A method for removing rickettsia endosymbiont from a female line of trichogramma spp.

Abstract

The application provides a method for removing Rickettsia endosymbiont of Trichogramma to obtain a hermaphroditic strain, and belongs to the technical field of arthropod reproductive mode regulation, and the method comprises the following steps: feeding Trichogramma for continuous multiple generations with rifampicin to remove Rickettsia carried by Trichogramma, and obtaining a fertile hermaphroditic strain. The method can stably remove Rickettsia endosymbiont of parthenogenetic female Trichogramma by using the antibiotic rifampicin, and obtain a fertile hermaphroditic strain, which lays a foundation for further regulating arthropod reproduction by using Rickettsia and exploring the interaction between symbiotic bacteria and hosts. The method provides a practical path for studying the changes in biology, behavior and physiology of hosts before and after removing bacteria, and has good application value.

Description

Technical Field

[0001] This invention belongs to the field of arthropod reproductive pattern regulation technology, and specifically relates to a method for obtaining bisexual strains by removing the endosymbiotic bacterium Rickettsia from the flat-bellied wasp. Background Technology

[0002] Rickettsia, belonging to the α subgroup and family Rickettsiaceae of the class Proteobacteria, is a Gram-negative bacterium that is morphologically diverse and serves as a secondary endosymbiotic in eukaryotic cells. Rickettsia was first discovered in hemophagocytic arthropods and is widely known as a vertebrate pathogen. However, Rickettsia also exists in non-hemophagocytic arthropods, such as the whitefly *Bemisiata baci*, the aphid *Acyrthosi phonpisum*, and the wasp *Pnigalio soemius*, inducing parthenogenesis and male killing in its hosts. In addition, Rickettsia can serve as a nutritional symbiotic, enhance host drug resistance, and improve the host's ability to resist predators, high temperatures, or other lethal factors.

[0003] Previous studies have found that *Anastatus gansuensis* primarily produces females parthenogenetically indoors, and the offspring parasitizing eggs of *Caligula japonica* at different instars and *Antheraea pernyi* at different stages are all female. Field-collected *Anastatus gansuensis* were 100% infected with *Rickettsia*, leading the inventors to speculate that the reproductive pattern of *Anastatus gansuensis* is influenced by *Rickettsia*.

[0004] In practical production applications, female wasps are the primary agents for biological control. Indoor rearing of parthenogenetic strains is more cost-effective than hermaphroditic strains. Furthermore, when released into the field, parthenogenetic wasps are more likely to establish field populations, maximizing their biological control efficacy. Therefore, exploring how the symbiotic bacterium *Rickettsia* mediates the change in the reproductive mode of parasitic wasps and obtaining hermaphroditic strains without *Rickettsia* as a control is crucial. This will help to further improve the reproductive efficiency of other parasitic wasps through transfection and other methods, promoting better practice and development of biological pest control using natural enemy insects. Summary of the Invention

[0005] To obtain hermaphroditic strains of the flat-bellied wasp, this invention provides a method for removing the endosymbiotic bacterium Rickettsia from the flat-bellied wasp. This method utilizes the antibiotic rifampin to stably remove the endosymbiotic bacterium Rickettsia from the parthenogenetic flat-bellied wasp, obtaining fertile hermaphroditic strains. This lays the foundation for further utilizing Rickettsia to regulate arthropod reproductive methods and explore the interaction between endosymbiotic bacteria and the host. It also provides a practical path for studying the biological, behavioral, and physiological changes in the host before and after the removal of the bacterium, and has good application value.

[0006] This invention is achieved through the following technical solution:

[0007] This invention provides a method for obtaining a hermaphroditic strain by removing the symbiotic bacterium Rickettsia from the flat-bellied wasp. The method includes feeding the flat-bellied wasp with rifampicin for multiple generations to remove the Rickettsia carried by the flat-bellied wasp and obtain a fertile hermaphroditic strain.

[0008] Furthermore, the rifampicin concentration is 0.01–10.00 mg / mL, and the feeding time per generation is 24 ± 1 h.

[0009] Furthermore, the method specifically includes feeding the flat-bellied wasp with a fructose solution containing rifampin for seven consecutive generations to remove the Rickettsia carried by the flat-bellied wasp and obtain a fertile hermaphroditic strain.

[0010] Alternatively, the present invention provides a method for obtaining a hermaphroditic strain by removing the endosymbiotic bacterium *Rickettsia* from the flat-bellied wasp, the method comprising:

[0011] Female flat-bellied wasps infected with Rickettsia were collected as parent stock for breeding.

[0012] Rifampicin was fed to the parents and adult offspring, and the infection status and content of the symbiotic bacterium Rickettsia in each generation of adult bees were identified.

[0013] If the test results show that there is Rickettsia infection, continue to feed the next generation with rifampicin until all test results are negative. Then replace rifampicin with fructose solution for feeding. Continue for multiple generations, and at the same time, test the infection status and content of the symbiotic bacterium Rickettsia in each generation of adult bees.

[0014] If there is no Rickettsia symbiosis in three consecutive generations of adult bees, then the fourth generation without Rickettsia symbiosis is a flat-bellied bee strain that is not infected with Rickettsia.

[0015] From the uninfected Rickettsia wasp strain, select male and female wasps without mating experience and mate them. The offspring are the uninfected Rickettsia wasp bisexual strain.

[0016] Furthermore, the feeding of rifampicin to the parent and adult offspring specifically includes:

[0017] The parent and adult offspring were fed a rifampicin-fructose solution for 24±1h per generation, wherein the rifampicin concentration in the rifampicin-fructose solution was 0.01~10.00mg / mL.

[0018] Furthermore, the identification of the infection status and content of the endosymbiotic bacterium *Rickettsia* in each generation of adult bees specifically includes:

[0019] The infection status and content of the endosymbiotic bacterium Rickettsia in each generation of adult bees were identified by conventional PCR and quantitative PCR, respectively.

[0020] The primers used for conventional PCR are as follows:

[0021] gltA-F:5'-GCTCTTCTCATCCTATGGCTATTAT-3';

[0022] gltA-R:5'-CAGGGTCTTCGTGCATTTCTT-3';

[0023] The primers used for quantitative PCR are as follows:

[0024] glt375-F:5'-TGGTATTGCATCGCTTTGGG-3';

[0025] glt574-R:5'-TTTCTTTAAGCACTGCAGCACG-3'.

[0026] Furthermore, the identification of the infection status and content of the endosymbiotic bacterium *Rickettsia* in each generation of adult bees using conventional PCR and quantitative PCR specifically includes:

[0027] The infection status and content of the endosymbiotic bacterium Rickettsia in each generation of adult bees were identified by conventional PCR and quantitative PCR, respectively. The amplified products of conventional PCR were subjected to agarose gel electrophoresis. If the Rickettsia test was negative, it indicated that the bees were not infected with Rickettsia. The titer of quantitative PCR was analyzed. If the titer was 0 copies / mic, it further proved that the bees were not infected with Rickettsia.

[0028] Furthermore, if the test results show Rickettsia infection, continue feeding the next generation with rifampicin until all test results are negative. Then, replace rifampicin with fructose solution for multiple generations. Simultaneously, test the infection status and content of the symbiotic bacterium Rickettsia in each generation of adult bees, specifically including:

[0029] If the test results show that Rickettsia infection is present, continue to feed the next generation with rifampicin-fructose solution until all test results are negative. Then, replace the rifampicin-fructose solution with fructose solution for the next generation. Continue this process for multiple generations. At the same time, use conventional PCR and quantitative PCR to identify the infection status and content of the symbiotic bacterium Rickettsia in each generation of adult bees.

[0030] Based on the same inventive concept, the present invention provides a hermaphroditic strain of the flat-bellied wasp that does not contain the endosymbiotic bacterium Rickettsia. The hermaphroditic strain of the flat-bellied wasp is constructed by the above-mentioned method for removing the endosymbiotic bacterium Rickettsia from the flat-bellied wasp to obtain a hermaphroditic strain.

[0031] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:

[0032] 1. This invention discloses a method for obtaining hermaphroditic strains by removing the symbiotic bacterium Rickettsia from the wasp *Amanita muscaria*. This method is the first to discover that feeding *Amanita muscaria* with 0.01 mg / mL rifampicin for multiple generations can completely remove Rickettsia carried by *Amanita muscaria*. Feeding with 0.01 mg / mL rifampicin has no adverse effect on the reproduction of subsequent populations, and a hermaphroditic strain capable of normal mating and fertility is obtained. This lays the foundation for further utilizing Rickettsia to regulate arthropod reproductive methods and explore the interaction between symbiotic bacteria and hosts. It provides a practical path for studying the biological, behavioral, and physiological changes of the host before and after the removal of the bacterium, and promotes better practice and development of using natural enemy insects for biological pest control, thus having good application value.

[0033] 2. This invention discloses a method for obtaining hermaphroditic strains of the symbiotic bacterium Rickettsia in the wasp *Pterygospermum praecox*. The method involves continuously feeding *Pterygospermum praecox* infected with a low concentration of rifampicin for seven generations, selecting uninfected male and female wasps from this group, mating the uninfected wasps, and detecting the strains at F0, F1, F4, F6, F7, and F8 using conventional PCR and quantitative PCR. 11 F 15 and F 17The infection status of Rickettsia in three generations of flat-bellied wasps was tested to confirm the stability of Rickettsia and flat-bellied wasps, thereby establishing a Rickettsia-free flat-bellied wasp bisexual strain.

[0034] 3. This invention discloses a method for obtaining hermaphroditic strains of *Rickettsia* by removing the symbiotic bacterium within *Pterygospermum praecox*. The inventors first discovered that feeding *Pterygospermum praecox* with the antibiotic rifampicin can effectively remove *Rickettsia* and reverse the reproductive pattern of *Pterygospermum praecox*, changing it from parthenogenesis to male reproduction. However, feeding high concentrations of antibiotics is extremely harmful to the wasps, resulting in reduced emergence rate and increased mortality. This invention successfully removes the symbiotic bacterium *Rickettsia* from *Pterygospermum praecox* by feeding it with 0.01 mg / mL rifampicin for multiple generations. Combining molecular technology and biological verification, this invention achieves the transformation of *Pterygospermum praecox* from parthenogenesis to male reproduction. Because the antibiotic concentration is low per generation and the duration of continuous feeding is long, the toxic effects of antibiotic feeding on the host can be effectively avoided. This invention can establish stable and long-term hermaphroditic strains of *Pterygospermum praecox* uninfected with *Rickettsia*, achieving stable reproduction and propagation of *Pterygospermum praecox* uninfected with *Rickettsia*.

[0035] 4. This invention provides a method for obtaining hermaphroditic strains of the symbiotic bacterium Rickettsia in the endophyte of the flat-bellied wasp. This method is simple to operate, highly controllable, and involves direct feeding with a prepared rifampicin solution. The feeding time for each generation is short and controllable. The low concentration of antibiotics can greatly reduce the damage to the parasitic wasps. Obtaining hermaphroditic strains uninfected with Rickettsia is of great significance for studying the biological functions of the flat-bellied wasp, the wasp-bacterium interaction, and developing other new technologies for controlling pests using the symbiotic bacterium Rickettsia transfection. Attached Figure Description

[0036] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0037] Figure 1 A survival analysis diagram of Gansu flat-bellied wasp after feeding with different concentrations of rifampicin solution;

[0038] Figure 2 A graph showing the male birth rate of Gansu flat-bellied wasps after feeding them with different concentrations of rifampicin solution;

[0039] Figure 3The emergence rate of Gansu flat-bellied wasp after feeding with different concentrations of rifampicin solution is shown in the graph.

[0040] Figure 4 Figure showing the infection status of multiple generations of *Rickettsia gansuensis* after continuous treatment with rifampicin.

[0041] Figure 5 The titer changes of multiple generations of *Rickettsia gansuensis* after continuous treatment with rifampicin. Detailed Implementation

[0042] The present invention will be described in detail below with reference to specific embodiments and examples, thereby making the advantages and various effects of the present invention more clearly apparent. Those skilled in the art should understand that these specific embodiments and examples are for illustrative purposes only and are not intended to limit the present invention.

[0043] Throughout this specification, unless otherwise specified, the terminology used herein should be understood as having the meaning commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. In the event of any conflict, this specification shall prevail.

[0044] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be purchased from the market or prepared by existing methods.

[0045] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0046] The following will describe in detail a method for obtaining hermaphroditic strains of the present invention by removing the endosymbiotic bacterium Rickettsia from flat-bellied wasps, in conjunction with embodiments and experimental data.

[0047] Test insects

[0048] The parasitic wasp *Triplophysa gansuensis* used in the experiment was collected from walnut orchards in Gansu Province, China. The wasp was identified based on morphological characteristics and further confirmed by COI sequencing (GenBank: MK373759). *Triplophysa gansuensis* wasp were reared with tussah silkworm eggs, and the parasitized silkworm eggs were placed in a culture room for emergence. 16S third-generation full-length sequencing showed that this wasp was severely infected only by *Rickettsia*, an existing induced parthenogenetic organism.

[0049] Example 1

[0050] This embodiment provides a method for obtaining hermaphroditic strains by removing the endosymbiotic bacterium Rickettsia from flat-bellied wasps.

[0051] I. Experimental Methods

[0052] 1. Collection of *Rickettsia* strains infected by *Aegilops scutellatus* in Gansu:

[0053] The parasitic wasps collected from the wild were first identified as *Rickettsia gansuensis* species by morphological and molecular biological methods, and then subjected to *Rickettsia* universal primer sequencing to determine the infection status.

[0054] Collect the adult bees into plastic jars (12.5*6.5cm) using a fine brush. Cover the jar opening with a piece of white cloth cut to the appropriate size and secure it with a rubber band. Each jar contains 20 female bees. Apply 30% honey water to the jar walls with a small brush, being careful not to let the parasitizing bees stick to the cloth. Then place the jars in a cultivation greenhouse under constant conditions of (24±1)℃, (70±5)% humidity, and a light-dark ratio of 14:10. After about 5 days, introduce 300 tussah silkworm eggs for parasitism to breed the next generation (F0).

[0055] Adults infected with 100% Rickettsia were used as parent adults (F0).

[0056] 2. Feeding with rifampicin solutions of different concentrations:

[0057] Rifampicin powder was mixed with 1 mol / L fructose water to prepare rifampicin solutions of 0.01, 0.05, 0.10, 1.00, and 10.00 mg / mL, respectively, which were then stored in centrifuge tubes for later use.

[0058] 3. Screening for a suitable rifampicin solution concentration:

[0059] Select small wasps to form a container (12.5*6.5cm). Carefully brush antibiotic fructose solution onto the container wall with a small brush to form small water droplets in the form of a mist. Feed the wasps once every 24 hours. Each concentration of antibiotic fructose solution was fed for 1, 3, 5, 7, 10, 15 and 20 days. The number of dead wasps was recorded daily during this period to facilitate survival analysis.

[0060] Remove a single juvenile wasp that has been fed for a certain number of days and place it in a glass tube (1.5*10cm). Feed it with a sufficient concentration of antibiotic fructose solution and provide fresh tussah silkworm egg cards for parasitism. After 24 hours of parasitism, remove the wasp and record the male emergence rate and eclosion rate of the offspring when fed the corresponding concentration of antibiotic fructose solution. This helps to eliminate antibiotic concentrations that have a significant impact on the eclosion of juvenile wasps.

[0061] The control group was fed the same conditions as the experimental group except that it was fed fructose water without antibiotics.

[0062] The survival rate, male emergence rate, and eclosion rate of each group of wasps were statistically analyzed. The experimental results are as follows: Figure 1 , 23. The results showed that low concentrations of rifampicin solution could achieve 100% male offspring, and the mortality rate was not significantly different from the control.

[0063] 4. Obtaining the uninfected Rickettsia strain:

[0064] Newly emerged infected *Rickettsia gansuensis* (F0) was selected, and each was placed individually in a glass tube (1.5*10cm). A 0.01mg / mL rifampicin-fructose aqueous solution was brushed onto the tube wall with a small brush. After feeding for 24 hours, silkworm eggs were introduced for parasitism. After 24 hours of parasitism, the female wasps were removed.

[0065] If all offspring are female, then continue to breed the next generation; if the offspring are both male and female, then pair them up.

[0066] Each generation is tested for Rickettsia infection. If the females and males in the offspring can mate and Rickettsia is not detected in the females, antibiotics are immediately stopped and the next generation is fed with fructose solution. If Rickettsia is not detected in the offspring for three consecutive generations, it proves that a male-female strain of Gansu flat-bellied wasp that is not infected with Rickettsia has been obtained.

[0067] Alternatively, the following method can be used:

[0068] Each generation was tested for Rickettsia infection. If the test results showed Rickettsia infection, the next generation was fed with rifampicin-fructose solution until all test results were negative. Then, the rifampicin-fructose solution was replaced with fructose solution for the next generation. This process was repeated for multiple generations. The infection status and content of the symbiotic bacterium Rickettsia in each generation of adult bees were identified using both conventional PCR and quantitative PCR. When there was no Rickettsia symbiosis in adult bees for three consecutive generations, the fourth generation without Rickettsia symbiosis was identified as the Rickettsia-free flat-bellied bee strain.

[0069] From the flat-bellied wasp strain that has never been infected with Rickettsia, select male and female wasps that have never mated and mate them. The offspring are the flat-bellied wasp bisexual strain that has never been infected with Rickettsia.

[0070] (1) Detection of Rickettsia infection in Gansu flat-bellied wasp by conventional PCR:

[0071] For routine PCR detection of the symbiotic bacterium Rickettsia, DNA was extracted from Gansu flat-bellied wasp using a kit (TIANamp Genomic DNA kit). For specific operating procedures, please refer to the instruction manual.

[0072] PCR detection of infection status in *Rickettsia gansuensis* was performed using a pair of primers targeting the *gltA* gene sequence: *gltA-F* and *gltA-R*. The sequences are as follows:

[0073] gltA-F: 5'-GCTCTTCTCATCCTATGGCTATTAT-3'

[0074] gltA-R:5'-CAGGGTCTTCGTGCATTTCTT-3'

[0075] Reaction system:

[0076]

[0077]

[0078] Total volume 25μL

[0079] Amplification conditions:

[0080] Pre-denaturation at 94℃ for 5 min; denaturation at 94℃ for 30 s, annealing at 53.7℃ for 30 s, extension at 72℃ for 30 s, 35 cycles; extension at 72℃ for 10 min, 4℃ cycle.

[0081] The PCR products were detected by 1.5% agarose gel electrophoresis, with a 2kb marker as a control. 5 μL of PCR product and marker were added to a 1.5% agarose gel and immediately placed in 1×TAE buffer for electrophoresis. The electrophoresis conditions were 120V and 20min.

[0082] The gel imaging system is used to photograph the gel, and the results are obtained by saving the images, such as the band diagram. Figure 4 Show.

[0083] (2) Determination of Rickettsia titer:

[0084] To determine the abundance of *Rickettsia* in *Gansu flat-bellied wasp*, the following methods were used: Ex Taq TM (Takara) and Bio-Rad CFX96 TM The measurement was performed using a Real-Time System (BioRad).

[0085] After obtaining the gltA gene gel using the above method, the following steps were performed: gel recovery and purification of DNA fragments, ligation of the target gene and vector, heat shock transformation of Escherichia coli competent cells, screening of positive clones and sequencing, and plasmid extraction. All steps were performed according to the kit instructions.

[0086] Quantitative PCR detection of Rickettsia titer

[0087] A standard curve was plotted using the extracted standard plasmid samples, with concentrations of 10... 4 10 5 10 6 10 7 and 10 8 Number of gene copies / mic.

[0088] The primer sequence is: glt375-F: 5′-TGGTATTGCATCGCTTTGGG-3′

[0089] glt574-R 5′-TTTCTTTAAGCACTGCAGCACG-3′.

[0090] Samples of each generation of wasps treated with the above-mentioned 0.01 mg / mL rifampicin-fructose aqueous solution were subjected to surface disinfection (75% alcohol for 1 min, 2% NaClO for 30 s, ddH2O three times, 3 min each time, all operations were performed in a clean bench). After DNA extraction, the abundance of Rickettsia in wasps under different treatments was determined by absolute quantification.

[0091] reaction system

[0092]

[0093]

[0094] The primer sequences are:

[0095] glt375-F:5′-TGGTATTGCATCGCTTTGGG-3′

[0096] glt574-R 5′-TTTCTTTAAGCACTGCAGCACG-3′.

[0097] Total volume 20μL

[0098] Amplification conditions:

[0099] Pre-denaturation at 95℃ for 30 seconds; denaturation at 95℃ for 5 seconds, extension at 60℃ for 30 seconds, 40 cycles; denaturation at 95℃ for 10 seconds; melting curve from 65℃ to 95℃. Temperature increased by 0.5℃ every 5 seconds.

[0100] (3) Biological verification: The Gansu flat-bellied wasp strain that could not be detected by Rickettsia for three consecutive generations was verified. If the female wasps that did not mate only produced male offspring, while the female wasps that mated produced both male and female offspring, it would indicate that the Gansu flat-bellied wasp bisexual strain that was not infected with Rickettsia had been obtained.

[0101] II. Experimental Results

[0102] 1. Effects of different concentrations of rifampin on the mortality rate of pygmy wasps

[0103] Figure 1 (L: represents rifampicin, ***p<0.001) This is a survival analysis of *Triplophysa gansuensis* fed with different rifampicin concentrations. As shown in the figure, compared with the control, high concentrations of rifampicin solution (1.00, 10.00 mg / mL) had a significant toxic effect on *Triplophysa gansuensis*, while the three low concentrations of rifampicin solution (0.01, 0.05, 0.10 mg / mL) had no significant effect on the mortality rate of *Triplophysa gansuensis*.

[0104] 2. Effects of different concentrations of rifampin on male emergence rate and eclosion rate of hornets.

[0105] Figure 2 and Figure 3 To analyze the male emergence rate and emergence rate of *Pegasus gansuensis* fed with different concentrations of rifampicin, only the male emergence rate and emergence rate of *Pegasus gansuensis* fed with concentrations of 0.01, 0.05, and 0.10 mg / mL were analyzed because 1.00 mg / mL and 10.00 mg / mL have significant toxic effects on the wasps.

[0106] In terms of male birth rate, such as Figure 2 As shown, after feeding with the three antibiotic concentrations for 10 days, the offspring masculinization rate increased significantly, reaching about 60%, with no significant difference among the three concentrations; after feeding for about 15 days, the offspring masculinization rate reached over 80%, with no significant difference among the three concentrations; after feeding for about 20 days, the offspring masculinization rate could reach 100%, with no significant difference among the three concentrations.

[0107] In terms of feathering rate, such as Figure 3 As shown, when fed with the three antibiotic concentrations within 5 days, the eclosion rate of the offspring reached 100%, and there was no significant difference between the three concentrations and the control. On the 7th, 10th, 15th and 20th days of feeding, the eclosion rate of the offspring was not significantly different from the control except for the 0.10 mg / mL concentration.

[0108] In summary, a rifampicin solution with a concentration of 0.01 mg / mL is the preferred choice for feeding.

[0109] 3. Obtaining the uninfected Rickettsia strain

[0110] (1) Analysis of the infection status of *Rickettsia* in antibiotic-treated *Pteris gansuensis* through successive generations of verification

[0111] Figure 4 The experiment used band diagrams to observe the changes in the titer of the endosymbiotic bacterium *Rickettsia* during multiple generations of treatment with *Pterygospermum gansuense*. The presence of a band indicated host infection with *Rickettsia*, while the absence of a band indicated host non-infection. As shown in the figure, compared to the control (CK), *Rickettsia* bands were detectable in samples from generations F0, F1, and F4. However, no bright bands were detected in generation F7. Subsequently, the offspring were continuously fed an antibiotic-free fructose solution, and mating was encouraged. Even after multiple generations, *Rickettsia* bands remained undetectable.

[0112] (2) Generation-wise validation of titer analysis of *Rickettsia* infected with antibiotic-treated *Pteris gansuensis*

[0113] Figure 5 The figure shows the titer analysis of the symbiotic bacterium Rickettsia in the Gansu flat-bellied wasp after continuous treatment for several generations during the experiment. As can be seen from the figure, compared with the control (CK), the parent generation (F0) was 100% infected with Rickettsia. The titer of Rickettsia infection gradually decreased from the first generation of F1. By the sixth generation of F6, the Rickettsia titer was significantly reduced, until the titer of F7 was about 0 copies / mic. Then, after continuous feeding with antibiotic-free fructose aqueous solution, the titer of the offspring remained at about 0 copies / mic for many generations.

[0114] (3) Biologically validated hermaphroditic strains

[0115] After antibiotic administration, the sex ratio of offspring was observed. If both male and female offspring were present, they were paired. Mating began to occur in the F4 generation. The presence of Rickettsia infection was verified in the F7 generation, by which time it had been completely eradicated. Biological verification was performed in the F8 generation, revealing that mated females (fertilized) produced both male and female offspring; unmated females (unfertilized) produced only male offspring. Subsequently, starting with the F8 generation, antibiotics were discontinued, and fructose water was fed instead. Figure 4As can be seen, the Rickettsia band was not detected in subsequent offspring after antibiotic feeding was stopped. Furthermore, the male offspring of the parthenogenetic and hermaphroditic strains were statistically analyzed, as shown in Table 6. The parthenogenetic strain produced only female offspring with a male ratio of 0 and a replicate number of 20; while the hermaphroditic strain produced both male and female offspring, with a male ratio of 40.65% and a replicate number of 20. Therefore, a stable, hermaphroditic strain of the Gansu flat-bellied wasp, free from Rickettsia infection, was obtained.

[0116] Table 6. Male ratio of offspring from parthenogenetic strains and hermaphroditic strains after mating

[0117]

[0118] Finally, it should be noted that the terms “comprising,” “including,” or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such process, method, article, or apparatus.

[0119] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including both the preferred embodiments and all changes and modifications falling within the scope of the invention.

[0120] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. A method for removing symbiotic bacteria from flat-bellied wasps Rickettsia A method for obtaining bisexual strains, characterized in that, The method includes feeding rifampicin to the flat-bellied wasp for multiple generations to remove the carcinogens carried by the wasp. Rickettsia To obtain fertile hermaphroditic strains; Among these measures, the method involves feeding the flat-bellied wasp with rifampin for multiple generations to remove the carcinogens carried by the wasp. Rickettsia To obtain fertile bisexual strains, specifically including: Collecting Infections Rickettsia The flat-bellied female wasps were used as parent plants for breeding; Rifampicin was fed to both parent bees and adult offspring, and symbiotic bacteria in each generation of adult bees were identified. Rickettsia The infection status and its content; If the identification results show that there is Rickettsia If infection occurs, continue feeding the next generation with rifampicin until all test results are negative. Then, replace rifampicin with fructose solution and continue feeding for multiple generations, while simultaneously identifying the symbiotic bacteria in each generation of adult bees. Rickettsia The infection status and its content; When there are no [specific insects] in three consecutive generations of adult bees Rickettsia Symbiosis, therefore nothing Rickettsia The fourth generation of symbiotic organisms is the uninfected. Rickettsia Flat-bellied wasp strain; From the stated uninfected Rickettsia From the flat-bellied wasp strain, unmated male and female wasps were selected for mating, and the offspring were considered uninfected. Rickettsia The two-sex strain of the flat-bellied wasp; The rifampicin concentration was 0.01–0.1 mg / mL, and the feeding time was 24 ± 1 h per generation.

2. The method for removing symbiotic bacteria from flat-bellied wasps according to claim 1. Rickettsia A method for obtaining bisexual strains, characterized in that, The flat-bellied wasp was fed rifampicin for seven consecutive generations. The rifampicin was a fructose solution containing rifampicin.

3. The method for removing symbiotic bacteria from flat-bellied wasps according to claim 1. Rickettsia A method for obtaining bisexual strains, characterized in that, The feeding of rifampicin to the parent and offspring adults specifically includes: Feed the parent and adult offspring with a rifampicin fructose solution for 24±1 h per generation.

4. The method for removing symbiotic bacteria from flat-bellied wasps according to claim 1 Rickettsia A method for obtaining bisexual strains, characterized in that, The identification of symbiotic bacteria in each generation of adult bees Rickettsia The infection status and its content, specifically including: The endosymbiotic bacteria of each generation of adult bees were identified using conventional PCR and quantitative PCR, respectively. Rickettsia The infection status and its content; The primers used for conventional PCR are as follows: gltA -F: 5'-GCTCTTCTCATCCTATGGCTATTAT-3'; gltA -R: 5'- CAGGGTCTTCGTGCATTTCTT -3'; The primers used for quantitative PCR are as follows: glt375 -F: 5'- TGGTATTGCATCGCTTTGGG -3'; glt574 -R: 5'- TTTCTTTAAGCACTGCAGCACG -3'。 5. A method for removing symbiotic bacteria from flat-bellied wasps according to claim 1. Rickettsia A method for obtaining bisexual strains, characterized in that, If the identification result shows that there is Rickettsia If infection occurs, continue feeding the next generation with rifampicin until all test results are negative. Then, replace rifampicin with fructose solution and continue feeding for multiple generations, while simultaneously identifying the symbiotic bacteria in each generation of adult bees. Rickettsia The infection status and its content, specifically including: If the identification results show that there is Rickettsia If infection is detected, continue feeding the next generation with rifampicin-fructose solution until all test results are negative. Then, replace the rifampicin-fructose solution with fructose solution for the next generation, continuing this process for multiple generations. Simultaneously, use both conventional PCR and quantitative PCR to identify the endosymbiotic bacteria in each generation of adult bees. Rickettsia The infection status and content of [the substance].

Images