A pAT- trans MP-Cas9-mediated gene editing system and its application in gene editing

Abstract

The application discloses a pAT- trans The application discloses an MP-Cas9-mediated gene editing system and application thereof in gene editing. The application optimizes the MP expression mode in the TMV virus genome, makes the MP expression mode get rid of the regulation and limitation of the original virus genome, and establishes a pAT- trans MP vector through complementary expression of the TMV-MP deletion vector in the same T-DNA region. The application successfully expresses a macromolecular weight protein represented by Cas9 by using the pAT- trans MP expression vector, and further creates a pAT- trans MP-Cas9 transient gene editing system which successfully edits the NbPDS and GFP genes in tobacco. The expression vector established by the application has a good application prospect in expression of a macromolecular weight protein and gene editing.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a pAT- trans MP-Cas9-mediated gene editing system and its application in gene editing. Background Technology

[0002] In plant biotechnology, plant viral vectors often utilize the efficient replication and transcriptional regulation mechanisms of viruses in plants to express desired target molecules / proteins. Due to their advantages of speed, efficiency, and low cost, they hold promise for widespread application in the production of exogenous proteins in plants, such as medical proteins, metabolic-related products, and subunit vaccines. Furthermore, using viral vectors to instantaneously express or knock out target genes is expected to overcome the shortcomings of traditional lethal genes and the difficulties and time-consuming processes of plant regeneration, providing a valuable tool for early trait screening in molecular breeding. However, in the application of plant viral expression vectors, virus-derived expression vectors often suffer from low expression levels, especially for large molecular weight target proteins (such as the approximately 1800bp gene fragment encoding the GUS protein, and target proteins exceeding 800 amino acids). This limits the application scope of viral vectors; for example, large molecular weight key proteins in biological metabolic pathways or enzyme reactions often only achieve partial expression due to expression difficulties.

[0003] The development of viral expression vectors has brought opportunities to CRISPR-Cas9-mediated editing systems. However, the large molecular weight of the Cas9 protein (over 150 kDa) makes it difficult to express in viral vectors, or results in extremely low expression levels. Therefore, viral vectors are mostly used to drive gRNA expression cassettes and are used in conjunction with transgenic plants expressing Cas9 (or with Cas9 expression provided by other Agrobacterium plasmids), which involves transgenic processes, low co-injection efficiency, and time consumption. Although there have been reports in the past two years of establishing CRISPR-Cas9 editing systems using negative-strand RNA rhabdoviruses, their large viral genome (nearly 15 kb) and complex gene regulation make practical operation difficult, especially in plant bioreactors, where further research is needed. Therefore, there is an urgent need to discover new, highly efficient viral vectors that can achieve high-level expression of large molecular weight target proteins and simultaneously express two target molecules in a single vector, which will have significant application value.

[0004] Scientists' in-depth research on the molecular replication of the TMV genome and the viral encoded proteins has laid the foundation for the development of plant virology. Research on TMV expression vectors has also led the research on plant virus expression vectors, but the expression of large molecular weight proteins remains an obstacle to their widespread application. Summary of the Invention

[0005] The technical problem to be solved by this invention is how to express high molecular weight proteins in plants using TMV plant virus vectors.

[0006] To solve the above-mentioned technical problems, the present invention first provides pAT- trans New applications for MP carriers; the pAT- trans The MP vector is a vector obtained by ligating the expression cassette of the motility protein MP into a plant virus expression vector, wherein the encoding gene of the motility protein MP and the encoding gene of the high molecular weight protein are expressed separately by their respective promoters in the plant virus expression vector; the motility protein MP is any one of the following (a1)-(a3):

[0007] (a1) The protein shown in SEQ ID No. 5;

[0008] (a2) A protein with the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID No. 5.

[0009] (a3) A protein that has more than 78% identity with SEQ ID No. 5 and has the same function;

[0010] This invention provides pAT- trans Applications of MP vectors in expressing high molecular weight proteins or preparing products expressing high molecular weight proteins.

[0011] In the protein described in (a2) above, the substitution and / or deletion and / or addition of one or more amino acid residues is as follows: substitution and / or deletion and / or addition of no more than 10 amino acid residues, or substitution and / or deletion and / or addition of no more than 9 amino acid residues, or substitution and / or deletion and / or addition of no more than 8 amino acid residues, or substitution and / or deletion and / or addition of no more than 7 amino acid residues, or substitution and / or deletion and / or addition of no more than 6 amino acid residues, or substitution and / or deletion and / or addition of no more than 5 amino acid residues, or substitution and / or deletion and / or addition of no more than 4 amino acid residues, or substitution and / or deletion and / or addition of no more than 3 amino acid residues, or substitution and / or deletion and / or addition of no more than 2 amino acid residues, or substitution and / or deletion and / or addition of no more than 1 amino acid residue.

[0012] In the protein described in (a3) ​​above, the identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using identity search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, by using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambdaratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences, the identity value (%) can be obtained.

[0013] In the above applications, the expression cassette of the motor protein MP includes the coding gene of the motor protein MP and a promoter for driving the expression of the coding gene of the motor protein MP.

[0014] The method of linking the expression cassette of the motor protein MP includes directly inserting the expression cassette of the motor protein MP into the plant expression vector, or replacing a portion of the DNA fragment in the plant expression vector with the expression cassette of the motor protein MP.

[0015] In the plant expression vector, the promoter used to drive the expression of the gene encoding the motility protein MP can be the same as or different from the promoter used to drive the expression of the gene encoding the high molecular weight protein.

[0016] In one embodiment of the invention, the pAT- trans The MP vector is a vector obtained by deleting the gene encoding the motility protein MP that regulates expression in the viral genome of a plant virus expression vector, and then inserting the expression cassette of the motility protein MP upstream or downstream of the viral genome in the same T-DNA region of the plant virus expression vector.

[0017] In one specific embodiment of the present invention, the pAT- trans The MP vector is a vector obtained by deleting the gene encoding the motility protein MP that regulates expression in the viral genome of a plant virus expression vector, and then inserting the expression cassette of the motility protein MP downstream of the viral genome in the same T-DNA region of the plant virus expression vector.

[0018] In one embodiment of the present invention, the expression cassette of the motor protein MP includes a promoter for initiating the expression of the gene encoding the motor protein MP, the gene encoding the motor protein MP, and a terminator for terminating the expression of the gene encoding the motor protein MP.

[0019] In one specific embodiment of the present invention, the promoter is the DNA molecule shown in positions 7-313 of SEQ ID No. 4.

[0020] The gene encoding the motor protein MP is a DNA molecule as described in either (A1) or (A2) below: (A1) the DNA molecule shown in SEQ ID No. 6; (A2) a DNA molecule that has more than 70% identity with SEQ ID No. 6 and encodes the motor protein MP. Wherein, identity refers to sequence similarity to a natural nucleic acid sequence, including nucleotide sequences having 75% or higher, 80% or higher, 85% or higher, 90% or higher, or 95% or higher identity with the nucleotide sequence of the protein encoding the amino acid sequence shown in SEQ ID No. 5 of the present invention.

[0021] The terminator is the DNA molecule represented by positions 2312-2575 of SEQ ID No. 4.

[0022] In one embodiment of the present invention, the plant virus expression vector includes Tobamovirus plant virus expression vector, Tobravirus plant virus expression vector and Potexvirus plant virus expression vector.

[0023] The preferred expression vector for Tobamovirus plants is the tobacco mosaic virus expression vector.

[0024] The preferred expression vector for Tobravirus plants is the Tobacco Crisp Virus expression vector.

[0025] The preferred expression vector for the Potexvirus plant virus is the potato X virus expression vector.

[0026] In one specific embodiment of the present invention, the tobacco mosaic virus expression vector is a pAT vector. The pAT vector sequentially includes the following main elements: a 35S promoter, the RdRp gene of TMV, the MP gene of TMV, a GFP reporter gene, the 3'UTR region of TMV, and a 35S terminator.

[0027] To address the aforementioned technical problems, the present invention also provides a vector for plant gene editing.

[0028] The vector for plant gene editing provided by this invention is based on the above-mentioned pAT- trans The vector obtained by linking the Cas9 nuclease-encoding gene into the viral genome of the MP vector.

[0029] In one embodiment of the present invention, the vector for plant gene editing is a pAT-trans The MP vector was obtained by inserting the Cas9 nuclease-encoding gene between the Asc I and Xho I restriction sites in the viral genome.

[0030] In one specific embodiment of the present invention, the vector for plant gene editing is a pAT- trans The vector is obtained by ligating the DNA molecule shown in SEQ ID No. 7 between the Asc I and Xho I restriction sites in the viral genome of the MP vector.

[0031] In one embodiment of the present invention, the vector further includes an sgRNA expression cassette targeting a target gene. The sgRNA expression cassette targets a target gene and includes, in sequence, a promoter for initiating the expression of the sgRNA and the gene encoding the sgRNA.

[0032] In one specific embodiment of the present invention, the nucleotide sequence of the sgRNA expression cassette targeting the target gene is shown in SEQ ID No. 9.

[0033] In another specific embodiment of the present invention, the nucleotide sequence of the sgRNA expression cassette targeting the target gene is shown in SEQ ID No. 10.

[0034] In a preferred embodiment of the present invention, the vector for plant gene editing is a pAT- trans The DNA molecule shown in SEQ ID No. 7 is ligated between the Asc I and Xho I restriction sites in the viral genome of the MP vector, and the pAT- trans The MP vector is obtained by ligating the sgRNA expression cassette targeting the gene into the Kpn I restriction site.

[0035] To address the aforementioned technical problems, this invention also provides new uses for the vectors used for plant gene editing.

[0036] This invention provides the application of the above-described vector for plant gene editing in any of the following 1)-5):

[0037] 1) Gene editing:

[0038] 2) Prepare gene-edited products;

[0039] 3) Preparation of plant mutants;

[0040] 4) Study the function of plant proteins or genes;

[0041] 5) Products that study the function of plant proteins or genes.

[0042] To solve the above-mentioned technical problems, the present invention finally provides either method b1) or b2):

[0043] b1) A method for expressing a high molecular weight protein, comprising the following steps: expressing the gene encoding the high molecular weight protein via the above-mentioned pAT- trans MP vectors are introduced into host cells to achieve the expression of high molecular weight proteins;

[0044] b2) A method for plant gene editing, comprising the following steps: introducing the above-mentioned vector for plant gene editing into a plant to achieve plant gene editing.

[0045] The host cell described above can be a plant cell. The plant can be tobacco, specifically Nicotiana benthamiana or 16c transgenic material of Nicotiana benthamiana.

[0046] Any of the above expressions can be instantaneous.

[0047] The aforementioned high molecular weight protein can be a protein with a molecular weight greater than 150 kDa, including but not limited to medically related proteins, plant functional proteins, and engineered products of molecular metabolic enzymes. In one specific embodiment of the present invention, the high molecular weight protein is a Cas9 protein with a molecular weight of 162 kDa.

[0048] The gene mentioned above can be any gene located in the plant genome, such as the NbPDS gene, or any gene introduced into the plant, such as the GFP gene.

[0049] This invention optimizes the MP expression mode in the TMV viral genome, freeing it from the regulatory restrictions of the original viral genome. Furthermore, it establishes pAT-... by tandemly expressing a TMV-MP deletion vector within the same T-DNA region. trans MP expression vector. This invention utilizes pAT- trans The MP expression vector successfully expressed high molecular weight proteins, such as Cas9, and further expressed them based on pAT- trans MP expression vectors created pAT-12000, driven by a single viral vector containing Cas9 and the target gene editing sequence. trans The MP-Cas9 transient gene editing system successfully edited the NbPDS and GFP genes in tobacco.

[0050] The beneficial effects of this invention are as follows:

[0051] 1. This invention optimizes the expression vector based on the Tobacco Mosaic Virus (TMV) genome, and dissociates the TMV movement protein (MP) from the expression regulation of the TMV genome through trans-expression, establishing the pAT- trans The MP expression vector can effectively express high molecular weight proteins (CRISPR gene editing Cas9 protein greater than 150 kDa), demonstrating that the pAT- expression vector established in this invention... trans The MP system has significant advantages in expressing large target proteins, breaking the limitations of viral expression vectors on exogenous protein molecules.

[0052] 2. The pAT- created by this invention trans The MP-Cas9 gene editing system enables CRISPR-Cas9-mediated gene editing using a single viral vector, offering advantages in efficiency and speed. It broadens the application scope of TMV viral vectors, facilitates research on gene function and metabolic pathways, and provides an effective tool for rapid screening of early traits in molecular breeding. It has significant theoretical importance and application potential.

[0053] 3. This invention utilizes a vector constructed based on the TMV genome that lacks the viral CP protein, eliminating the safety hazards of traditional viral vector systems and the ecological risks associated with release into the environment. Therefore, the pAT- vector established in this invention... trans The MP-Cas9 high-efficiency expression vector will have potential application value and social significance. Attached Figure Description

[0054] Figure 1 This is a schematic diagram of vector construction. Specifically, the pAT vector involves replacing the CP gene in the TMV genome with the GFP gene and inserting it into the CaMV 35S promoter (P...). 35S ) drive the expression of exogenous GFP protein in plants; pAT-ΔMP: an expression vector after deleting the MP gene from the pAT vector; pAT- trans MP: The MP expression frame is supplemented in the pAT-ΔMP vector via trans expression, where "P NOS -MP-T NOS "This is the MP expression box."

[0055] Figure 2 For in pAT- trans The MP system efficiently expresses CRISPR-Cas9 protein and effectively edits the NbPDS and GFP genes. A and B show the Cas9 protein expression levels as detected by Western blot. A represents a comparison of pAT- at 3-6 dpi. transThe expression level of Cas9 in the MP-Cas9 vector showed that samples with 3 dpi exhibited high expression. B represents the expression level of pAT- using Western blot comparison. trans The expression levels of Cas9 in the MP system and the pAT control vector were compared. Results showed that, with or without the addition of VSRs silencing repressors (with the addition of empty P130 vector as a negative control), no Cas9 expression was detected in the samples in the pAT-Cas9 control vector, while pAT- trans Significantly enhanced Cas9 signal was generated in all MP-Cas9 vectors. C represents the gene editing vector pAT- trans MP-Cas9-pds360 and pAT- trans A schematic diagram of the structure of MP-Cas9-gfp, showing the editing target sequence of Cas9 and the target gene driven by a single vector. D represents pAT- trans Leaf phenotypes after NbPDS gene editing using the MP-Cas9-pds360 vector. E shows the agarose gel electrophoresis and sequencing results of the DNA-template PCR products after enzyme digestion with ApeKI. F shows the pAT- trans Leaf phenotype after GFP gene editing using the MP-Cas9-gfp vector. G represents the agarose gel electrophoresis and sequencing results of the DNA-template PCR product after enzyme digestion using Bst BI. Detailed Implementation

[0056] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0057] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0058] The specific method for constructing the TMV virus expression vector pAT in the following embodiments is as follows:

[0059] (1) The double-stranded DNA molecule shown in SEQ ID No.1 was artificially synthesized; in the double-stranded DNA molecule, nucleotides 3-8 form the Xho I restriction enzyme recognition sequence, nucleotides 24-227 form the 3'UTR region of TMV, and nucleotides 228-233 form the Kpn I restriction enzyme recognition sequence.

[0060] (2) The double-stranded DNA molecule obtained in step (1) was digested with restriction endonucleases Xho I and Kpn I, and the digestion products were recovered.

[0061] (3) The p35S-30B plasmid was digested with restriction endonucleases Xho I and Kpn I, and the vector backbone with a size of 13605 bp was recovered.

[0062] (4) The enzyme digestion product obtained in step (2) and the vector backbone obtained in step (3) are linked together to obtain the pAT0 vector. The pAT0 vector includes the following main elements in sequence: 35S promoter, TMV RdRp gene, TMV MP gene, multiple cloning site sequence, TMV 3'UTR region, and 35S terminator.

[0063] (5) The GFP reporter gene shown in SEQ ID No. 2 was inserted between the Pac I and Xho I restriction sites of the pAT0 vector to obtain the pAT vector. The pAT vector includes the following main elements in sequence: 35S promoter, TMV RdRp gene, TMV MP gene, GFP reporter gene, TMV 3'UTR region, and 35S terminator.

[0064] The above-mentioned p35S-30B plasmid is described in the following literature: Jia HG, Pang Y Q and Fang RX (2003) Agroinoculation as a simple way to deliver a Tobacco mosaicvirus-based expression vector. Acta Botanica Sinica, 45(7):770-773. The specific construction method is as follows: First, obtain the functional region (including the RdRp gene of TMV, the MP gene of TMV and the CP gene of TMGMV) from the 30B vector. Then, insert the functional region between the 35S promoter and the 35S terminator of the pCassKS vector through the multiple cloning site to obtain a vector containing the functional region expression cassette. Then, obtain the expression cassette with the 35S promoter, functional region and 35S terminator from the vector containing the functional region expression cassette. Finally, clone the expression cassette into the pCAMBIA1300 vector to obtain the p35S-30B plasmid. The 30B vector is described in the following literature: Shivprasad, S., Pogue, GP, Lewandowski, DJ, Hidalgo, J., Donson, J., Grill, LK, and Dawson, WO (1999) Heterologous sequences greatly affect foreign gene expression in Tobacco mosaic virus-based vectors. Virology, 255:312-323.

[0065] The 16c transgenic material of Nicotiana benthamiana in the following examples is described in the literature “Ruiz, MT, Voinnet, O. and Baulcombe, DC (1998) Initiation and maintenance of virus-induced gene silencing. Plant Cell 10, 937-946.”

[0066] The vector pGD-VSRs, which are the VSR silencing repressors in the following examples, are described in the literature “Gao,Q.,Xu,WY,Yan,T.,Fang,XD,Cao,Q.,Zhang,ZJ,Ding,ZH,Wang,Y.,and Wang,XB(2019).Rescue of a plant cytorhabdovirus as versatile expression platforms for planthopper and cereal genomic studies.New Phytol 223(4):2120-2133.”

[0067] The Western blot detection method in the following examples is as follows: Tobacco leaf samples were thoroughly ground into powder in a mortar pre-cooled with liquid nitrogen. 2 ml of protein extraction buffer [50 mM Tris (pH 7.5), 150 mM NaCl, 10% glycerol, 1.0% Triton X-100, 5 mM β-mercaptoethanol, 20 mM Imidazole, 1×complete protease inhibitor cocktail] was added per gram of leaf sample. The mixture was thoroughly mixed and incubated at 4°C for 30 min by rotation. Then, the sample was centrifuged at 4°C and 13000 rpm for 15 min, and the supernatant was collected. This centrifugation was repeated 2-3 times. Finally, add an equal volume of 2×SDS loading buffer [100mM Tris-Cl (pH 6.8), 4% (w / v) SDS, 0.2% (w / v) bromophenol blue, 20% (v / v) glycerol, 200mM DTT (dithiothreitol)] to the supernatant, mix thoroughly, boil in water for 15 min, and then centrifuge at 4°C for 3 min. After separating the protein by SDS-PAGE, transfer the supernatant sample to a PVDF membrane for Western blotting. After blocking with skim milk powder, add primary antibody [1:5000 diluted anti-Cas9 (Merck Millipore, Cat no. MAC133, Massachusetts, USA); Anti-His Antibody, Tianjin, Beijing, Cat no. AB102-02] and incubate at room temperature for 2 hours. Wash the membrane 3 times, 10 min each time. Add secondary antibody (rabbit secondary antibody, Promega, Madison, WI USA, Cat no. W4028; mouse secondary antibody: Anti-Mouse IgG (H+L), HRP Conjugate, Promega, Madison, WI USA, Cat no. W4021) and incubate at room temperature for 1 hour. Wash the membrane 3 times again. Finally, add chromogenic solution (Thermo Scientific™, Rockford, USA, Cat no. 34075) for reaction. Detect the signal using an Azure c600 instrument.

[0068] The following examples illustrate the method for transient expression of Agrobacterium in tobacco (N. benthamiana): Agrobacterium GV3101 carrying the target vector was cultured overnight at 28°C in 4 ml LB liquid medium containing 25 mg / L kanamycin (Kan) and 25 mg / L rifampin (Rif), and then reactivated in 20 ml LB liquid medium at a 1% (v / v) inoculation rate until OD.600 When the concentration was 1.2, bacteria were collected after centrifugation at 7000 rpm for 15 min and fully resuspended in MMA solution (10 mM MgCl2, 10 mM MES pH 5.6, 100 μM acetylsylgenone) (OD). 600 =0.8) After standing at room temperature for 1 hour, inject 5-6 leaf-aged tobacco (N. benthamiana) leaves into each tobacco plant using a needleless syringe. Inject 3 fully expanded leaves into each tobacco plant. After injection, the tobacco plants are cultured in a greenhouse (22℃, 16h light / 8h dark) (protein expression: 3-7 days; gene editing: 7-15 days).

[0069] Example 1, pAT- trans Construction of MP-Cas9-mediated gene editing system and detection of Cas9 protein expression level

[0070] I. pAT- trans Construction of MP vector

[0071] 1. The TMV virus expression vector pAT was double-digested with ZraⅠ and AscⅠ to obtain a 13kp digested pAT vector.

[0072] 2. Using the puc57-ZrAsBq plasmid (synthesized by Beijing Qingke Biotechnology Co., Ltd., China) containing the DNA molecule shown in SEQ ID No. 3 (optimized ZrAsBq) as a template, PCR amplification was performed using primers DMZR-F and DMZR-R to obtain the PCR product. The primer sequences are as follows:

[0073] DMZR-F: 5'-AGAAAGAGCGGGGACGTCACGACGTTCATTGGA-3';

[0074] DMZR-R: 5'-ACCATTAATGGCGCGCCGGATTGGAAGTAGAGG-3'.

[0075] 3. Using recombinant enzyme (Trelief) TM The SoSoo Cloning Kit Ver.2 (Cat no. TSV-S2, Beijing Qingke Biotechnology Co., Ltd., China) recombined the PCR product from step 2 into the enzyme-digested pAT vector from step 1 to obtain the recombinant vector pAT-ΔMP with MP deletion expression.

[0076] 4. Containing “P” as shown in SEQ ID No. 4 NOS Promoter - Luc gene (including introns) - T NOS Termination child expression box (P) NOSThe nucleotide sequence of the promoter is shown in positions 7-313 of SEQ ID No. 4, T NOS Using the T-LucINT plasmid (with the nucleotide sequence of the terminator shown in positions 2312-2575 of SEQ ID No. 4) as a template, PCR amplification was performed using primer pairs Pnos-ΔM-F and ΔM-pnos-R to obtain P... NOS Promoter fragment; then, using the T-LucINT plasmid as a template, PCR amplification was performed using primer pairs ΔM-pnos-F and NOS-ΔM-R to obtain T... NOS The terminator fragment was then used; using the pAT vector as a template, PCR amplification was performed using primer pairs TMV-mp-F and TMV-mp-R to obtain the MP-ORF gene fragment (encoding gene of the motor protein MP). The encoding gene of the motor protein MP is shown in SEQ ID No. 6, and the amino acid sequence of the encoded motor protein MP is shown in SEQ ID No. 5. The primer sequences are as follows:

[0077] Pnos-ΔM-F: 5'-ttcctttaacaactagagccatggatccagatccggtgcaga-3';

[0078] ΔM-pnos-R: 5'-ctgtcaaacactgatagtttgaaccgcaacgttgaaggag-3';

[0079] ΔM-pnos-F:5'- tcgtttcccgccttcagttt ccgatctagtaacatagatg-3';

[0080] NOS-ΔM-R:5'- cgccgaatcggattcgttttaa gaatttccccgatcgttcaa-3';

[0081] TMV-mp-F: 5'-ttaaaacgaatccgattcggcg-3';

[0082] TMV-mp-R: 5'-atggctctagttgttaaaggaa-3'.

[0083] 5. Using recombinant enzyme (Trelief) TM SoSoo Cloning Kit Ver.2, Cat no. TSV-S2, Beijing Qingke Biotechnology Co., Ltd., China) will use the three fragments P obtained in step 4. NOS promoter fragment, T NOS The terminator fragment and the MP-ORF gene fragment were integrated into the Pme I site of the recombinant vector pAT-ΔMP to obtain the recombinant vector pAT-trans MP. Recombinant vector pAT- trans MP is a vector obtained by trans-expressing MP in the TMV viral expression vector pAT, that is, transferring the MP reading frame that regulates expression in the TMV genome of the TMV viral expression vector pAT to the P vector located downstream of the TMV genome. NOS Promoters and T NOS Between terminators, independent MP expression boxes are formed. MP expression boxes (i.e., P...) NOS -MP-T NOS The expression box includes P in sequence. NOS The promoter (shown in positions 7-313 of SEQ ID No. 4), the gene encoding the motor protein MP (shown in SEQ ID No. 6), and T NOS Terminator (as shown in bits 2312-2575 of SEQ ID No. 4).

[0084] II. pAT- trans Construction of MP-Cas9-mediated gene editing system and detection of Cas9 protein expression level

[0085] pAT- constructed in step one trans The gene encoding the Cas9-6xHis fusion protein was inserted into the TMV genome on the MP vector to obtain pAT- trans The MP-Cas9-mediated gene editing system was studied, and the expression level of its CRISPR-associated protein 9 (Cas9) (162 kDa) was analyzed.

[0086] 1. pAT- trans Construction of MP-Cas9-mediated gene editing system

[0087] 1) Using a TKC plasmid containing the CRISPR-Cas9 gene as a template, PCR amplification was performed using primer pairs pAmT-NLS-Cas9-PKC-F and pAmT-CsAS9-R to obtain a 4,177 bp gene fragment encoding the Cas9-6xHis fusion protein (the nucleotide sequence of this gene fragment is shown in SEQ ID No. 7). The primer sequences are as follows:

[0088] pAmT-NLS-Cas9-PKC-F: 5'-gcgagaacctctacttccaatccggcatgctcaccctgttgtttgg-3'; pAmT-Cas9-R: 5'-acctcaagttgcaggaccctcgagttagtgatggtgatggtgatgatcgccgccgagttgtgtgaga-3'.

[0089] 2) The 4177 bp gene fragment encoding the Cas9-6xHis fusion protein from step 1) was inserted into pAT- using homologous recombination. trans Between the Asc I and Xho I restriction sites of the MP vector, the recombinant vector pAT- was obtained. trans MP-Cas9, the recombinant vector pAT- trans MP-Cas9 expresses the Cas9-6xHis fusion protein (162 kDa) shown in SEQ ID No. 8.

[0090] 2. The recombinant vector pAT- constructed in step 1... trans MP-Cas9 was transformed into Agrobacterium GV3101, and the exogenous protein Cas9 was expressed using an Agrobacterium transient expression system in Nicotiana benthamiana leaves. The expression levels of exogenous Cas9 were compared and analyzed by Western blot. Simultaneously, pAT- trans Leaves of the MP empty vector were used as a negative control.

[0091] Western blot results showed that from pAT- trans The protein sample obtained by the MP-Cas9 vector showed a clear Cas9-specific expression product at approximately 160 kDa. Figure 2 AB), while from the empty carrier (pAT- trans No expression product signal was found in protein samples obtained from pAT-Cas9 (MP) and the unmodified vector pAT-Cas9, therefore, Cas9 protein in pAT- trans Successful expression was achieved in the MP vector.

[0092] Example 2, pAT- trans Application of MP-Cas9-mediated gene editing system in gene editing

[0093] I. pAT- trans Construction of MP-Cas9-sgRNA recombinant vector

[0094] To verify the bioactivity of the expressed Cas9 product, this invention is based on the pAT- established in step two of Example 1. trans MP-Cas9-mediated gene editing system, in recombinant vector pAT- trans An expression cassette for the target gene's sgRNA is inserted into MP-Cas9, enabling the Cas9-6xHis fusion protein expressed by TMV virus replication to be tandemly expressed with the sgRNA carrying the target gene in T-DNA, yielding the recombinant vector pAT- transMP-Cas9-sgRNA. The specific steps are as follows:

[0095] 1. Recombinant vector pAT- trans Building MP-Cas9-pds360

[0096] Based on the NbPDS gene sequence, the following sgRNA target sequence for NbPDS, pds 360: 5'-gctgcatggaaagatgatgatgg-3', was designed. The sgRNA coding sequence shown in SEQ ID No. 9 was artificially synthesized and ligated into pAT- trans At the Kpn I restriction site of the MP vector, the recombinant vector pAT- for editing the NbPDS gene was obtained. trans MP-Cas9-pds360. Recombinant vector pAT- trans The structural diagram of MP-Cas9-pds360 is shown below. Figure 2 As shown in C.

[0097] 2. Recombinant vector pAT- trans Construction of MP-Cas9-gfp

[0098] Based on the GFP gene sequence, the following sgRNA target sequence gfp targeting GFP was designed: 5'-cgcgctgaagtcaagttcgaagg-3'. The sgRNA coding sequence shown in SEQ ID No. 10 was artificially synthesized and ligated into pAT- trans At the Kpn I restriction site of the MP vector, the recombinant vector pAT- for editing the GFP gene is obtained. trans MP-Cas9-gfp. Recombinant vector pAT- trans A schematic diagram of the MP-Cas9-gfp structure is shown below. Figure 2 As shown in C.

[0099] II. pAT- trans Application of MP-Cas9-sgRNA recombinant vector in editing target genes

[0100] The recombinant vector pAT- trans MP-Cas9-pds360 and the vector pGD-VSRs silencing repressor were introduced into Agrobacterium GV3101 to obtain recombinant bacteria pAT- transMP-Cas9-pds360 / GV3101 and pGD-VSRs / GV3101 were used. The two recombinant bacteria were then mixed at a 1:1 volume ratio and co-injected into leaves of *Nicotiana benthamiana*, with MMA buffer injection serving as a negative control (mock). Three tobacco plants were injected, with three leaves from each plant, and each leaf was injected with only one vector. The leaf phenotype was observed after injection, and DNA samples from leaves exhibiting a bleached and wrinkled phenotype were extracted 7-14 days after transient expression in the tobacco leaves for gene editing detection. The primer sequences for detecting the PDS gene editing target sequence are as follows:

[0101] nbpds-check-f:5'-TTTTAAACTGAGTCAATTTTAACCG-3';

[0102] nbpds-check-r: 5'-TATGAGTCACCATACGAGGTTAGCAG-3'.

[0103] The recombinant vector pAT- trans The vector pGD-VSRs, which contains MP-Cas9-gfp and VSRs silencing repressors, was introduced into Agrobacterium GV3101 to obtain recombinant bacteria pAT- trans MP-Cas9-gfp / GV3101 and pGD-VSRs / GV3101 were then used. The two recombinant bacteria were then mixed at a 1:1 volume ratio and co-injected into the leaves of 16c transgenic Nicotiana benthamiana, simultaneously with the co-injection of pAT- trans MP-Cas9 and pGD-VSRs were used as negative controls. Three tobacco plants were injected, with three leaves from each plant. Each leaf was injected with only one vector. The leaf phenotype was observed after injection, and DNA samples from leaves exhibiting GFP fluorescence quenching were extracted 7-14 days after transient expression in the tobacco for gene editing detection. The primer sequences for detecting the GFP gene editing target sequence are as follows:

[0104] GFP-F: 5'-ATGAGTAAAGGAGAAGAACTTTTC-3';

[0105] GFP-R: 5'-TTTGTATAGTTCATCCATGC-3'.

[0106] The results showed that, compared with the leaves of normally growing negative control plants, the leaves injected with pAT- trans The leaves of MP-Cas9-pds360 *Nicotiana benthamiana* exhibit the classic phenotype of the PDS gene mutation, namely, a bleached and wrinkled appearance. Figure 2D). ApeK I digestion and sequencing of PCR products from leaf DNA samples showed that only after injection of pAT- trans Base editing occurred in leaf samples of the MP-Cas9-pds360 editing vector, targeting the NbPDS gene. Figure 2 E) This result indicates that the single-vector-mediated expression of Cas9 constructed in this invention successfully edited the NbPDS target gene. Additionally, during pAT- injection... trans The GFP gene was also successfully edited in tobacco 16c leaves with MP-Cas9-gfp, thereby quenching the green fluorescence expression of GFP. Figure 2 FG).

[0107] The above results indicate that pAT- trans MP vectors can effectively express large Cas9 proteins up to 162 kDa. The single vectors created can simultaneously express Cas9 protein and the target RNA sequence of the corresponding target gene, and achieve ideal editing results on the target gene, showing broad application potential in gene editing.

[0108] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. pAT- trans Application of MP vectors in expressing high molecular weight proteins or preparing products expressing high molecular weight proteins; The pAT- trans The MP vector is obtained by deleting the gene encoding the motility protein MP that regulates expression in the viral genome of the tobacco mosaic virus expression vector, and then inserting the expression cassette of the motility protein MP downstream of the viral genome in the same T-DNA region of the tobacco mosaic virus expression vector; in the tobacco mosaic virus expression vector, the gene encoding the motility protein MP and the gene encoding the high molecular weight protein are expressed separately by their respective promoters. The amino acid sequence of the motor protein MP is shown in SEQ ID No. 5; The high molecular weight protein is a protein with a molecular weight greater than 150 kDa; The expression cassette of the motor protein MP includes P in sequence. NOS The promoter, the gene encoding the motor protein MP, and T NOS Termination of contract.

2. The application according to claim 1, characterized in that: The P NOS The promoter is the DNA molecule shown in positions 7-313 of SEQ ID No. 4; The gene encoding the motor protein MP is a DNA molecule as described in either (A1) or (A2): (A1) The DNA molecule shown in SEQ ID No. 6; (A2) A DNA molecule that has more than 70% identity with SEQ ID No. 6 and encodes the said motion protein MP; The terminator is the DNA molecule represented by positions 2312-2575 of SEQ ID No.

4.

3. A vector for plant gene editing, said vector being the pAT- as described in claim 1 or 2. trans The vector obtained by linking the Cas9 nuclease-encoding gene into the viral genome of the MP vector.

4. The carrier according to claim 3, characterized in that: The vector also includes an sgRNA expression cassette that targets the target gene.

5. The use of the carrier according to claim 3 or 4 in any of the following 1)-5): 1) Plant gene editing: 2) Prepare plant gene-edited products; 3) Preparation of plant mutants; 4) Study the function of plant proteins or genes; 5) Prepare products for research on plant protein or gene function.

6. Either method b1) or b2) below: b1) A method for expressing a high molecular weight protein, comprising the steps of: expressing the gene encoding the high molecular weight protein via pAT- as described in any one of claims 1-3. trans MP vectors are introduced into host cells to achieve the expression or preparation of high molecular weight proteins; b2) A method for plant gene editing, comprising the following steps: introducing the vector of claim 4 or 5 into a plant to achieve plant gene editing; The high molecular weight protein is a protein with a molecular weight greater than 150 kDa.

Images