACT(Q1)ATGTCCGGGAACACAAAGA-Q2;

[0077] SEQ ID No. 11: aaaaTCTTTGTGTTCCCGGACATAGTCCaaaAACGTCACAGTCTGCTGATCTaaaaa.

[0078] 2) Based on the BRAF target, the nucleotide sequences of the upstream hairpin probe primer, target primer, and auxiliary target are shown in SEQ ID No. 12 to SEQ ID No. 14, respectively; the universal double quenching probe is SEQ ID No. 10;

[0079] SEQ ID No. 12: (Underlined text indicates 5' prominent sequence; italic text indicates middle sequence; underlined text indicates primer sequence);

[0080] SEQ ID No.13: TTCTTCATGAAGACCTCACAG;

[0081] SEQ ID No.14: aaaaTCTTTGTGTTCCCGGACATAGTCCaaaGACGTCACAGTCTGCTGATCTaaaaaa;

[0082] 3) Based on the PIK3CA target, the nucleotide sequences of the upstream hairpin probe primer, target primer, and auxiliary target are shown in SEQ ID No. 15 to SEQ ID No. 17, respectively; the universal double quenching probe is SEQ ID No. 10;

[0083] SEQ ID NO.15: (Underlined text indicates 5' prominent sequence; italic text indicates middle sequence; underlined text indicates primer sequence);

[0084] SEQ ID No.16: GGAATCCAGAGGTGAGCTTTC;

[0085] SEQ ID No.17: AGCAGACTGTGACGTGTTTAATTGTGTGGAAGATCCACTGGACAACAAAAATGGATTG;

[0086] 4) The reaction volume is 15 μL, containing 3 μL buffer, 0.15 μL Taq enzyme, 1 μM each of upstream hairpin probe primer and target primer, 0.5 μM universal quenching fluorescent probe, 0.4 μM auxiliary target, and 5 μL cDNA template. Specific probe ddPCR and HPPAddPCR are performed in separate tubes.

[0087] The reaction procedure for specific probe ddPCR is the same as that for HPPA.

[0088] The upstream primer for the EGFR target (SEQ ID No. 47): ATGGTATTCTTTCTCTTCCG CAC;

[0089] Downstream primer (SEQ ID No. 9): AACGTACTGGTGAAAACACCG;

[0090] Specific probe (SEQ ID No. 48): FAM-CAGTTTGGCCAGCCCAAAATCT-BHQ1;

[0091] BRAF target upstream primer (SEQ ID No. 49): CTGTTCAAACTGATGGGACC;

[0092] Downstream primer (SEQ ID No. 13): TTCTTCATGAAGACCTCACAG;

[0093] Specific probe (SEQ ID No. 50) FAM-CATCGAGATTTCACTGTAGCTAGA C-BHQ1;

[0094] PIK3CA target upstream primer (SEQ ID No. 51): ATGAAACAAATGAATGATG CAC;

[0095] Downstream primer (SEQ ID No. 16): GGAATCCAGAGTGAGCTTTC;

[0096] Specific probe (SEQ ID No. 52): FAM-TGCTGTTTAATTGTGTGGAAGAT CC-BHQ1;

[0097] Both upstream and downstream primers were 1 μM; the probe was 0.3 μM.

[0098] 5) Droplet generation and PCR amplification were performed using Zhejiang Leading Technology AD3200 ddPCR. The specific procedure was as follows: enzyme activation at 95℃ for 3 min; denaturation at 95℃ for 30 s; annealing and extension at 58℃ for 50 s; 50 cycles.

[0099] 6) Signal acquisition was performed using the Zhejiang Leading Technology AD3200 ddPCR system, and the results are as follows: Figure 3 As shown, the HPPAddPCR system clearly separates positive and negative droplets, and the quantification of multiple targets is consistent with that of specific probe ddPCR.

[0100] Example 3

[0101] A new nucleic acid detection system: HPPA CRISPR / Cas12a for detecting HPV targets, the steps are as follows:

[0102] The components of the high-efficiency, universal probe detection system are shown in steps 1) to 5):

[0103] 1) Based on the HPV18 target, the nucleotide sequences of the upstream hairpin probe primer, target primer, universal crRNA, and auxiliary target are shown in SEQ ID No. 18, SEQ ID No. 2, and SEQ ID No. 19 to SEQ ID No. 20, respectively;

[0104] SEQ ID No. 18: (Underlined text indicates 5' prominent sequence; italic text indicates middle sequence; underlined text indicates primer sequence);

[0105] SEQ ID No.19: UAAUUUCUACUAAGUGUAGAUUUGGUCGUCUUCAG CAUGAGCUG;

[0106] SEQ ID No.20: aaaaTTTTGGTCGTCTTCAGCATGAGCaaaaCCGTCACAGT CTGCTGAaaaaaa;

[0107] Based on the HPV16 target, the nucleotide sequences of the upstream hairpin probe primer, target primer, universal crRNA, and auxiliary target are shown in SEQ ID No. 21, SEQ ID No. 6, SEQ ID No. 19, and SEQ ID No. 22, respectively.

[0108] SEQ ID No. 21: (Underlined text indicates 5' prominent sequence; italic text indicates middle sequence; underlined text indicates primer sequence);

[0109] SEQ ID No. 22: aaaaTTTTGGTCGTCTTCAGCATGAGCaaaaTGGTCACAGT CTGCTGAaaaaaa;

[0110] 2) The amplification reaction volume was 30 μL, containing 2 mM MgCl2, 0.2 mM dNTPs, 0.3 μM upstream target primer, 0.1 μM auxiliary target, and 0.03 U / μL hot-start polymerase; 10 μL of template at different concentrations were also included. Each template concentration was separated into its own tube for PCR amplification. In this example, the template DNA consisted of different concentrations of 293T cell line genomic DNA.

[0111] 3) PCR amplification was performed using Shanghai Hongshi SLAN-96S. The specific procedure was as follows: enzyme activation at 95℃ for 3 min; denaturation at 95℃ for 10 s, annealing at 56℃ for 15 s, extension at 72℃ for 15 s, for 50 cycles.

[0112] 4) Mix 5 μL of PCR product with 0.2 μM universal crRNA, 0.3 μM Cas12a enzyme, and 0.5 μM reporter probe (fluorescence detection: FAM-TTATT-BHQ1; test strip detection: FAM-TTATTT TATTTTATT-Biotin). Incubate at 42℃ for 40 min using a Shanghai Hongshi SLAN-96S incubator or perform fluorescence detection. In the test strip experiment, the probe concentration is 0.06 μM. Mix 5 μL of the reaction mixture with 45 μL of deionized water, then drop it onto the sample application area of ​​the test strip. Observe the results and take pictures after 10 min.

[0113] 5) Results as follows Figure 4 As shown, the new system exhibits excellent detection performance. It has high sensitivity, successfully detecting up to 10 copies of HPV18 and 16.

[0114] Example 4

[0115] A new nucleic acid detection system: HPPA CRISPR / Cas12a for detecting HPV targets, the steps are as follows:

[0116] The components of the efficient and versatile dual detection system are shown in steps 1) to 5):

[0117] 1) Based on the HPV18 target, the nucleotide sequences of the upstream hairpin probe primer, target primer, universal crRNA, and auxiliary target are shown in SEQ ID No. 18, SEQ ID No. 2, and SEQ ID No. 19 to SEQ ID No. 20, respectively; based on the HPV16 target, the nucleotide sequences of the upstream hairpin probe primer, target primer, universal crRNA, and auxiliary target are shown in SEQ ID No. 21, SEQ ID No. 6, SEQ ID No. 19, and SEQ ID No. 22, respectively.

[0118] 2) The amplification reaction volume is 30 μL, containing 3 mM MgCl2, 0.2 mM dNTPs, 0.3 μM each of the upstream target primers, 0.08 μM of the auxiliary target, and 0.04 U / μL hot-start polymerase; 10 μL of different templates or clinical sample DNA, each in its own tube. The positive control is 10 copies / μL of HPV18 or 16 sample (mixed with 293T genomic DNA).

[0119] 3) PCR amplification was performed using Shanghai Hongshi SLAN-96S. The specific procedure was as follows: enzyme activation at 95℃ for 3 min; denaturation at 95℃ for 10 s, annealing at 56℃ for 15 s, extension at 72℃ for 15 s, for 50 cycles.

[0120] 4) Mix 3 μL of PCR product with 0.2 μM universal crRNA, 0.35 μM Cas12a enzyme, and 0.06 μM reporter probe (for test strip detection: FAM-TTATTTTATTTTATT-Biotin), and incubate at 42℃ for 40 min using a Shanghai Hongshi SLAN-96S incubator. Then mix 5 μL of the reaction mixture with 45 μL of deionized water, and drop the mixture onto the sample application area of ​​the test strip. Observe the results and take a picture after 10 min.

[0121] 5) From Figure 5 As can be seen, the dual detection system has excellent detection performance. Ten copies of HPV18 and 16 can be successfully detected by the test strip, demonstrating high sensitivity. The detection results from 20 clinical DNA samples were completely consistent with those of commercial kits.

[0122] Example 5

[0123] A new nucleic acid detection system: HPPA-MCA for detecting HPV targets, the steps are as follows:

[0124] The components of the efficient, multi-component detection system are shown in steps 1) to 5):

[0125] 1) Based on the HPV18 target, the nucleotide sequences of the upstream hairpin probe primer and the target primer are as shown in SEQ ID No. 18 and SEQ ID No. 2, respectively;

[0126] Based on the HPV16 target, the nucleotide sequences of the upstream hairpin probe primer and the target primer are shown in SEQ ID No. 23 and SEQ ID No. 6, respectively;

[0127] SEQ ID NO.23: (Underlined text indicates 5' prominent sequence; italic text indicates middle sequence; underlined text indicates primer sequence);

[0128] Based on the HPV31 target, the nucleotide sequences of the upstream hairpin probe primer and the target primer are shown in SEQ ID No. 24 and SEQ ID No. 25, respectively;

[0129] SEQ ID No. 24: (Underlined text indicates 5' prominent sequence; italic text indicates middle sequence; underlined text indicates primer sequence);

[0130] SEQ ID No.25: CTGAGGCAACTGACCTCTAC;

[0131] Based on the HPV33 target, the nucleotide sequences of the upstream hairpin probe primer and the target primer are shown in SEQ ID No. 26 and SEQ ID No. 27, respectively;

[0132] SEQ ID No. 26: (Underlined text indicates 5' prominent sequence; italic text indicates middle sequence; underlined text indicates primer sequence);

[0133] SEQ ID No.27: CAACTGACCTATACTGCTA;

[0134] The universal fluorescent probes used are linear probes or hairpin probes, with sequences shown in SEQ ID No. 28 and SEQ ID No. 29.

[0135] SEQ ID No.28: ROX-AGGCGGACTCACGAGACCTGAGCAGTGGTCACAGGATCTCCGTCACAGTCTGCT-BHQ2;

[0136] SEQ ID No. 29: ROX-AGGCGGACTCACGAGACCTGAGCAGTGGTCACAGGATCTCCGTCACAGTTCTGCTCCGCCT-BHQ2.

[0137] 2) The reaction volume is 30 μL, containing 3 mM MgCl2, 0.2 mM dNTPs, 0.15–0.5 μM upstream target primers, 0.2 μM universal fluorescent linear or hairpin probe, 0.04 U / μL hot-start polymerase, and 10 μL of different HPV plasmid DNA templates (diluted to 3 ng / μL genomic DNA of cell line 293T).

[0138] 4) Perform PCR amplification. The specific procedure is as follows: activate enzyme at 95℃ for 3 min; denature at 95℃ for 10 s, anneal at 58℃ for 20 s, extend at 72℃ for 10 s, for 55 cycles.

[0139] 5) Melting curve analysis (from 50℃ to 90℃) was performed using the Shanghai Hongshi SLAN-96S qPCR system, and fluorescence was collected every 0.04℃.

[0140] The results are as follows Figure 6 As shown, both linear probes and hairpin probes can achieve multiplex detection, enabling highly sensitive and simultaneous detection of multiple target nucleic acids.

[0141] Example 6

[0142] A new nucleic acid detection system, HPPA-MCA, detects multiple HPV targets. The steps are as follows:

[0143] The components of the efficient, multi-component detection system are shown in steps 1) to 5):

[0144] 1) Based on the HPV18 target, the nucleotide sequences of the upstream hairpin probe primer and the target primer are as shown in SEQ ID No. 30 and SEQ ID No. 2, respectively;

[0145] SEQ ID No. 30: (Underlined text indicates 5' prominent sequence; italic text indicates middle sequence; underlined text indicates primer sequence);

[0146] Based on the HPV16 target, the nucleotide sequences of the upstream hairpin probe primer and the target primer are shown in SEQ ID No. 31 and SEQ ID No. 6, respectively;

[0147] SEQ ID No. 31: (Underlined text indicates 5' prominent sequence; italic text indicates middle sequence; underlined text indicates primer sequence);

[0148] Based on the ACTB target, the nucleotide sequences of the upstream hairpin probe primer and the target primer are shown in SEQ ID No. 32 and SEQ ID No. 33, respectively;

[0149] SEQ ID No. 32: (Underlined text indicates 5' prominent sequence; italic text indicates middle sequence; underlined text indicates primer sequence);

[0150] SEQ ID No.33: AGGCATCCTCACCCTGAAG;

[0151] Based on the HPV58 target, the nucleotide sequences of the upstream hairpin probe primer and the target primer are shown in SEQ ID No. 34 and SEQ ID No. 35, respectively;

[0152] SEQ ID No. 34: (Underlined text indicates 5' prominent sequence; italic text indicates middle sequence; underlined text indicates primer sequence);

[0153] SEQ ID No.35: TATAACCTCAGATCGCTGCAA;

[0154] Based on the HPV31 target, the nucleotide sequences of the upstream hairpin probe primer and the target primer are shown in SEQ ID No. 36 and SEQ ID No. 25, respectively;

[0155] SEQ ID No. 36: (Underlined text indicates 5' prominent sequence; italic text indicates middle sequence; underlined text indicates primer sequence);

[0156] Based on the HPV33 target, the nucleotide sequences of the upstream hairpin probe primer and the target primer are shown in SEQ ID No. 37 and SEQ ID No. 27, respectively;

[0157] SEQ ID No. 37: (Underlined text indicates 5' prominent sequence; italic text indicates middle sequence; underlined text indicates primer sequence);

[0158] Based on the HPV35 target, the nucleotide sequences of the upstream hairpin probe primer and the target primer are shown in SEQ ID No. 38 and SEQ ID No. 39, respectively;

[0159] SEQ ID No. 38: (Underlined text indicates 5' prominent sequence; italic text indicates middle sequence; underlined text indicates primer sequence);

[0160] SEQ ID No.39: GAACGACCTTACAAACTGCA;

[0161] The sequences of universal probes 1 and 2 are shown in SEQ ID No. 40 and SEQ ID No. 41, respectively;

[0162] SEQ ID No.40: FAM-TGTACACTCAGACAACAGTGAGACTCGACCTCA GTGAGTCAGCCAGCACA-BHQ1;

[0163] SEQ ID No. 41: ROX-AAGATGATACTTCTCTCTAGGACGACACGAGACCTGAGCAGTGGTCACAGGATCTCCA-BHQ2;

[0164] 2) The reaction volume is 30 μL, containing 6 mM MgCl2, 0.25 mM dNTPs, 0.2–0.5 μM upstream target primer, 0.15–0.25 μM universal fluorescent probe, 0.06 U / μL hot-start polymerase, and 5 μL of different HPV plasmid DNA templates (diluted to 3 ng / μL genomic DNA of cell line 293T).

[0165] 4) Perform PCR amplification. The specific procedure is as follows: activate enzyme at 95℃ for 3 min; then denature at 95℃ for 10 s, anneal at 60℃ for 35 s, and extend at 72℃ for 10 s for 55 cycles.

[0166] 5) Melting curve analysis (from 50℃ to 85℃) was performed using the Shanghai Hongshi SLAN-96S qPCR system, and fluorescence was collected every 0.04℃.

[0167] The results are as follows Figure 7 As shown, the two universal probes enable seven-fold nucleic acid detection, demonstrating that HPPA-MCA possesses multiplex detection capabilities.

[0168] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A primer and probe set for multiplex nucleic acid detection based on the HPPA-CRISPR / Cas12a method, characterized in that, This includes target primers, hairpin probe primers, universal crRNA, auxiliary targets, and reporter probes; The hairpin probe primer includes: a 3' end complementary to the template DNA of the nucleic acid to be tested, an intermediate sequence of 15-35 bases complementary to its own single-stranded amplicon, and a 5' end containing a protruding sequence of 10-25 bases. The hairpin structure formed by the hairpin probe primer during the cooling step of PCR is degraded by Taq polymerase and generates a secondary primer that is complementary to the auxiliary target. The 3' end of the auxiliary target is complementary to the secondary primer, the 5' end is consistent with the universal crRNA sequence and contains the PAM sequence, and the 3' end or both ends of the auxiliary target contain continuous bases or modifying groups to avoid nonspecific extension. The secondary primer contains the prominent sequence at the 5' end of the hairpin probe primer, and the 3' end also includes a portion of the bases of the middle sequence of the hairpin probe primer.

2. A primer and probe set for multiplex nucleic acid detection based on HPPA-MCA melting curve analysis, characterized in that, This includes target primers, hairpin probe primers, and universal fluorescent probes; The hairpin probe primer includes: a 3' end complementary to the template DNA of the nucleic acid to be tested, an intermediate sequence of 15-35 bases complementary to its own single-stranded amplicon, and a 5' end containing a protruding sequence of 10-25 bases. The hairpin structure formed by the hairpin probe primers during the cooling step of PCR is degraded by Taq polymerase, generating secondary primers that are complementary to the universal fluorescent probe. The universal fluorescent probe is modified with a luminescent group and a quenching group at both ends or in the middle, respectively; the length of the universal fluorescent probe is 30 to 150 bases; the secondary primer and a segment of the universal fluorescent probe are complementary and amplified to generate a double-stranded DNA of a certain length, which has a specific melting temperature; The secondary primer contains the prominent sequence at the 5' end of the hairpin probe primer, and the 3' end also includes a portion of the bases of the middle sequence of the hairpin probe primer.

3. The multiplex nucleic acid detection primer and probe set according to claim 2, characterized in that, The hairpin probe primers are designed to be located upstream or downstream of the amplification template.

4. A kit for multiplex nucleic acid detection based on the HPPA-CRISPR / Cas12a method, characterized in that, It includes the multiplex nucleic acid detection primer and probe set as described in claim 1, a hot-start polymerase, a polymerase buffer, dNTPs, and MgCl2.

5. A kit for multiplex nucleic acid detection based on HPPA-MCA melting curve analysis, characterized in that, It includes the multiplex nucleic acid detection primer and probe set as described in claim 2 or 3, a hot-start polymerase, a polymerase buffer, dNTPs, and MgCl2.

Images