Fusion proteins and their use in discriminating between bcg vaccine immunization and natural infection with mycobacterium tuberculosis

CN119431607BActive Publication Date: 2026-09-22TECON BIOPHARMACEUTICAL CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411688582.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-25
Publication Date
2026-09-22
Estimated Expiration
2044-11-25

AI Technical Summary

Technical Problem

两种方法均使用到结核菌素纯化蛋白衍生物(PPD),PPD由分枝杆菌培养物灭活提纯得到,成分复杂,其特异性易受交叉反应影响,经常造成诊断结果的假阳性,给生产带来一些不必要的损失

Benefits of technology

[0031]本发明使用免疫信息学软件对ESAT6、CFP10和Rv3615c蛋白进行抗原位点预测,将所得的抗原位点进行融合,获得融合蛋白。该融合蛋白的抗原特异性高,能够通过皮试检测、ELISA检测或者体外IFN-γ检测的方式实现对BCG疫苗免疫和自然感染结核分枝杆菌的鉴别,且检测的敏感度和特异性高。此外,通过将所得的抗原位点进行重复融合,能够显著提升融合蛋白的敏感性。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005150285430000151
    Figure BDA0005150285430000151
  • Figure BDA0005150285430000161
    Figure BDA0005150285430000161
  • Figure BDA0005150285430000162
    Figure BDA0005150285430000162
Patent Text Reader

Abstract

The application provides a fusion protein and application thereof in identification of BCG vaccine immunization and natural infection of Mycobacterium tuberculosis, and relates to the technical field of biotechnology.The fusion protein provided by the application comprises an Rv3615c-1 fragment and an Rv3615c-2 fragment.The fusion protein has high antigen specificity, and can realize identification of BCG vaccine immunization and natural infection of Mycobacterium tuberculosis in a manner of skin test detection, ELISA detection or in-vitro IFN-gamma detection, and has high sensitivity and specificity in detection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a fusion protein and its application in identifying BCG vaccine-immunized and naturally infected Mycobacterium tuberculosis. Background Technology

[0002] Bovine tuberculosis (TB) is a chronic bacterial disease primarily caused by Mycobacterium bovis infecting cattle. It can also infect humans and other animals, causing corresponding illnesses. It is listed as a notifiable animal disease by the World Organisation for Veterinary Medicine (OIE). TB directly impacts cattle productivity and international trade in their products, causing significant economic losses. Furthermore, as an important zoonotic disease, it poses a major threat to public health. Therefore, effective prevention and detection of bovine TB are of significant economic and social importance.

[0003] Given that the body's immune response in the early stages of mycobacterial infection is primarily cellular immunity, bovine tuberculosis (TB) detection mainly relies on cell-based immune responses, including the tuberculin skin test (TST) and antigen-specific interferon-gamma (IFN-γ) assays. TST is the OIE-designated and most widely used method for TB detection, but its sensitivity and specificity are limited. The IFN-γ assay primarily detects the level of IFN-γ produced in whole blood after in vitro stimulation with a specific antigen, but it is mainly used as an adjunct to TST. Both methods utilize purified tuberculin protein derivatives (PPDs), which are obtained by inactivating and purifying mycobacterial cultures. PPDs have complex compositions, and their specificity is easily affected by cross-reactivity, frequently resulting in false positives and causing unnecessary losses in production. Furthermore, BCG vaccination can interfere with TB diagnosis, making it difficult to distinguish between vaccine-immunized and naturally occurring infections using the aforementioned methods. This severely hinders quarantine measures, making it difficult to eliminate the epidemic situation caused by pathogen spread, and rendering bovine TB control time-consuming, labor-intensive, and extremely challenging. Therefore, exploring specific and sensitive detection antigens is of great significance for controlling bovine tuberculosis.

[0004] In view of this, the present invention is hereby proposed. Summary of the Invention

[0005] The primary objective of this invention is to provide a fusion protein with high antigen specificity, which can be used for the identification of BCG vaccine immunization and natural infection with Mycobacterium tuberculosis with high accuracy, thereby solving the aforementioned problems.

[0006] A second objective of this invention is to provide a biomaterial.

[0007] A third objective of this invention is to provide the application of the above-mentioned fusion protein in identifying BCG vaccine-immunized and naturally infected Mycobacterium tuberculosis.

[0008] A fourth objective of this invention is to provide a reagent.

[0009] The fifth objective of this invention is to provide an ELISA kit.

[0010] To achieve the above objectives, the following technical solution is adopted:

[0011] In a first aspect, the present invention provides a fusion protein comprising an Rv3615c-1 fragment and an Rv3615c-2 fragment;

[0012] The amino acid sequence of the Rv3615c-1 fragment is as shown in SEQ ID NO.5 or a sequence having at least 90% homology with that sequence; the amino acid sequence of the Rv3615c-2 fragment is as shown in SEQ ID NO.6 or a sequence having at least 90% homology with that sequence.

[0013] As a further technical solution, the fusion protein comprises at least one repeating unit, and adjacent repeating units are connected by a linker peptide;

[0014] The repeating unit mainly consists of ESAT6-1 fragment, ESAT6-2 fragment, CFP10-1 fragment, CFP10-2 fragment, Rv3615c-1 fragment and Rv3615c-2 fragment, and adjacent fragments are connected by linking peptides.

[0015] The amino acid sequence of the ESAT6-1 fragment is as shown in SEQ ID NO.1 or a sequence that has at least 90% homology with that sequence;

[0016] The amino acid sequence of the ESAT6-2 fragment is as shown in SEQ ID NO.2 or a sequence that has at least 90% homology with that sequence;

[0017] The amino acid sequence of the CFP10-1 fragment is shown in SEQ ID NO.3 or a sequence that has at least 90% homology with that sequence;

[0018] The amino acid sequence of the CFP10-2 fragment is shown in SEQ ID NO.4 or a sequence that has at least 90% homology with that sequence.

[0019] As a further technical solution, the repeating unit is composed of ESAT6-1 fragment, ESAT6-2 fragment, CFP10-1 fragment, CFP10-2 fragment, Rv3615c-1 fragment and Rv3615c-2 fragment connected in series from the N-terminus to the C-terminus, with adjacent fragments connected by linking peptides.

[0020] As a further technical solution, the amino acid sequence of the linker peptide is GGAGGG.

[0021] As a further technical solution, the fusion protein comprises two repeating units.

[0022] Secondly, the present invention provides a biomaterial selected from any one of the following:

[0023] a. Nucleotides, said nucleotides comprising a nucleotide sequence encoding the fusion protein;

[0024] b. A carrier carrying the nucleotides in a;

[0025] c. A cell that carries the nucleotides in a, or contains the vector in b, or expresses the fusion protein.

[0026] As a further technical solution, the nucleotide sequence of the nucleotide is shown in SEQ ID NO.7.

[0027] Thirdly, the present invention provides the application of the above-mentioned fusion protein in identifying BCG vaccine-immunized and naturally infected Mycobacterium tuberculosis.

[0028] Fourthly, the present invention provides a reagent comprising the fusion protein described above.

[0029] Fifthly, the present invention provides an ELISA kit comprising the aforementioned fusion protein, an enzyme-labeled plate, a washing solution, and a fluorescently labeled anti-bovine IgM antibody or a fluorescently labeled anti-bovine IgG antibody; preferably, the fluorescent label is CY5 or CY3.

[0030] Compared with the prior art, the present invention has the following beneficial effects:

[0031] This invention uses immunoinformatics software to predict antigenic sites of ESAT6, CFP10, and Rv3615c proteins, and then fuses the obtained antigenic sites to obtain a fusion protein. This fusion protein exhibits high antigen specificity and can differentiate between BCG vaccine-immunized and naturally infected Mycobacterium tuberculosis through skin test, ELISA, or in vitro IFN-γ detection, with high sensitivity and specificity. Furthermore, repeated fusion of the obtained antigenic sites significantly enhances the sensitivity of the fusion protein. Detailed Implementation

[0032] The embodiments and examples of the present invention will be described in detail below. However, those skilled in the art will understand that the following embodiments and examples are for illustrative purposes only and should not be considered as limiting the scope of the present invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention. Unless otherwise specified, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.

[0033] In a first aspect, the present invention provides a fusion protein comprising an Rv3615c-1 fragment and an Rv3615c-2 fragment;

[0034] The amino acid sequence of the Rv3615c-1 fragment is as shown in SEQ ID NO.5 or a sequence having at least 90% homology with that sequence; the amino acid sequence of the Rv3615c-2 fragment is as shown in SEQ ID NO.6 or a sequence having at least 90% homology with that sequence.

[0035] The sequence shown in SEQ ID NO.5 is as follows:

[0036] TVQPERLGVLASHHDNAAVD(SEQ ID NO.5);

[0037] The sequence shown in SEQ ID NO.6 is as follows:

[0038] RIAAKIYSEADEAWRKAIDG (SEQ ID NO. 6).

[0039] This invention uses immunoinformatics software to predict antigenic sites in the Rv3615c protein, and then fuses the obtained antigenic sites to obtain a fusion protein. This fusion protein exhibits high antigen specificity and can differentiate between BCG vaccine-immunized and naturally infected Mycobacterium tuberculosis through skin tests, ELISA, or in vitro IFN-γ detection, with high sensitivity and specificity. Furthermore, repeated fusion of the obtained antigenic sites significantly enhances the sensitivity of the fusion protein.

[0040] In some alternative embodiments, the Rv3615c-1 fragment and the Rv3615c-2 fragment are linked by a linker peptide.

[0041] In some alternative embodiments, the fusion protein comprises at least one repeating unit, with adjacent repeating units linked by a linker peptide;

[0042] The repeating unit comprises an Rv3615c-1 fragment and an Rv3615c-2 fragment, with adjacent fragments linked by a linker peptide.

[0043] The inventors discovered that when the number of repeating units of the fusion protein is 1-3, it can effectively distinguish between cattle immunized with BCG vaccine and naturally infected cattle.

[0044] In some alternative embodiments, the fusion protein comprises at least one repeating unit, with adjacent repeating units linked by a linker peptide;

[0045] The repeating unit mainly consists of ESAT6-1 fragment, ESAT6-2 fragment, CFP10-1 fragment, CFP10-2 fragment, Rv3615c-1 fragment and Rv3615c-2 fragment, and adjacent fragments are connected by linking peptides.

[0046] The amino acid sequence of the ESAT6-1 fragment is shown in SEQ ID NO.1 or a sequence with at least 90% homology to it; the sequence shown in SEQ ID NO.1 is as follows:

[0047] SLLDEGKQSLTKLAAAWGGSGSEAY(SEQ ID NO.1);

[0048] The amino acid sequence of the ESAT6-2 fragment is shown in SEQ ID NO.2 or a sequence with at least 90% homology to it; the sequence shown in SEQ ID NO.2 is as follows:

[0049] SGSEAYQGVQQKWDATATEL(SEQ ID NO.2);

[0050] The amino acid sequence of the CFP10-1 fragment is shown in SEQ ID NO.3 or a sequence with at least 90% homology to this sequence; the sequence shown in SEQ ID NO.3 is as follows:

[0051] LAQEAGNFERISGDLKTQID(SEQ ID NO.3);

[0052] The amino acid sequence of the CFP10-2 fragment is shown in SEQ ID NO.4 or a sequence with at least 90% homology to it. The sequence shown in SEQ ID NO.4 is as follows:

[0053] VQYSRADEEQQQALSSQMGF(SEQ ID NO.4);

[0054] This invention also predicts antigenic sites for ESAT6 and CFP10 proteins, and fuses the obtained antigenic sites with the Rv3615c antigenic site to obtain a fusion protein. This fusion protein exhibits high antigenic specificity and can differentiate between BCG vaccine-immunized and naturally infected Mycobacterium tuberculosis via skin test, ELISA, or in vitro IFN-γ detection, with high sensitivity and specificity. Furthermore, repeated fusion of the obtained antigenic sites significantly enhances the sensitivity of the fusion protein.

[0055] In some alternative embodiments, the repeating unit is composed of ESAT6-1 fragment, ESAT6-2 fragment, CFP10-1 fragment, CFP10-2 fragment, Rv3615c-1 fragment and Rv3615c-2 fragment connected in series from the N-terminus to the C-terminus, with adjacent fragments linked by linker peptides.

[0056] The inventors discovered that fusion proteins with different sequences of fragments (ESAT6-1, ESAT6-2, CFP10-1, CFP10-2, Rv3615c-1, and Rv3615c-2) can effectively distinguish between cattle immunized with BCG vaccine and naturally infected cattle. Among them, the fusion protein composed of ESAT6-1, ESAT6-2, CFP10-1, CFP10-2, Rv3615c-1, and Rv3615c-2 fragments in series has the best detection sensitivity and specificity.

[0057] In some alternative embodiments, the amino acid sequence of the linker peptide is GGAGGG.

[0058] In some alternative implementations, the fusion protein comprises two repeating units.

[0059] The inventors discovered that when the number of repeating units in the fusion protein is 1-3, it can effectively distinguish between cattle immunized with BCG vaccine and naturally infected cattle, and the sensitivity and specificity of the detection are best when the number of repeating units is 2.

[0060] In some alternative embodiments, the composition of the fusion protein from the N-terminus to the C-terminus is as follows:

[0061] ESAT6-1+linker+ESAT6-2+linker+CFP10-1+linker+CFP10-2+linker+Rv3615c-1+linker+Rv3615c-2+lin ker+ESAT6-1+linker+ESAT6-2+linker+CFP10-1+linker+CFP10-2+linker+Rv3615c-1+linker+Rv3615c-2.

[0062] This fusion protein has high antigen specificity, making it more sensitive and specific for BCG vaccine immunization and identification of naturally infected Mycobacterium tuberculosis.

[0063] Secondly, the present invention provides a biomaterial selected from any one of the following:

[0064] a. Nucleotides, said nucleotides comprising a nucleotide sequence encoding the fusion protein;

[0065] b. A carrier carrying the nucleotides in a;

[0066] c. A cell that carries the nucleotides in a, or contains the vector in b, or expresses the fusion protein.

[0067] In some alternative embodiments, the nucleotide sequence of the nucleotide is as shown in SEQ ID NO. 8:

[0068] TCCCTCCTTGACGAGGGGAAGCAGTCCCTGACCAAGCTCGCAGCGGCCTGGGGCGGTAGCGGTTCGGAGGCGTACGGAGGGAGCGGTTCGGAGGCGTACCAGGGTGTCCAGCAAAAATGGGACGCCACGGCTACCGAGCTGGGAGGGCTCGCGCAGGAGGCAGGTAATTTCGAGCGGATCTCCGGCGACCTGAAAACCCAGATCGACGGAGGGGTCCAATACTCGAGGGCCGACGAGGAGCAGCAGCAGGCGCTGTCCTCGCAAATGGGCTTCGGAGGGACCGTCCAGCCCGAGCGTCTCGGTGTACTGGCGTCGCACCATGACAACGCGGCGGTCGATGGAGGGCGAATTGCGGCGAAGATATATAGCGAGGCCGACGAAGCGTGGCGCAAGGCTATCGACGGGGGAGGGTCCCTCCTTGACGAGGGGAAGCAGTCCCTGACCAAGCTCGCAGCGGCCTGGGGCGGTAGCGGTTCGGAGGCGTACGGAGGGAGCGGTTCGGAGGCGTACCAGGGTGTCCAGCAAAAATGGGACGCCACGGCTACCGAGCTGGGAGGGCTCGCGCAGGAGGCAGGTAATTTCGAGCGGATCTCCGGCGACCTGAAAACCCAGATCGACGGAGGGGTCCAATACTCGAGGGCCGACGAGGAGCAGCAGCAGGCGCTGTCCTCGCAAATGGGCTTCGGAGGGACCGTCCAGCCCGAGCGTCTCGGTGTACTGGCGTCGCACCATGACAACGCGGCGGTCGATGGAGGGCGAATTGCGGCGAAGATATATAGCGAGGCCGACGAAGCGTGGCGCAAGGCTATCGACGGG(SEQ ID NO. 8).

[0069] In some alternative embodiments, the nucleotide sequence of said nucleotide is shown as SEQ ID NO. 7:

[0070] (SEQ ID NO.7).

[0071] This sequence was obtained by optimizing the nucleic acid sequence using cattle as the host.

[0072] Thirdly, the present invention provides the application of the above-mentioned fusion protein in identifying BCG vaccine-immunized and naturally infected Mycobacterium tuberculosis.

[0073] The fusion protein provided by this invention has high antigen specificity and can be used to distinguish between BCG vaccine-immunized and naturally infected Mycobacterium tuberculosis by skin test, ELISA or in vitro IFN-γ detection, with high sensitivity and specificity.

[0074] Fourthly, the present invention provides a reagent comprising the fusion protein described above.

[0075] This reagent can be used for skin test detection, and the results of the skin test can distinguish between BCG vaccine immunity and natural infection with Mycobacterium tuberculosis.

[0076] Fifthly, the present invention provides an ELISA kit comprising the aforementioned fusion protein, an enzyme-labeled plate, a washing solution, and a fluorescently labeled anti-bovine IgM antibody or a fluorescently labeled anti-bovine IgG antibody.

[0077] This kit uses the fusion protein provided by this invention to coat an ELISA plate, and uses fluorescently labeled anti-bovine IgM antibody or fluorescently labeled anti-bovine IgG antibody as a secondary antibody for the identification of BCG vaccine immunization and natural infection with Mycobacterium tuberculosis.

[0078] In some alternative embodiments, the fluorescent marker includes, but is not limited to, CY5 or CY3, or other markers well known to those skilled in the art.

[0079] The present invention will be further illustrated below with specific embodiments. However, it should be understood that these embodiments are merely for the purpose of more detailed illustration and should not be construed as limiting the present invention in any way.

[0080] Example 1

[0081] 1. Antigen site selection

[0082] Six optimized antigen sites (ESAT6, CFP10, and Rv3615c) were selected through preliminary experiments, namely:

[0083] ESAT6-1:SLLDEGKQSLTKLAAAWGGSGSEAY(SEQ ID NO.1);

[0084] ESAT6-2:SGSEAYQGVQQKWDATATEL(SEQ ID NO.2);

[0085] CFP10-1:LAQEAGNFERISGDLKTQID(SEQ ID NO.3);

[0086] CFP10-2: VQYSRADEEQQQALSSQMGF (SEQ ID NO.4);

[0087] Rv3615c-1: TVQPERLGVLASHHDNAAVD (SEQ ID NO.5);

[0088] Rv3615c-2: RIAAKIYSEADEAWRKAIDG (SEQ ID NO. 6).

[0089] 2. Antigen sequence optimization

[0090] The three proteins were combined using a tandem expression approach, specifically: ESAT6-1+linker+ESAT6-2+linker+CFP10-1+linker+CFP10-2+linker+Rv3615c-1+linker+Rv3615c-2+linker+ESAT6-1+linker+ESAT6-2+linker+CFP10-1+linker+CFP10-2+linker+Rv3615c-1+linker+Rv3615c-2. The amino acid sequence of the linker is GGAGGG (SEQ ID NO.16).

[0091] Nucleic acid sequence optimization was performed using cattle as the host. The optimized sequence is as follows:

[0092] TCCTTGCTCGACGAAGGCAAGCAATCCCTTACTAAATTGGCCGCGGCATGGGGGGGGAGTGGCAGCGAAGCCTACGGGGGCTCAGGATCCGAGGCTTACCAAGGGGTCCAGCAGAAGTGGGATGCAACCGCCACGGAGCTGGGCGGTTTGGCTCAAGAGGCCGGTAACTTTGAGCGGATATCCGGCGACCTGAAAACACAGATTGACGGCGGGGTGCAATACAGCAGAGCCGACGAAGAACAGCAGCAGGCTCTTTCCAGCCAAATGGGCTTCGGAGGCACCGTTCAGCCCGAGAGGCTTGGAGTCCTGGCCTCACATCACGACAACGCTGCCGTGGACGGCGGAAGGATTGCGGCCAAGATCTATTCCGAAGCTGACGAAGCTTGGCGCAAAGCAATCGACGGAGGAGGGTCACTCCTCGATGAGGGAAAGCAGTCCCTCACTAAGTTGGCGGCCGCTTGGGGCGGCTCTGGTTCTGAGGCTTATGGAGGAAGCGGATCAGAGGCATACCAGGGTGTGCAACAGAAGTGGGACGCCACCGCTACAGAACTGGGCGGGTTGGCTCAAGAGGCCGGCAACTTTGAGCGCATCTCTGGGGACCTGAAGACCCAGATAGACGGAGGGGTGCAGTACTCCAGAGCAGACGAGGAGCAGCAGCAGGCCCTCAGCTCACAGATGGGGTTCGGCGGGACAGTGCAGCCTGAACGGCTTGGCGTCCTCGCCTCCCACCACGATAACGCCGCAGTGGATGGGGGGCGCATTGCCGCCAAAATCTATAGCGAAGCTGATGAGGCTTGGAGGAAGGCCATTGACGGT(SEQ ID NO: 7).

[0093] Construction of 3 tandem fusion protein expression strain:

[0094] The optimized sequence was sent to Sangon Biotech (Shanghai) Co., Ltd. for gene synthesis. The synthesized gene sequence was cloned into the expression plasmid pET-28a, which was then transformed into BL21(DE3) competent cells. After plating, the recombinant expression strain BL21-2ECRv was obtained. The recombinant strain BL21-2ECRv was inoculated into LB medium to induce the fusion protein, which was denoted as BL21-2ECRv.

[0095] 4. Establishment of ELISA detection method:

[0096] The purified BL21-2ECRv fusion protein was coated onto an ELISA plate. Fluorescently labeled secondary antibodies were obtained by labeling anti-bovine IgM antibody with CY5 and anti-bovine IgG antibody with CY3. The working concentrations of the fusion protein, test serum, and fluorescently labeled secondary antibody were optimized to establish detection methods for both antibodies. The optimal protein coating concentration was determined to be 100–200 ng / well, the serum dilution to be 1:200, the CY5-labeled IgM secondary antibody dilution to be 1:8000, and the CY3-labeled IgG secondary antibody dilution to be 1:10000. A P / N ratio ≥ 2.1 was considered positive.

[0097] 5. Establishment of intradermal allergy testing methods:

[0098] The fusion protein BL21-2ECRv was diluted into working solutions of different concentrations and injected into tuberculosis-positive cattle. Skin fold thickness was measured 72 hours post-injection; protein concentrations greater than or equal to 4 mm were considered the optimal concentration for use. The optimal concentration for BL21-2ECRv was determined to be 5–20 μg / 0.1 ml.

[0099] Example 2

[0100] The difference from Example 1 is that the antigen is a fusion protein consisting of a non-repetitive unit composed of ESAT6-1, ESAT6-2, CFP10-1, CFP10-2, Rv3615c-1, and Rv3615c-2 fragments connected in series, named BL21-ECRv. Specifically, it is: ESAT6-1+linker+ESAT6-2+linker+CFP10-1+linker+CFP10-2+linker+Rv3615c-1+linker+Rv3615c-2.

[0101] Example 3

[0102] The difference from Example 1 is that the antigen is a fusion protein consisting of two repeating units sequentially tandemly composed of Rv3615c-1, Rv3615c-2, CFP10-1, CFP10-2, ESAT6-1, and ESAT6-2 fragments, named BL21-2RvCE. Specifically, it is: Rv3615c-1+linker+Rv3615c-2+linker+CFP10-1+linker+CFP10-2+linker+ESAT6-1+linker+ESAT6-2+linker+Rv3615c-1+linker+Rv3615c-2+linker+CFP10-1+linker+CFP10-2+linker+ESAT6-1+linker+ESAT6-2.

[0103] Example 4

[0104] The difference from Example 1 is that the antigen is a fusion protein consisting of three repeating units sequentially tandemly composed of ESAT6-1, ESAT6-2, CFP10-1, CFP10-2, Rv3615c-1, and Rv3615c-2 fragments, named BL21-3ECRv. Specifically, it is: ESAT6-1+linker+ESAT6-2+linker+CFP10-1+linker+CFP10-2+linker+Rv3615c-1+linker+Rv3615c-2+linker+ESAT6-1+linker+ESAT6-2+linker+CFP10-1+linker+CFP10-2+linker+Rv3615c-1+linker+Rv3615c-2+

[0105] linker+ESAT6-1+linker+ESAT6-2+linker+CFP10-1+linker+CFP10-2+linker+Rv3615c-1+linker+Rv3615c-2.

[0106] Example 5

[0107] The difference from Example 1 is that the antigen is a fusion protein consisting of two repeating units randomly tandemly linked together from CFP10-1, ESAT6-1, ESAT6-2, CFP10-2, Rv3615c-2, and Rv3615c-1 fragments, named BL21-2CERv. Specifically, it is: CFP10-1+linker+ESAT6-1+linker+ESAT6-2+linker+CFP10-2+linker+Rv3615c-2+linker+Rv3615c-1+linker+CFP10-1+linker+ESAT6-1+linker+ESAT6-2+linker+CFP10-2+linker+Rv3615c-2+linker+Rv3615c-1.

[0108] Example 6

[0109] The difference from Example 1 is that the antigen is a fusion protein consisting of two repeating units, Rv3615c-1 and Rv3615c-2, sequentially tandemly linked, named BL21-Rv. Specifically, it is: Rv3615c-1+linker+Rv3615c-2+linker+Rv3615c-1+linker+Rv3615c-2.

[0110] Example 7

[0111] The difference from Example 1 is that the antigen is a fusion protein consisting of two repeating units sequentially tandemly composed of Rv3615c-1 and Rv3615c-2 fragments (the amino acid sequences of the two fragments are SEQ ID NO.9 and SEQ ID NO.10, respectively, where SEQ ID NO.9 is AVQPERLGVLASHHDNAAVD, with 95% homology to SEQ ID NO.5; SEQ ID NO.10 is YIAAKIYSEADEAWDKAIDG, with 90% homology to SEQ ID NO.6), named BL21-Rv2. Specifically:

[0112] Rv3615c-1+linker+Rv3615c-2+linker+Rv3615c-1+linker+Rv3615c-2.

[0113] Example 8

[0114] The difference from Example 1 is that the antigen is a fusion protein consisting of two repeating units, named BL21-CRv2, composed of CFP10-1 fragment, CFP10-2 fragment (the amino acid sequences of the two fragments are SEQ ID NO.11 and SEQ ID NO.12, respectively, where SEQ ID NO.11 is LAQEAGNFERISGDLKTAID, with 95% homology to SEQ ID NO.3, and SEQ ID NO.12 is VQYSRADEEQQQALSSQMQF, with 95% homology to SEQ ID NO.4), Rv3615c-1 fragment, and Rv3615c-2 fragment (the amino acid sequences of the two fragments are SEQ ID NO.9 and SEQ ID NO.10, respectively), sequentially tandemly connected. Specifically:

[0115] CFP10-1+linker+CFP10-2+linker+Rv3615c-1+linker+Rv3615c-2+linker+CFP10-1+linker+CFP10-2+linker+Rv3615c-1+linker+Rv3615c-2.

[0116] Example 9

[0117] The difference from Example 1 is that the antigen is a fusion protein composed of Rv3615c-1 and Rv3615c-2 fragments tandemly, named BL21-Rv3. Specifically, it is: Rv3615c-1+linker+Rv3615c-2+linker+Rv3615c-1+linker+Rv3615c-2+linker+Rv3615c-1+linker+Rv3615c-2.

[0118] Comparative Example 1

[0119] The difference from Example 1 is that the antigen is a fusion protein consisting of two repeating units, ESAT6+CFP10+Rv3615c, tandemly linked together, named BL21-qECR. Specifically, it is: ESAT6+linker+CFP10+linker+Rv3615c.

[0120] The nucleotide sequence of ESAT6 is as follows:

[0121] ATGACAGAGCAGCAGTGGAATTTCGCGGGTATCGAGGCCGCGGC

[0122] AAGCGCAATCCAGGGAAATGTCACGTCCATTCATTCCCTCCTTGACGA

[0123] GGGGAAGCAGTCCCTGACCAAGCTCGCAGCGGCCTGGGGCGGTAGC

[0124] GGTTCGGAGGCGTACCAGGGTGTCCAGCAAAAATGGGACGCCACGG

[0125] CTACCGAGCTGAACAACGCGCTGCAGAACCTGGCGCGGACGATCAGC

[0126] GAAGCCGGTCAGGCAATGGCTTCGACCGAAGGCAACGTCACTGGGAT

[0127] GTTCGCA(SEQ ID NO. 13).

[0128] The nucleotide sequence of CFP10 is as follows:

[0129] ATGGCAGAGATGAAGACCGATGCCGCTACCCTCGCGCAGGAGGC

[0130] AGGTAATTTCGAGCGGATCTCCGGCGACCTGAAAACCCAGATCGACC

[0131] AGGTGGAGTCGACGGCAGGTTCGTTGCAGGGCCAGTGGCGCGGCGC

[0132] GGCGGGGACGGCCGCCCAGGCCGCGGTGGTGCGCTTCCAAGAAGCA

[0133] GCCAATAAGCAGAAGCAGGAACTCGACGAGATCTCGACGAATATTCG

[0134] TCAGGCCGGCGTCCAATACTCGAGGGCCGACGAGGAGCAGCAGCAG

[0135] GCGCTGTCCTCGCAAATGGGCTTC(SEQ ID NO. 14).

[0136] The nucleotide sequence of Rv3615c is as follows:

[0137] ATGACGGAAAACTTGACCGTCCAGCCCGAGCGTCTCGGTGTACT

[0138] GGCGTCGCACCATGACAACGCGGCGGTCGATGCCTCCTCGGGCGTCG

[0139] AAGCTGCCGCTGGCCTAGGCGAATCTGTGGCGATCACTCACGGTCCGT

[0140] ACTGCTCACAGTTCAACGACACGTTAAATGTGTACTTGACTGCCCACA

[0141] ATGCCCTGGGCTCGTCCTTGCATACGGCCGGTGTCGATCTCGCCAAAA

[0142] GTCTTCGAATTGCGGCGAAGATATATAGCGAGGCCGACGAAGCGTGG

[0143] CGCAAGGCTATCGACGGGTTGTTTACCTGA (SEQ ID NO. 15).

[0144] Comparative Example 2

[0145] The difference from Example 1 is that the antigen is a fusion protein consisting of a non-repetitive unit composed of ESAT6-1, ESAT6-2, CFP10-1, and CFP10-2 fragments connected in series, named BL21-2EC. Specifically:

[0146] ESAT6-1+linker+ESAT6-2+linker+CFP10-1+linker+CFP10-2+linker+

[0147] ESAT6-1+linker+ESAT6-2+linker+CFP10-1+linker+CFP10-2.

[0148] Experimental Example 1

[0149] Fifteen cattle suspected of having tuberculosis, 20 healthy cattle, and 50 cattle vaccinated with BCG were tested using ELISA and skin tests based on the BL21-2ECRv protein.

[0150] ELISA test:

[0151] Blood was collected from the jugular vein of cattle. After blood agglutination, serum was collected by centrifugation and detected using the established ELISA. The specific procedure was as follows: the fusion protein was diluted with carbonate buffer (pH 9.6) to a concentration of 1 μg / ml, and then 100 μl / well was added to coat the microplate overnight at 4°C. The coating solution was discarded, and the plate was blocked with 1% BSA solution and incubated at 37°C for 2 hours. The plate was washed twice with PBST. 100 μl of the test serum diluted 1:200 was added to each well, and the plate was incubated at 37°C for 30 minutes. The serum was discarded, and the plate was washed four times with PBST. 100 μl of a 1:1 mixture of CY3 and CY5 labeled secondary antibody was added to each well, and the plate was incubated at 37°C for 45 minutes. The secondary antibody was discarded, and the plate was washed four times with PBST. The readings were taken at wavelengths of 550 nm and 650 nm, respectively. The results are shown in Table 1. The results showed that in 15 cattle suspected of having tuberculosis, the ELISA method established in this invention was used to detect IgM and IgG antibodies. 14 cattle (with typical tuberculous nodules after necropsy) tested positive, while 1 cattle (with no lesions after necropsy) tested negative. The results were consistent with the clinical necropsy findings, with a sensitivity of 100%. In 20 cattle that tested negative, the ELISA test was negative, with a specificity of 100%. In 50 cattle vaccinated with BCG, the ELISA test showed negative IgM antibodies in all 50 cattle, negative IgG antibodies in 49 cattle, and positive IgG antibodies in 1 cattle, with a specificity of 98%. Therefore, using BL21-2ECRv as the antigen, ELISA detection can effectively distinguish between BCG-vaccinated cattle and naturally infected cattle.

[0152] Table 1. ELISA detection of BL21-2ECRv fusion protein

[0153]

[0154] Note: "+" indicates positive; "±" indicates suspected; "-" indicates negative.

[0155] Intradermal allergy testing:

[0156] Intradermal injections were performed in the neck of cattle, with 100 μl (10 μg / cattle) injected intradermally per animal. 72 hours post-injection, the skinfold thickness at the injection site was measured using calipers. A thickness greater than or equal to 4 mm was considered positive. The results are shown in Table 2. Among 15 cattle suspected of having tuberculosis, 14 (with typical tuberculous nodules observed upon necropsy) showed a skinfold thickness difference greater than 4 mm before and after injection, resulting in a positive result. One cattle showed a skinfold thickness difference less than 2 mm before and after injection, resulting in a negative result. The test results were consistent with the clinical necropsy findings, with a sensitivity of 100%. Among 20 healthy cattle, all 20 showed a skinfold thickness difference less than 2 mm before and after injection, with a specificity of 100%. Among 50 cattle vaccinated with BCG, 49 showed a skinfold thickness difference less than 2 mm before and after injection, and one cattle showed a skinfold thickness of 3 mm before and after injection, with a specificity of 98%.

[0157] Table 2. Skin Test Detection of BL21-2ECRv Fusion Protein

[0158]

[0159] Note: "+" indicates positive; "±" indicates suspected; "-" indicates negative.

[0160] Experimental Example 2

[0161] The cattle in Experiment 1 were grouped together, and the fusion proteins BL21-ECRv, BL21-2ECRv, and BL21-3ECRv with different number of repetitions were tested using ELISA and skin tests. The results are shown in Tables 3 and 4.

[0162] Table 3. ELISA detection of fusion proteins with different number of repetitions

[0163]

[0164] Note: "+" indicates positive; "±" indicates suspected; "-" indicates negative.

[0165] The results showed that in 15 cattle suspected of having tuberculosis, the ELISA methods for detecting IgM and IgG using BL21-ECRv, BL21-2ECRv, and BL21-3ECRv proteins yielded the following results: BL21-ECRv protein detection had a sensitivity of 85.7%, BL21-2ECRv protein detection had a sensitivity of 100%, and BL21-3ECRv protein detection had a sensitivity of 92.8%. In 20 negative cattle, the specificity for all three proteins was 100%. In 50 cattle vaccinated with BCG, the specificity for all three proteins was 98%. Therefore, using these proteins as antigens, ELISA detection can effectively distinguish between BCG-vaccinated cattle and naturally infected cattle.

[0166] Table 4. Skin test detection of fusion protein with different number of repetitions

[0167]

[0168]

[0169] Note: "+" indicates positive, with a skin thickness difference of ≥4mm; "±" indicates suspected, with a skin thickness difference of 4mm≦ / ≧2mm; "-" indicates negative, with a skin thickness difference of 2mm≧.

[0170] For 15 cattle suspected of having tuberculosis, skin tests were performed using BL21-ECRv, BL21-2ECRv, and BL21-3ECRv proteins. The sensitivity for BL21-ECRv protein detection was 85.7%, for BL21-2ECRv protein detection was 100%, and for BL21-3ECRv protein detection was 92.8%. For 20 negative cattle, the specificity for all three proteins was 100%. In 50 cattle vaccinated with BCG, the specificity for all three proteins using skin tests was 98%. Therefore, using these proteins as antigens, skin tests can effectively distinguish between BCG-vaccinated cattle and naturally infected cattle.

[0171] Experimental Example 3

[0172] The cattle in Experiment 1 were grouped together, and the fusion proteins BL21-2ECRv, BL21-2RvCE, and BL21-2CERv with different sequences were tested using ELISA and skin tests. The results are shown in Tables 5 and 6.

[0173] Table 5. ELISA detection of fusion proteins with different sequences

[0174]

[0175] Note: "+" indicates positive; "±" indicates suspected; "-" indicates negative.

[0176] The results showed that in 15 cattle suspected of having tuberculosis, ELISA testing using BL21-2ECRv, BL21-2RvCE, and BL21-2CERv proteins yielded the following results: BL21-2ECRv protein showed a sensitivity of 100%, BL21-2RvCE protein showed a sensitivity of 92.8%, and BL21-2CERv protein showed sensitivities of 100% (IgG) and 92.8% (IgM). In 20 negative cattle, the specificity of all three proteins was 100%. In 50 cattle vaccinated with BCG, the specificity of all three proteins was 98%. Therefore, using these proteins as antigens, ELISA testing can effectively distinguish between BCG-vaccinated cattle and naturally infected cattle.

[0177] Table 6. Skin test detection of fusion proteins with different sequences

[0178]

[0179] Note: "+" indicates positive, with a skin thickness difference of ≥4mm; "±" indicates suspected, with a skin thickness difference of 4mm≦ / ≧2mm; "-" indicates negative, with a skin thickness difference of 2mm≧.

[0180] The results showed that in 15 cattle suspected of having tuberculosis, the skin tests for BL21-2ECRv, BL21-2RvCE, and BL21-2CERv proteins yielded the following results: BL21-2ECRv protein showed a sensitivity of 100%, BL21-2RvCE protein showed a sensitivity of 92.8%, and BL21-2CERv protein showed a sensitivity of 87.5%. In 20 negative cattle, the specificity of all three skin tests was 100%. In 50 cattle vaccinated with BCG, the specificity of the BL21-2ECRv protein skin test was 98%, and the specificities of both the BL21-2CERv and BL21-2RvCE proteins were 96%. Therefore, using these antigens, skin tests can effectively distinguish between BCG-vaccinated cattle and naturally infected cattle.

[0181] Test Example 4

[0182] The cattle in Experiment 1 were grouped together, and the fusion proteins BL21-Rv, BL21-Rv2, BL21-CRv2, and BL21-Rv3 were tested using ELISA and skin tests, respectively. The results are shown in Tables 7 and 8.

[0183] Table 7 ELISA detection of different fusion proteins

[0184]

[0185] Note: "+" indicates positive; "±" indicates suspected; "-" indicates negative.

[0186] The results showed that in 15 cattle suspected of having tuberculosis, ELISA testing of BL21-Rv, BL21-Rv2, BL21-CRv2, and BL21-Rv3 proteins yielded the following results: BL21-Rv protein showed a sensitivity of 92.8% (IgG) and 100% (IgM); BL21-Rv2, BL21-CRv2, and BL21-Rv3 proteins all showed a sensitivity of 92.8%. In 20 negative cattle, the specificity of BL21-Rv protein was 100%; the specificities of BL21-Rv2, BL21-CRv2, and BL21-Rv3 proteins were 95% (IgM) and 100% (IgG). In 50 cattle vaccinated with BCG, the specificity of BL21-Rv, BL21-Rv2, BL21-CRv2, and BL21-Rv3 proteins was 98%. It is evident that using it as an antigen, ELISA testing can meet the need to distinguish between cattle immunized with BCG vaccine and naturally infected cattle.

[0187] Table 8. Skin test detection of different fusion proteins

[0188]

[0189]

[0190] Note: "+" indicates positive, with a skin thickness difference of ≥4mm; "±" indicates suspected, with a skin thickness difference of 4mm≦ / ≧2mm; "-" indicates negative, with a skin thickness difference of 2mm≧.

[0191] The results showed that in 15 cattle suspected of having tuberculosis, the sensitivity of BL21-Rv protein detection was 92.8%, the sensitivity of BL21-Rv2 protein detection was 92.8%, and the sensitivity of BL21-Rv3 protein detection was 87.5%. In 20 cattle that tested negative for tuberculosis, the specificity of BL21-Rv protein skin test was 100%, and the specificity of BL21-Rv2, BL21-CRv2, and BL21-Rv3 protein detection was 95%. In 50 cattle vaccinated with BCG, the specificity of BL21-Rv protein skin test was 96%, and the specificity of BL21-CRv2 protein detection was 94%. It is evident that using it as an antigen, skin testing can meet the need to distinguish between cattle immunized with BCG vaccines and naturally infected cattle.

[0192] Comparative test data of Example 5 and existing technologies

[0193] In a cattle farm infected with bovine tuberculosis, 200 cattle were randomly selected, and 100 of them were vaccinated with BCG vaccine via subcutaneous injection in the neck, at a dose of 1×10n. 6 CFU / head. The remaining 100 cattle were left untreated. Sixty days after vaccination, antibodies in the serum of all cattle were detected using a commercially available ELISA kit and the ELISA kit developed in this invention. Skin allergy and in vitro IFN-γ were detected using commercially available bovine tuberculin PPD-B, BL21-2ECRv prepared in this invention, qECR fusion protein (ESAT6, CFP10, Rv3615c fusion expression) without sequence antigen site optimization, and 2EC fusion protein (ESAT6, CFP10) without Rv3615c. The results are shown in Table 9.

[0194] Table 9. Number of cattle tested positive and negative by different detection methods

[0195]

[0196] Note: "+" indicates positive; "±" indicates suspected; "-" indicates negative.

[0197] The test data shows that the tandem fusion protein BL21-2ECRv constructed in this invention can effectively distinguish between BCG vaccine immunization and natural infection, and the distinguishing efficiency is significantly better than the detection methods currently used.

[0198] Using ELISA to detect antibodies, in 100 BCG-vaccinated cattle, 100 tested positive with commercially available ELISA kits, while 99 tested negative with the ELISA method (BL21-2ECRv) established in this invention. 97 tested negative with the unoptimized fusion protein qECR method, and 96 tested negative with the fusion protein 2EC (which does not contain Rv3615c). In 100 unvaccinated cattle, 22 tested positive with commercially available ELISA kits (16 of which showed typical tuberculous nodules upon necropsy), while 17 tested positive with the ELISA method (BL21-2ECRv) established in this invention (16 of which showed typical tuberculous nodules upon necropsy). 19 tested positive with the unoptimized fusion protein qECR method (16 of which showed typical tuberculous nodules upon necropsy), and 18 tested positive with the fusion protein 2EC (which does not contain Rv3615c) (16 of which showed typical tuberculous nodules upon necropsy). Commercially available ELISA products can accurately detect immune antibodies and infection antibodies, but they cannot differentiate between vaccine immunization and natural infection. Unoptimized fusion protein qECR and fusion protein 2EC (without Rv3615c) can distinguish between vaccine-induced immunity and natural infection, but their accuracy is insufficient. The ELISA (BL21-2ECRv) method established in this invention can accurately detect infection antibodies, effectively distinguish between vaccine-induced immunity and natural infection, and has a sensitivity (number of positive samples detected / (number of positive samples - false positives) × 100%) of 100% and a specificity (number of negative samples detected / (negative samples - false negatives) × 100%) of 99%.

[0199] In skin allergy testing, among 100 BCG-vaccinated cattle, 98 tested positive for commercially available PPD-B, 1 tested positive for BL21-2ECRv (established in this invention), 5 tested positive for the unoptimized fusion protein qECR, and 5 tested positive for the fusion protein 2EC (which does not contain Rv3615c). Among 100 unvaccinated cattle, 21 tested positive for commercially available PPD-B (16 of which showed typical tuberculous nodules upon necropsy), and the BL21-2ECRv (established in this invention) tested positive for... Of the 16 positive cases detected, 18 were positive using the unoptimized fusion protein qECR (all 16 showed typical tuberculous nodules after necropsy), and 19 were positive using the fusion protein 2EC (which does not contain Rv3615c) (all 16 showed typical tuberculous nodules after necropsy). Existing technologies such as PPD-B cannot distinguish between vaccine-immunized and naturally occurring infections, and the unoptimized fusion protein qECR and the fusion protein 2EC (which does not contain Rv3615c) both exhibit a certain degree of false positives and false negatives. The BL21-2ECRv skin allergy detection method established in this invention has a specificity of 99% and a sensitivity of 100%, effectively distinguishing between vaccine-immunized and naturally occurring infections.

[0200] In IFN-γ testing, among 100 BCG-vaccinated cattle, 100 tested positive for commercially available PPD-B, 0 tested positive for the BL21-2ECRv assay established in this invention, 7 tested positive for the unoptimized fusion protein ECR assay, and 3 tested positive for the fusion protein 2EC assay that does not contain Rv3615c. Among 100 unvaccinated cattle, 23 tested positive for commercially available PPD-B (16 of which showed typical tuberculous nodules after necropsy), 16 tested positive for the BL21-2ECRv assay established in this invention (16 of which showed typical tuberculous nodules after necropsy), 19 tested positive for the unoptimized fusion protein qECR assay (16 of which showed typical tuberculous nodules after necropsy), and 18 tested positive for the fusion protein 2EC assay that does not contain Rv3615c (16 of which showed typical tuberculous nodules after necropsy).

[0201] It is evident that existing technologies such as PPD-B cannot distinguish between vaccine immunization and natural infection, and the unoptimized qECR and the 2ECR method, which does not include the Rv3615c fusion protein, both have a certain degree of false negatives and false negatives. The BL21-2ECRv in vitro IFN-γ detection method established in this invention has 100% specificity and 100% sensitivity, and can effectively distinguish between vaccine immunization and natural infection.

[0202] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A fusion protein, characterized in that, The fusion protein contains 2-3 repeating units, with adjacent repeating units linked by linker peptides; The repeating unit consists of Rv3615c-1 and Rv3615c-2 fragments, with adjacent fragments linked by a linker peptide. The amino acid sequence of the Rv3615c-1 fragment is shown in SEQ ID NO.5 or SEQ ID NO.9; the amino acid sequence of the Rv3615c-2 fragment is shown in SEQ ID NO.6 or SEQ ID NO.

10.

2. A fusion protein, characterized in that, From the N-terminus to the C-terminus, the fusion protein consists of the following fragments in sequence: CFP10-1, CFP10-2, Rv3615c-1, Rv3615c-2, CFP10-1, CFP10-2, Rv3615c-1, and Rv3615c-2. Adjacent fragments are connected by a linker peptide with the amino acid sequence GGAGGG. The amino acid sequence of the CFP10-1 fragment is shown in SEQ ID NO.11; The amino acid sequence of the CFP10-2 fragment is shown in SEQ ID NO.12; The amino acid sequence of the Rv3615c-1 fragment is shown in SEQ ID NO.9; the amino acid sequence of the Rv3615c-2 fragment is shown in SEQ ID NO.

10.

3. A fusion protein, characterized in that, The fusion protein comprises 1-3 repeating units, with adjacent repeating units linked by linker peptides; The repeating unit consists of ESAT6-1 fragment, ESAT6-2 fragment, CFP10-1 fragment, CFP10-2 fragment, Rv3615c-1 fragment, and Rv3615c-2 fragment, with adjacent fragments linked by linker peptides. The amino acid sequence of the ESAT6-1 fragment is shown in SEQ ID NO.1; The amino acid sequence of the ESAT6-2 fragment is shown in SEQ ID NO.2; The amino acid sequence of the CFP10-1 fragment is shown in SEQ ID NO.3 or SEQ ID NO.11; The amino acid sequence of the CFP10-2 fragment is shown in SEQ ID NO.4 or SEQ ID NO.12; The amino acid sequence of the Rv3615c-1 fragment is shown in SEQ ID NO.5 or SEQ ID NO.9; the amino acid sequence of the Rv3615c-2 fragment is shown in SEQ ID NO.6 or SEQ ID NO.

10.

4. The fusion protein according to claim 3, characterized in that, The repeating unit is composed of ESAT6-1 fragment, ESAT6-2 fragment, CFP10-1 fragment, CFP10-2 fragment, Rv3615c-1 fragment and Rv3615c-2 fragment connected in series from the N-terminus to the C-terminus, with adjacent fragments linked by linker peptides.

5. The fusion protein according to claim 3, characterized in that, The amino acid sequence of the linker peptide is GGAGGG.

6. The fusion protein according to claim 3, characterized in that, The fusion protein contains two repeating units.

7. A biomaterial, characterized in that, The biomaterial is selected from any one of ac: a. A polynucleotide, wherein the polynucleotide is a nucleotide sequence encoding the fusion protein of any one of claims 1, 3-6; b. A vector carrying the polynucleotide in a; c. A cell carrying the polynucleotide of a, or containing the vector of b, or expressing the fusion protein of any one of claims 1, 3-6.

8. The biomaterial according to claim 7, characterized in that, The nucleotide sequence of the polynucleotide is shown in SEQ ID NO.

7.

9. The use of the fusion protein according to any one of claims 1, 3-6 in the identification of BCG vaccine immunization and natural infection with Mycobacterium tuberculosis for non-disease diagnosis and treatment purposes.

10. A reagent, characterized in that, Includes the fusion protein described in any one of claims 1, 3-6.

11. An ELISA kit, characterized in that, Includes the fusion protein, ELISA plate, washing solution, and fluorescently labeled anti-bovine IgM antibody or fluorescently labeled anti-bovine IgG antibody as described in any one of claims 1, 3-6.

12. The ELISA kit according to claim 11, characterized in that, The fluorescent label is CY5 or CY3.

Citation Information

Patent Citations

  • Diagnostic reagents for improved in vivo or in vitro cell-mediated immunological diagnosis of tuberculosis

    CN105829891A

  • Comparative mycobacterial genomics as a tool for identifying targets for the diagnosis, prophylaxis or treatment of mycobacterioses

    US20030129601A1