A method for constructing a transferrin overexpression non-human primate model and application thereof in construction of an animal model of stroke
Patent Information
- Application Number
- CN202411687558.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-25
- Publication Date
- 2026-09-18
- Estimated Expiration
- 2044-11-25
AI Technical Summary
目前常用的模式动物如大鼠、小鼠等啮齿类动物,虽然大鼠、小鼠易于遗传操作,但由于其不能完全复制人类疾病的复杂性,不能精准地模拟人类脑疾病的发病过程,也成为了药物研发和临床的一大亟待解决的难题
[0003] In view of this, the purpose of this invention is to provide a method for constructing a non-human primate model of transferrin overexpression, which overexpresses the transferrin-encoding gene in non-human primates through adenovirus-mediated overexpression, thus providing a basis for the construction of an animal model of stroke.
Smart Images

Figure CN119404806B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of disease animal model construction technology, specifically relating to a method for constructing a non-human primate animal model with transferrin overexpression and its application in the construction of a stroke animal model. Background Technology
[0002] Stroke is a general term for a group of diseases characterized by sudden, localized disruption of cerebral blood circulation leading to neurological dysfunction, usually caused by vascular embolism or rupture. Moderate to severe stroke often induces complications of other age-related diseases, posing a significant threat to human health. However, current intervention and treatment methods are limited, making it urgent to elucidate its pathogenesis and develop effective prevention and intervention strategies. Selecting suitable animal models is crucial for disease mechanism research and drug development. Currently used model animals, such as rats and mice, while easily genetically manipulated, cannot fully replicate the complexity of human diseases or accurately simulate the pathogenesis of human brain diseases, thus posing a significant challenge for drug development and clinical application. Summary of the Invention
[0003] In view of this, the purpose of this invention is to provide a method for constructing a non-human primate model of transferrin overexpression, which overexpresses the transferrin-encoding gene in non-human primates through adenovirus-mediated overexpression, thus providing a basis for the construction of an animal model of stroke.
[0004] This invention provides a method for constructing a non-human primate model of transferrin overexpression, comprising the following steps:
[0005] The recombinant adeno-associated virus vector encoding the transferrin gene and the helper vector were packaged to obtain recombinant adeno-associated virus;
[0006] The recombinant adeno-associated virus was introduced into non-human primates for overexpression to obtain a transferrin-overexpressing non-human primate model.
[0007] Preferably, the recombinant adeno-associated virus is introduced via intravenous injection;
[0008] The dosage of the recombinant adeno-associated virus is not less than 1×10⁻⁶. 12 VG / each.
[0009] Preferably, the method for constructing the recombinant adeno-associated virus vector is to clone a fusion gene formed by the kozak sequence and the transferrin coding gene into the XhoI and SpeI multiple cloning sites in the backbone vector.
[0010] The backbone vector includes GPAAV-CMV-P2A-eGFP-WPRE.
[0011] Preferably, the nucleotide sequence of the gene encoding transferrin is shown in SEQ ID NO:1.
[0012] This invention provides the application of the construction method or the transferrin overexpression non-human primate model obtained by the construction method in the preparation of non-human primate thrombotic disease models.
[0013] This invention provides the application of reagents and photochemical inducers that promote transferrin overexpression in the preparation of non-human primate models of stroke.
[0014] Preferably, the reagent that promotes transferrin overexpression includes a recombinant adeno-associated virus vector or recombinant adeno-associated virus containing the gene encoding transferrin.
[0015] Preferably, the photochemical inducer includes Bengal rose red and a green light source.
[0016] Preferably, the photochemical inducer is used to induce transferrin overexpression in non-human primates for 25 days.
[0017] Preferably, the induction treatment method involves injecting Bengal rose red into non-human primates that overexpress transferrin, followed by green light irradiation of the arterial areas of the motor and sensory cortices of the non-human primates' brains.
[0018] The duration of the green light irradiation is 18–22 minutes;
[0019] The diameter of the green light spot is 7–9 mm.
[0020] This invention provides a method for constructing a non-human primate model of transferrin overexpression, comprising the following steps: packaging a recombinant adeno-associated virus (AAV) vector encoding the transferrin coding gene and an auxiliary vector to obtain a recombinant AAV; and introducing the recombinant AAV into non-human primates for overexpression to obtain a transferrin-overexpressing non-human primate model. This invention uses non-human primates as host animals, which are superior to humans in terms of their highly similar genetic composition, physiological metabolism, organ structure, and behavioral cognitive functions, allowing for a high degree of replication of the molecular mechanisms of disease development and providing technical support for drug development and disease treatment. Furthermore, this invention utilizes AAV-mediated transferrin coding gene expression in animals, avoiding the adverse effects of viral cytotoxicity while ensuring the overexpression of the exogenous target gene. Examples of this invention show that the transferrin-overexpressing non-human primate model constructed by this invention has a shortened clotting time. It is evident that this invention successfully established a non-human primate animal model of coagulation tendency by overexpressing the coagulation regulatory factor transferrin, which can be used in the construction of thrombotic disease models such as stroke, coronary heart disease, and atherosclerosis.
[0021] This invention provides the application of reagents and photochemical inducers that promote transferrin overexpression in the preparation of non-human primate models of stroke. First, a non-human primate model of coagulation tendency is constructed using reagents that promote transferrin overexpression. Then, this model is used as the treatment subject for photochemical induction with a photochemical inducer. Results from the embodiments of this invention show that, compared with the empty adeno-associated virus group, the transferrin-overexpressing rhesus monkeys exhibited more severe brain pathological damage and poorer recovery ability after photochemical induction treatment, along with a significant decline in behavioral functional assessment. The application provided by this invention makes it possible to observe more phenotypes and differences in drug treatment in stroke models, offering new means to elucidate the pathogenesis of stroke and its clinical treatment. Attached Figure Description
[0022] Figure 1 The figure shows the transferrin expression results in the plasma of macaques after different injection times, using adeno-associated virus (AAV) overexpressing transferrin and control empty AAV.
[0023] Figure 2 Figure 1 shows the results of coagulation parameters in plasma of a non-human primate model with transferrin overexpression.
[0024] Figure 3 The figure shows the expression results of transferrin in the cerebrospinal fluid of rhesus monkeys overexpressing transferrin.
[0025] Figure 4 Image showing the results of routine blood tests on rhesus monkeys after photochemical induction of transferrin overexpression;
[0026] Figure 5 The images show the results of MRI scans of cerebral edema in two non-human primate stroke models; where A is the MRI image and B is the statistical result of the lesion volume.
[0027] Figure 6 The figures show the behavioral results of rhesus monkeys after photochemically induced transferrin overexpression. A represents the behavior of the modified Brinkman board feeding task, B represents the average single feeding time of the Brinkman board feeding task, C represents the number of successful feedings in the first 30 seconds of the Brinkman board feeding task, D represents the total time to complete the Brinkman board feeding task, E represents the behavior of the vertical trough feeding task, and F represents the feeding time of the vertical trough feeding task. Detailed Implementation
[0028] This invention provides a method for constructing a non-human primate model of transferrin overexpression, comprising the following steps:
[0029] The recombinant adeno-associated virus vector encoding the transferrin gene and the helper vector were packaged to obtain recombinant adeno-associated virus;
[0030] The recombinant adeno-associated virus was introduced into non-human primates for overexpression to obtain a transferrin-overexpressing non-human primate model.
[0031] This invention packages a recombinant adeno-associated virus vector encoding the transferrin gene and an auxiliary vector to obtain a recombinant adeno-associated virus.
[0032] In this invention, the preferred method for constructing the recombinant adeno-associated virus vector is to clone a fusion gene formed by the kozak sequence and the transferrin coding gene into the XhoI and SpeI multiple cloning sites in the backbone vector. The kozak sequence improves translation initiation efficiency by promoting ribosome recognition and binding to the start codon. The backbone vector preferably comprises a plasmid obtained by removing the GFP gene from a GPAAV-CMV-P2A-eGFP-WPRE-based vector. The nucleotide sequence of the transferrin coding gene is preferably as shown in SEQ ID NO:1. The recombinant adeno-associated virus vector is 7545 bp in length.
[0033] In this invention, the auxiliary vector preferably includes an adenovirus AAV9 helper packaging plasmid and a serotype plasmid. The recombinant adeno-associated virus vector, serotype plasmid, and adenovirus AAV9 helper packaging plasmid are arranged in a molar ratio of 1:1:2 to form a packaging system. The working concentration of the recombinant adeno-associated virus vector in the packaging system is preferably 500 ng / μL. The packaging method involves transfecting the packaging system into mammalian cells using a transfection reagent. This invention does not impose any special limitations on the type of transfection reagent; any transfection reagent well-known in the art, such as HG transgene reagent, can be used. The mammalian cells are preferably AAV Pro-293T cells. The transfection time is preferably 15–20 min, more preferably 20 min. After transfection, the culture medium is replaced with fresh medium and cultured for another 6–8 h. The successful packaging of adeno-associated virus is verified by quantitative PCR detection of the viral copy number in the viral concentrate. The results show that packaged adeno-associated virus particles were successfully obtained.
[0034] The recombinant adeno-associated virus was introduced into non-human primates for overexpression to obtain a transferrin-overexpressing non-human primate model.
[0035] In this invention, the non-human primates preferably include rhesus macaques and / or cynomolgus monkeys. Transferrin is primarily synthesized in the liver; therefore, the recombinant adeno-associated virus is preferably administered intravenously, rapidly distributing to the liver via the bloodstream and infecting the liver to achieve overexpression. Furthermore, transferrin can specifically bind to transferrin receptors present on the surface of brain capillary endothelial cells at the blood-brain barrier, forming a transferrin-receptor complex. This complex can enter the brain via endocytosis and subsequently dissociate from the receptor, thereby enabling transferrin to cross the blood-brain barrier. The dosage of the recombinant adeno-associated virus administered is not less than 10... 12 VG / each, which can be 5×10 12 ~10 14 VG / animal. The preferred working concentration of the recombinant adeno-associated virus is 10. 13 VG / mL, can be 10 12 -10 14 VG / mL. In this invention, recombinant adeno-associated virus was injected intravenously into rhesus monkeys. Transferrin content detection showed that transferrin was overexpressed not only in peripheral blood plasma but also in intracranial blood. Further analysis of coagulation parameters revealed that transferrin-overexpressing rhesus monkeys had lower APTT and FIB values than the control group, indicating a shortened clotting time and a high propensity for coagulation.
[0036] Given that the transferrin overexpression non-human primate model has the characteristic of shortened clotting time, the present invention provides the application of the construction method or the transferrin overexpression non-human primate model obtained by the construction method in the preparation of non-human primate thrombotic disease models.
[0037] In this invention, the thrombotic disease preferably includes at least one of the following: stroke, coronary heart disease, and atherosclerosis.
[0038] This invention provides the application of reagents and photochemical inducers that promote transferrin overexpression in the preparation of non-human primate models of stroke.
[0039] In this invention, the reagent for promoting transferrin overexpression preferably comprises a recombinant adeno-associated virus vector or recombinant adeno-associated virus containing the transferrin coding gene. The nucleotide sequence of the transferrin coding gene is preferably as shown in SEQ ID NO:1. This invention does not impose any particular limitation on the construction method of the recombinant adeno-associated virus vector or recombinant adeno-associated virus containing the transferrin coding gene; any method well-known in the art for constructing a recombinant adeno-associated virus vector or recombinant adeno-associated virus may be used.
[0040] In this invention, the photochemical inducer preferably includes Rosacea Bengal and a green light source. The emission wavelength of the green light source is preferably 528-532 nm, and can be 530 nm. In this invention, the photochemical inducer is preferably administered by treating non-human primates with transferrin overexpression reagent for 25 days. The preferred method of induction treatment is to inject Rosacea Bengal into non-human primates overexpressing transferrin, followed by green light irradiation of the arterial areas of the motor and sensory cortices of the non-human primates' brains. The injection dose of Rosacea Bengal is 20 mg / kg / time, injected twice, with a preferred interval of 20 minutes between the two injections. The effect of Rosacea Bengal is to generate free radicals through photocatalytic degradation, which damage vascular endothelial cells, promote platelet aggregation, activate the coagulation process, and thus promote thrombus formation. The duration of green light irradiation is preferably 18-22 minutes, more preferably 20 minutes. The diameter of the green light spot is preferably 7-9 mm, and can be 8 mm.
[0041] In this invention, the blood routine, behavioral phenotype, transferrin expression, and pathological tissue of the brain injury area of the constructed non-human primate model of stroke were detected. The results showed that rhesus monkeys with transferrin overexpression had poor injury recovery ability after photochemical induction (PT), and the edema damage in the lesion area of the transferrin overexpression group was more persistent.
[0042] The following detailed description, in conjunction with embodiments, illustrates a method for constructing a non-human primate model of transferrin overexpression provided by the present invention and its application in the construction of an animal model of stroke. However, these descriptions should not be construed as limiting the scope of protection of the present invention.
[0043] Example 1
[0044] A method for constructing a non-human primate model of transferrin overexpression
[0045] 1. Construction of rhesus monkey transferrin gene overexpression plasmid and adeno-associated virus packaging
[0046] 1.1 Plasmid Construction
[0047]
[0048] 1.2 Adeno-associated virus packaging
[0049] The successfully constructed adeno-associated expression vector and adenovirus AAV9 helper packaging plasmid were extracted using a high-purity, endotoxin-free kit and transfected using HG transgene reagent. TM The constructed viral vector and its helper packaging element plasmid were co-transfected into AAVPro-293T cells. During transfection, the expression plasmid (10 μg), serotype plasmid, and helper plasmid were prepared in a 1:1:2 molar ratio. After 6–8 h of transfection, the culture medium was replaced with fresh medium and enhancing buffer (5 mM). After 72 h of further culture, the cells detached, and the virus-rich cells and supernatant were collected. These were then concentrated and purified to obtain a high-titer virus concentrate. Simultaneously, a control group was prepared by packaging adeno-associated virus using a blank vector without the target gene instead of the adeno-associated expression vector and the adenovirus AAV9 helper packaging plasmid. The resulting virus was the control adeno-associated virus.
[0050] 1.3 Adeno-associated virus titer testing
[0051] Before titer testing, standard plasmids need to be prepared. The bacterial culture containing the empty vector plasmid is cultured overnight, and 3–5 mL of fresh bacterial culture is used to extract the plasmid. 1 μg of the extracted empty vector plasmid is double-digested with Xho I restriction endonuclease and Spel restriction endonuclease. The digestion products are then subjected to agarose gel electrophoresis, and the gel is recovered after electrophoresis. Simultaneously, the recombinant vector encoding the transferrin gene prepared above is also double-digested with these enzymes. The digestion products are then subjected to agarose gel electrophoresis, and the target fragment is recovered. The concentrations of the recovered vector and target fragment are determined, and the required volume ratio is calculated based on a vector:target fragment molar ratio of 1:7. The vector and target fragment are ligated using DNA ligase. Finally, the ligation product is transformed into prepared *E. coli* competent cells. After antibiotic selection, single colonies are picked for sequencing identification.
[0052] Prepare samples and standards. Dilute the standard quality particles 10-fold serially. Set the standard quality particles to their original concentration and 10-fold serial concentration. -1 10 -2 10 -3 10 -4 10 -5 The sample was serially diluted 10-fold, specifically: 10 -3 10 -4 10 -5 10 -6 10 -7The total reaction volume was calculated based on the reaction number (X) (two replicates were performed for each gradient). The qPCR system was set up as follows: 2×SYBR Mix (10 μL), 0.2 μL of 10 μM upstream primer (CGCTATGTGGATACGCTGCTTTA, SEQ ID NO:2), 0.2 μL of 10 μM downstream primer (GCAACCAGGATTTATACAAGGAGGA, SEQ ID NO:3), template (2 μL), and then the total volume was brought to 20 μL with ultrapure water (7.6 μL). The reaction system was as follows: pre-denaturation at 95℃ (30 s); PCR cycles at 95℃ (15 s), 60℃ (60 s), for a total of 40 cycles; melting curve at 60℃→95℃. The number of AAV viral particles was determined by detecting the genome copy number of the AAV vector using qPCR to determine whether the adeno-associated virus was successfully packaged. The results showed that recombinant AAV viral particles were successfully obtained.
[0053] 2. Construction of a rhesus monkey transferrin overexpression model
[0054] Successfully packaged transferrin-overexpressing adeno-associated virus (AAV) and blank vector AAV were injected intravenously into rhesus monkeys (4 monkeys with empty vector and 4 monkeys with transferrin overexpression). The viral injection dose was 1 × 10⁻⁶. 13 VG / mL / animal. Serum samples were collected before virus injection (d0) and after virus injection (d7, d14, d20, d25, d30, d36, d43) for transferrin content detection (ELISA) to assess the transferrin overexpression effect. The procedure for detecting transferrin content in rhesus monkey serum is as follows:
[0055] Rhesus monkey serum was diluted 1:5000 with coating buffer (0.01% sodium carbonate, pH 9.6), and 100 μL was added to each well of a 96-well flat-bottom immunoassay plate, with 3 replicates, and incubated overnight at 4°C. The supernatant was then discarded, and the plate was washed three times with PBST buffer (PBS buffer containing 0.1% Tween 20). 100 μL of 5% BSA blocking buffer (5 g BSA dissolved in 100 g PBST buffer) was added to each well, and the plate was incubated at 37°C for 1 h.
[0056] After washing three times, anti-transferrin antibody (1:1000) was dissolved in blocking buffer, and 100 μL was added to each well. The mixture was incubated at 37°C for 1 hour. After washing three more times, rabbit IgG secondary antibody (1:5000) was added, and the mixture was incubated at 37°C for another 1 hour. Color development was performed using 90 μL / well TMB buffer, and incubation was carried out at 37°C for approximately 10 minutes. Once a clear color gradient was observed, the reaction was stopped with 50 μL / well stop solution. The absorbance was measured at 450 nm using a microplate reader.
[0057] See results Figure 1 A significant increase in transferrin levels was detectable in the blood of rhesus monkeys 14 days after intravenous injection of adeno-associated virus (AAV).
[0058] Example 2
[0059] Detection of clotting time in rhesus monkeys with transferrin overexpression
[0060] The peripheral blood coagulation parameters of transferrin-overexpressing rhesus monkeys were tested using a fully automated coagulation function analyzer, including prothrombin time (PT), activated partial thromboplastin time (APTT), thrombin time (TT), and fibrinogen (FIB).
[0061] See results Figure 2 Transferrin-overexpressing rhesus monkeys showed lower APTT and FIB levels than the control group.
[0062] Example 3
[0063] Application of transferrin overexpression in macaques in a photochemically induced stroke model
[0064] A stroke model was established by photochemical induction 25 days after injection of transferrin-overexpressing virus (TF) and empty vector virus (Vehicle). Blood routine tests, behavioral phenotypes (Brinkman board feeding, vertical groove feeding), and MRI were performed on both groups of macaques, and baseline values were recorded.
[0065] The photochemical induction of a stroke model was performed as follows: After intravenous injection of Rose Bengal (20 mg / kg, twice at 20-minute intervals) into rhesus monkeys, the motor and sensory cortex regions of the monkey brain were surgically exposed. Three sites were selected at the lateral fissure of the distal insular segment (M3) of the middle insular artery, and each site was irradiated with green light (530 nm, 8 mm spot) for 20 minutes to induce stroke.
[0066] After induction, various indicators such as blood routine, behavioral phenotype (Brinkmanboard feeding, vertical groove feeding) and MRI were detected in the two groups of macaques. Finally, 30 days after photoinduction, the macaque brain was perfused and samples were taken to detect the expression of transferrin in the cerebrospinal fluid, and to verify the effect of transferrin overexpression on the macaque photochemical-induced stroke model.
[0067] See results Figure 3 The transferrin content in the cerebrospinal fluid of transferrin-overexpressing rhesus monkeys and control monkeys was detected by enzyme-linked immunosorbent assay (ELISA). At 30 days post-surgery, the transferrin content in the cerebrospinal fluid of the overexpressing group remained significantly higher than that in the control group.
[0068] See results Figure 4 Blood routine indicators were measured using a fully automated blood analyzer. Compared with the control macaques, the transferrin-overexpressing macaques showed a stronger and more significant postoperative inflammatory response. This indicates that transferrin overexpression promotes an increased inflammatory response in macaques after photochemical induction.
[0069] See results Figure 5 MRI was used to examine the phenotype of photochemically induced cerebral edema in rhesus monkeys using a three-dimensional weighted fast spin echo sequence (voxel size = 0.5 × 0.5 × 0.5 mm, echo time = 396.48 ms, repetition time = 3400 ms, deflection angle: 59°). Compared with the control group, the transferrin-overexpressing rhesus monkeys showed more persistent and significantly different edema damage in the lesion area. This indicates that transferrin-overexpressing rhesus monkeys have poor recovery ability after photochemical induction.
[0070] See results Figure 6 The modified Brinkman board feeding task and the vertical trough feeding task were used to evaluate the finger motor function phenotypes in rhesus monkeys after photochemical induction. Compared with the control group, the transferrin-overexpressing rhesus monkeys had significantly fewer successful feeding attempts after the modified Brinkman board feeding task than the pre-operative baseline, as shown by a reduced rate of change in the number of successful feeding attempts, and the feeding time was significantly slower after the operation than the pre-operative baseline, as shown by an increased rate of change in the feeding time. In addition, the transferrin-overexpressing rhesus monkeys had significantly slower feeding times after the operation of the vertical trough feeding task than the pre-operative baseline. In contrast, the control group showed little or no change in the number of successful feeding attempts and the feeding time was slightly better than before the operation. This indicates that transferrin-overexpressing rhesus monkeys can exacerbate photochemically induced stroke injury and have poor recovery ability.
[0071] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. The application of a reagent and photochemical inducer for promoting transferrin overexpression in the preparation of a non-human primate model of stroke, wherein the reagent for promoting transferrin overexpression comprises a recombinant adeno-associated virus vector or recombinant adeno-associated virus containing a gene encoding transferrin. The photochemical inducer was used to induce the transferrin overexpression in non-human primates on day 25 after the reagent was introduced into the animal. The induction treatment method involves injecting Bengal rose red into non-human primates that have overexpressed transferrin, followed by green light irradiation of the arterial areas of the motor and sensory cortices of the non-human primates' brains.
2. The application according to claim 1, characterized in that, The duration of the green light irradiation is 18-22 minutes; The diameter of the green light spot is 7-9 mm.
3. The application according to claim 1, characterized in that, The method for treating non-human primates with the reagent for transferrin overexpression includes the following steps: The recombinant adeno-associated virus vector encoding the transferrin gene and the helper vector were packaged to obtain recombinant adeno-associated virus; The recombinant adeno-associated virus was introduced into non-human primates for overexpression to obtain a transferrin-overexpressing non-human primate model.
4. The application according to claim 3, characterized in that, The recombinant adeno-associated virus was introduced via intravenous injection; The dosage of the recombinant adeno-associated virus is not less than 1×10⁻⁶. 12 VG / each.
5. The application according to claim 3, characterized in that, The method for constructing the recombinant adeno-associated virus vector involves cloning a fusion gene formed by the kozak sequence and the transferrin coding gene into a backbone vector. Xho I and Spe At the multiple cloning site; The backbone vector includes GPAAV-CMV-P2A-eGFP-WPRE.
6. The application according to claim 3 or 5, characterized in that, The nucleotide sequence of the gene encoding the transferrin is shown in SEQ ID NO:1.
Citation Information
Patent Citations
Transferrin marker and application thereof
CN107831315A