Application of ZmRIN4 protein in regulating maize root development

Abstract

The application discloses application of ZmRIN4 protein in regulating corn root development and belongs to the technical field of biological breeding. The technical problem to be solved by the application is how to regulate plant root development. In order to solve the technical problem, the application provides application of ZmRIN4 protein and a coding gene thereof in regulating plant root development, wherein the ZmRIN4 protein is a protein with an amino acid sequence shown in SEQ ID No. 2. The application first discloses the role of ZmRIN4 in regulating corn root development, and can be applied to high-yield corn breeding with high density and has wide market prospects.

Description

Technical Field

[0001] This application belongs to the field of biological breeding technology and discloses the application of ZmRIN4 protein in regulating maize root development. Background Technology

[0002] Plant roots have the potential to improve plant growth and crop productivity. Lateral roots, in particular, are vital organs for absorbing water and nutrients and coping with stress, playing a crucial role in adapting to various environmental conditions. Maize is my country's largest grain crop, ranking first in both yield and planting area, and plays a vital role in ensuring economic and social security. Maize is one of the dryland crops with high water requirements and is relatively sensitive to water stress. Drought is one of the important abiotic stresses that restricts maize yield and threatens food security. Root phenotypic characteristics are an important means of evaluating maize's stress resistance. Root phenotypic traits related to stress resistance have been proven to include root length, root growth angle, root biomass, total root number, number of root branches, and the number, angle, and layer of aerial roots. Generally, maize varieties with well-developed root systems have stronger lodging resistance.

[0003] As the only underground organ of a plant, the root system plays a crucial role in water and nutrient absorption and lodging resistance. Corn roots are fibrous; those growing from underground stem nodes are called underground roots, while those growing from above-ground stem nodes are called aerial roots or supporting roots. The functions of the corn root system are multifaceted: absorption – the distribution of roots in the soil affects the strength of their absorption of substances; a strong root system can absorb abundant water and minerals and has relatively high resistance to adverse conditions. In addition, it has a relatively high absorption rate of organic matter such as amino acids, amides, and glucose. These substances participate in the plant's metabolic processes; ammonia and nitrate nitrogen absorbed from the soil can be converted into organic compounds through the corn root system to participate in the construction and development of the above-ground parts. Fixation and support – compared to other crops, corn plants are relatively tall, resulting in a much larger and more complex root system. This complex root structure can resist wind and rain, preventing lodging. Aerial roots play a crucial role in the fixation and support of corn throughout its middle and later stages. A strong root system can provide more nutrients for plant growth, thereby increasing yield. At the same time, the above-ground and underground parts of crops are closely related. Quantitative analysis and research on crop root systems can further help us understand the structure and morphology of the above-ground parts of corn.

[0004] Significant progress has been made in identifying loci associated with maize root traits. The growth of maize primary roots depends on flavonoid biosynthesis and auxin signal transduction, and two candidate genes, rtcs and Zm00001d012781, have been identified. QTL mapping for maize root number, length, direction, and branching has identified 15 QTLs, with each QTL explaining 0.44%–13.5% of the phenotypic variation. Comparison of transcriptome data from drought-resistant and drought-sensitive varieties has identified 343 and 177 differentially expressed genes, respectively, and 10 central genes involved in two important related modules have been identified. GWAS analysis of drought tolerance in maize seedlings has identified 42 candidate genes; overexpression of the ZmVPP1 gene enhances photosynthetic efficiency and promotes root development, thereby improving drought tolerance. The genetic structure of maize root hair length has been analyzed, revealing 14 SNP loci significantly associated with root hairs.

[0005] Although some QTLs related to maize root system traits have been identified, the root system is a complex quantitative trait regulated by multiple genes. Existing studies have only been able to detect a limited number of genetic loci in their respective research populations. Therefore, genetic analysis of maize root system-related traits is still needed to deepen the understanding of the molecular mechanisms of variation in maize root traits. This is of great theoretical significance for exploring crop resources that are resistant to stress and adapt to future climate change. Summary of the Invention

[0006] The technical problem this application aims to solve is how to regulate the root development of plants.

[0007] To solve the above-mentioned technical problems, this application provides an application, wherein the application is the application of a protein or a substance that regulates gene expression or a substance that regulates the content of the protein in any of the following: the gene encodes the protein, and the protein is ZmRIN4 protein.

[0008] A1) Application in regulating the development of plant underground root systems;

[0009] A2) Application in the preparation of products that regulate the development of plant underground root systems;

[0010] A3) Application in regulating the number and / or quantity of aerial root layers in plants;

[0011] A4) Application in the preparation of products that regulate the number and / or quantity of aerial root layers in plants;

[0012] A5) Applications in plant breeding or plant-assisted breeding;

[0013] The ZmRIN4 protein may be any of the following proteins:

[0014] a1) The amino acid sequence is that of the protein shown in SEQ ID No. 2;

[0015] a2) A protein obtained by substituting, deleting and / or adding amino acid residues of the amino acid sequence shown in a1), which has more than 80% identity with the amino acid sequence shown in a1).

[0016] a3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of a1) or a2).

[0017] Furthermore, the indicators for examining the development of the plant's underground root system include taproot length, number of root branches, root surface area, taproot projected area, and / or number of root tips.

[0018] Furthermore, the number and / or quantity of aerial root layers in the plant can be root traits during the mature stage of the plant.

[0019] Furthermore, the root traits of the mature plant stage also include: root length, root volume and / or root biomass.

[0020] Furthermore, in the method described, the ZmRIN4 protein may be derived from corn.

[0021] SEQ ID No.1 consists of 80 amino acid residues.

[0022] The proteins mentioned above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0023] The protein tag refers to a polypeptide or protein fused with a target protein using in vitro DNA recombination technology for expression, detection, tracing, and / or purification of the target protein. The protein tag may be a Flag protein tag, His protein tag, MBP protein tag, HA protein tag, myc protein tag, GST protein tag, and / or SUMO protein tag, etc.

[0024] Further, the connection described in a3) may be a peptide bond formed by dehydration condensation between the N-terminus of the tag and the C-terminus of the protein described in a1) or a2), or a peptide bond formed by dehydration condensation between the C-terminus of the tag and the N-terminus of the protein described in a1) or a2).

[0025] Furthermore, in the aforementioned applications, the evaluation indicators for plant breeding include root development.

[0026] Furthermore, in the aforementioned applications, the purpose of plant breeding includes cultivating plants with improved root development.

[0027] Furthermore, in the aforementioned applications, the target plant with improved development can be used for plant breeding.

[0028] Furthermore, in the aforementioned applications, the purpose of plant breeding includes cultivating plants with reduced root development.

[0029] Furthermore, in the aforementioned applications, the plants with reduced root development can be used for research on the mechanisms of plant root development.

[0030] In this application, the root system can be a seedling root system or a mature plant root system. In some embodiments of this application, the mature plant period refers to the corn flowering period and within 21 days after flowering.

[0031] In this application, the root development assessment indicators include the length of the plant's taproot, the number of root branches, the root surface area, the projected area of ​​the taproot, the number of root tips, and the number of aerial root layers.

[0032] In this application, the improved root development is manifested as an increase or enhancement in the plant's taproot length, number of root branches, root surface area, taproot projected area, number of root tips, and / or number of aerial root layers (compared to the wild-type control).

[0033] In this application, the reduced root development is manifested as a decrease or reduction in the plant's taproot length, number of root branches, root surface area, taproot projected area, number of root tips, and / or number of aerial root layers (compared to the wild-type control).

[0034] Furthermore, in the aforementioned application, the substance regulating gene expression or the substance regulating protein content is a biological material, which may be any of the following:

[0035] B1) Nucleic acid molecules that inhibit or reduce the expression of the gene encoding the ZmRIN4 protein or inhibit or reduce the content of the ZmRIN4 protein;

[0036] B2), an expression cassette containing the nucleic acid molecule described in B1);

[0037] B3), a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0038] B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3);

[0039] B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), a transgenic plant cell line containing the expression cassette described in B2), or a transgenic plant cell line containing the recombinant vector described in B3);

[0040] B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), transgenic plant tissue containing the expression cassette described in B2), or transgenic plant tissue containing the recombinant vector described in B3);

[0041] B7) Transgenic plant organs containing the nucleic acid molecules described in B1), transgenic plant organs containing the expression cassette described in B2), or transgenic plant organs containing the recombinant vector described in B3);

[0042] B8), nucleic acid molecules encoding the ZmRIN4 protein;

[0043] B9) Expression cassettes, recombinant vectors, recombinant microorganisms or transgenic plant cell lines containing the nucleic acid molecules described in B8).

[0044] Furthermore, in the aforementioned applications, the nucleic acid molecule in B1) may be a gRNA (gRNA gene) targeting the gene or a DNA molecule encoding the gRNA.

[0045] Furthermore, the nucleic acid molecule described in B8) can be any one of the following DNA molecules described in g1)-g3):

[0046] g1) The coding sequence of the coding strand is the DNA molecule of SEQ ID No. 1;

[0047] g2) The nucleotide sequence of the coding strand is the DNA molecule of SEQ ID No. 3;

[0048] g3) is a DNA molecule that has more than 80% identity with the DNA molecule described in g1) or g2) and regulates plant stress resistance.

[0049] Furthermore, in the above applications, the target nucleotide sequence of the gRNA can be positions 2759-2778 of SEQ ID No. 3 (5'-GGCCGTCCCTTGCCAAAGTT-3').

[0050] Furthermore, the expression cassette described in B2) refers to DNA capable of expressing the gRNA in a host cell, which may include not only a promoter that initiates sgRNA gene transcription but also a terminator that terminates sgRNA gene transcription.

[0051] Furthermore, the recombinant microorganisms mentioned in B4) can specifically be yeast, bacteria, algae, and fungi.

[0052] Furthermore, the plant tissues described in B6) may be derived from roots, stems, leaves, flowers, fruits, seeds, pollen, embryos, and anthers.

[0053] Furthermore, the transgenic plant organs described in B7) can be the roots, stems, leaves, flowers, fruits, and seeds of the transgenic plant.

[0054] Furthermore, the transgenic plant cell lines, transgenic plant tissues, and / or transgenic plant organs may or may not include propagation material.

[0055] Furthermore, the expression cassette described in B9) refers to DNA capable of expressing the ZmRIN4 protein in a host cell. This DNA may include not only a promoter that initiates transcription of the ZmRIN4 protein-encoding gene, but also a terminator that terminates transcription of the ZmRIN4 protein-encoding gene.

[0056] Furthermore, the expression box described in B9 may also include an enhancer subsequence.

[0057] Furthermore, the recombinant vector described in B9) may contain the DNA molecule shown in SEQ ID No. 1 for encoding the ZmRIN4 protein.

[0058] Furthermore, in the aforementioned application, the plant is selected from monocotyledonous plants.

[0059] Furthermore, in the aforementioned application, the monocotyledonous plant is selected from grasses.

[0060] Furthermore, in the aforementioned application, the grass plant is selected from plants of the genus *Zea*.

[0061] Furthermore, in the aforementioned application, the *Zea* species is selected from *Zea mays* L.

[0062] This application also provides a method for increasing or improving plant root development, the method comprising step M1) or M2).

[0063] M1) The expression level of the ZmRIN4 protein coding gene and / or the content of the ZmRIN4 protein in the recipient plant are reduced by knocking out the ZmRIN4 protein coding gene in the recipient plant using a CRISPR / Cas system; the recipient plant is a plant containing the ZmRIN4 protein coding gene.

[0064] M2) The gene in the recipient plant is mutated using any one, two, or three of the following mutations (M2-1)-M2-5), wherein the recipient plant is a plant containing the gene encoding the ZmRIN4 protein, and the plant is maize.

[0065] M2-1) The nucleotide AA at positions 2773-2774 of the DNA molecule in the genome of the recipient maize, which has the nucleotide sequence of SEQ ID No.3, is deleted;

[0066] M2-2), the nucleotide sequence of the DNA molecule with the nucleotide sequence of SEQ ID No.3 in the genome of the recipient maize was deleted from positions 2776-2796;

[0067] M2-3), the nucleotide A at position 2773 of the DNA molecule in the genome of the recipient maize is deleted, which has the nucleotide sequence of SEQ ID No. 3;

[0068] M2-4), the nucleotide sequence of the recipient maize genome is the deletion of nucleotides AAA at positions 2772-2774 of the DNA molecule with the nucleotide sequence of SEQ ID No. 3;

[0069] M2-5) Replace nucleotides AAA at positions 2773-2775 of the DNA molecule with SEQ ID No. 3 in the genome of the recipient maize with AAAA.

[0070] Furthermore, in the method, M1) includes the step of introducing a gRNA gene encoding a gene targeting the ZmRIN4 protein and a gene encoding the Cas protein into the recipient maize.

[0071] Furthermore, in the method, the Cas protein may be the Cas9 protein.

[0072] Furthermore, in the method, the target nucleotide sequence of the gRNA gene may be positions 2759-2778 of SEQ ID No. 3 (5'-GGCCGTCCCTTGCCAAAGTT-3').

[0073] Furthermore, in the method described, the plant is selected from monocotyledonous plants.

[0074] Furthermore, in the method, the monocotyledonous plant is selected from grasses.

[0075] Furthermore, in the method, the grass plant is selected from plants of the genus *Zea*.

[0076] Furthermore, in the method, the maize plant is selected from Zea mays L.

[0077] Furthermore, in the method, the coding sequence of the ZmRIN4 protein-coding gene is the DNA molecule shown in SEQ ID No. 1. The genomic nucleotide sequence of the ZmRIN4 protein-coding gene is SEQ ID No. 3.

[0078] The methods for increasing or improving plant root development provided in this application, and the resulting target plants, can be used for plant density tolerance, lodging resistance breeding and / or assisted breeding, as well as for the study of root development mechanisms.

[0079] This application also provides a method for reducing plant root development, the method comprising the steps of upregulating or increasing or promoting the expression of the ZmRIN4 protein encoding gene in the recipient plant or upregulating or increasing or promoting the content of the ZmRIN4 protein in the recipient plant, thereby reducing the root development of the recipient plant (the root development of the target plant is lower than that of the recipient / control plant).

[0080] Furthermore, in the method, the upregulation, enhancement, or promotion of the expression of the ZmRIN4 protein encoding gene in the recipient plant, or the upregulation, enhancement, or promotion of the ZmRIN4 protein content in the recipient plant, is achieved by introducing the ZmRIN4 protein encoding gene into the recipient plant.

[0081] Furthermore, in the method, the encoding gene can be any one of the following (g1)-g3):

[0082] g1) The coding sequence of the coding strand is the DNA molecule of SEQ ID No. 1;

[0083] g2) The nucleotide sequence of the coding strand is the DNA molecule of SEQ ID No. 3;

[0084] g3) is a DNA molecule that has more than 80% identity with the DNA molecule described in g1) or g2) and regulates plant stress resistance.

[0085] Furthermore, in the method described above, the gene encoding the ZmRIN4 protein is introduced into the recipient plant in the form of a recombinant expression vector.

[0086] In some embodiments of this application, the recombinant expression vector is pCAMBIA3301-ZmRIN4, and its physical spectrum is as follows: Figure 1 As shown. The gene encoding the ZmRIN4 protein is transcribed and expressed by the Ubi promoter.

[0087] Furthermore, in the method described, the plant is selected from monocotyledonous plants.

[0088] Furthermore, in the method, the monocotyledonous plant is selected from grasses.

[0089] Furthermore, in the method, the grass plant is selected from plants of the genus *Zea*.

[0090] Furthermore, in the method, the maize plant is selected from Zea mays L.

[0091] The method for reducing plant root development provided in this application and the target plants obtained therefrom can be used for research on the mechanism of plant root development.

[0092] In this application, the "identity of more than 80%" can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. The "identity of more than 85%" can be at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. The "identity of more than 90%" can be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. The 95% or higher level of identity can be at least 95%, 96%, 97%, 98%, or 99% identity.

[0093] In this application, identity refers to the similarity of amino acid sequences or nucleotide sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, by using blastp as the procedure, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, and setting the Gap existence cost, Per residue gap cost, and Lambdaratio to 11, 1, and 0.85 (default values) respectively, a search can be performed to calculate the identity of amino acid sequences, and then the identity value (%) can be obtained.

[0094] In this application, the substance regulating the protein content can be a substance that downregulates, reduces, or knocks out the protein-coding gene and / or downregulates or reduces the expression of the protein-coding gene. The regulation of plant root development can be aimed at improving plant root development.

[0095] In this application, the substance regulating gene expression can be a substance that performs at least one of the following six types of regulation: 1) regulation at the gene transcription level; 2) post-transcriptional regulation of the gene (i.e., regulation of splicing or processing of the primary transcript of the gene); 3) regulation of RNA transport of the gene (i.e., regulation of mRNA transport of the gene from the nucleus to the cytoplasm); 4) regulation of gene translation; 5) regulation of mRNA degradation of the gene; and 6) post-translational regulation of the gene (i.e., regulation of the content or activity of the protein translated by the gene).

[0096] In this application, the regulation of gene expression can be achieved by inhibiting or reducing gene expression, which can be achieved by gene knockout or gene silencing.

[0097] Gene knockout refers to the phenomenon of inactivating a specific target gene through homologous recombination. Gene knockout inactivates a specific target gene by altering its DNA sequence.

[0098] Gene silencing refers to the phenomenon of preventing or reducing gene expression without damaging the original DNA. Gene silencing presupposes no change in the DNA sequence, resulting in the absence or reduction of gene expression. Gene silencing can occur at two levels: transcriptional silencing due to DNA methylation, heterochromatinization, and position effects; and post-transcriptional gene silencing, which inactivates the gene at the post-transcriptional level through specific inhibition of target RNA. This includes antisense RNA, co-suppression, gene quelling, RNA interference (RNAi), and microRNA (miRNA)-mediated translational repression.

[0099] In this application, the substance regulating gene expression can be a reagent that inhibits or reduces the expression of the gene. The reagent that inhibits or reduces the expression of the gene can be a gene knockout reagent, such as a reagent that knocks out the gene through homologous recombination or a reagent that knocks out the gene through CRISPR-Cas9. The reagent that inhibits or reduces the expression of the gene can contain a polynucleotide that targets the gene, such as siRNA, shRNA, sgRNA, miRNA, or antisense RNA.

[0100] The beneficial technical effects achieved by this application are as follows:

[0101] 1. This application reveals for the first time the mechanism of ZmRIN4 in regulating maize root development, explores the application prospects of ZmRIN4 in maize bio-breeding, and provides new gene resources for high-yield and high-density maize breeding; it can be applied to high-density planting and lodging-resistant maize breeding and has broad market prospects.

[0102] 2. Nutrient absorption is crucial for maize during its growth and development. Plants cannot overcome resource scarcity through mere foraging behavior; instead, they adjust their overall growth and development by regulating root morphology, including root volume, surface area, root hair density, diameter, number, and spatial configuration in the soil. Analyzing the genetic basis of maize root structure formation and identifying superior alleles for root-related traits is significant for further improving maize's resistance to stress, density tolerance, and lodging resistance, providing new insights for improving maize root morphology and nutrient utilization efficiency. The ZmRIN4 gene's regulation of maize root development provides genetic resources for designing and breeding ideal root configurations, offering a reference for cultivating stress-resistant, high-yielding maize varieties. Attached Figure Description

[0103] Figure 1 The spectrum of the recombinant vector pCAMBIA3301-ZmRIN4.

[0104] Figure 2 The relative expression levels of the target gene in the overexpressing maize line and the non-transgenic control KN5585 were calculated.

[0105] Figure 3 This refers to the mutant genotype of the gene knockout line.

[0106] Figure 4 The results show the appearance of root development and the statistical results of root length at the seedling stage in maize lines with ZmRIN4 gene overexpression and knockout.

[0107] Figure 5 The results show the number of seedling branches in maize lines with ZmRIN4 gene overexpression and knockout.

[0108] Figure 6 Statistical results of root surface area at the seedling stage for ZmRIN4 gene overexpression and knockout maize lines.

[0109] Figure 7 Statistical results of the projected area of ​​the primary root at the seedling stage for maize lines with ZmRIN4 gene overexpression and knockout.

[0110] Figure 8 The results show the number of root tips at the seedling stage in maize lines with ZmRIN4 gene overexpression and knockout.

[0111] Figure 9 The root development appearance during flowering of maize lines with ZmRIN4 gene overexpression and knockout.

[0112] Figure 10 The appearance of aerial root development during flowering in maize lines with the ZmRIN4 gene knockout. Detailed Implementation

[0113] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0114] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0115] Unless otherwise specified, the quantitative experiments in the following examples were performed in triplicate, and the results were averaged.

[0116] The following examples use GraphPad Prism statistical software to process the data. The experimental results are expressed as mean ± standard deviation. The t-test is used, and P < 0.05 (*) indicates a significant difference, and P < 0.001 (***) indicates a highly significant difference.

[0117] The CRISPR / Cas9 gene editing vector CPB used in the following examples was kindly provided by the research group of Professor Xie Chuanxiao at the Institute of Crop Science, Chinese Academy of Agricultural Sciences, and is disclosed in the literature "Qi X, et al., Genome Editing Enables Next-Generation Hybrid Seed Production Technology. Molecular Plant, 2020, 13(9):1262-1269." The public can obtain the above-mentioned biological material from the applicant. The above-mentioned biological material is only used to repeat the experiments of this application and cannot be used for other purposes.

[0118] The P-Easy-blunt vector used in the following examples is a product of Beijing TransGen Biotech Co., Ltd., catalog number CB101-01;

[0119] The Escherichia coli DH5α / EC DH5α in the following examples is a product of Beijing Qingke Biotechnology Co., Ltd., catalog number TSC01;

[0120] The Agrobacterium GV3101 (pSoup) competent cells used in the following examples are products of Beijing Bomaide Gene Technology Co., Ltd., catalog number C314-01;

[0121] In the following embodiments FastPfu PCR SuperMix is ​​a product of Beijing TransGen Biotech Co., Ltd., with catalog number AS221-11.

[0122] The pCAMBIA3301 vector in the following examples was preserved by the applicant and disclosed in the literature "Zhang X, et al., Overexpression of a maize BR transcription factor ZmBZR1 in Arabidopsis enlarges organ and seed size of the transgenic plants. Plant Science, 2020, 292, 110378." The public can obtain the above-mentioned biological material from the applicant. The obtained biological material is only used to repeat the experiments of this application and cannot be used for other purposes.

[0123] The present application will now be described in further detail with reference to specific embodiments. The embodiments given are merely illustrative of the present application and are not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the present application in any way.

[0124] Example 1: ZmRIN4 protein and its gene

[0125] This application discloses the use of the ZmRIN4 protein and its encoding gene in regulating maize root development. The amino acid sequence of the ZmRIN4 protein is SEQ ID No. 2, and its encoding gene is the Zm00001eb280910 gene. The nucleotide sequence of the encoding sequence of the Zm00001eb280910 gene is SEQ ID No. 1, and the nucleotide sequence of the genome of the Zm00001eb280910 gene is SEQ ID No. 3.

[0126] Example 2: Preparation of overexpression lines

[0127] 2.1 Construction of overexpression vectors

[0128] (1) Cloning the target gene

[0129] The reverse-transcribed cDNA was used as a template for cloning the Zm00001eb280910 gene, and PCR amplification was performed using RIN4-FW / RIN4-RV primers. The cloning PCR reaction used... Amplification was performed using FastPfu PCR SuperMix.

[0130] The nucleotide sequence of primer RIN4-FW / RIN4-RV is as follows (5'-3'):

[0131] RIN4-FW: ATGGCGGAGGAATCAGGCC;

[0132] RIN4-RV: TCAGGATTGCGTAGGGCTGG.

[0133] The PCR reaction system is as follows: 1 μL template, 2 μL 2.5 mM dNTPs, 1 μL each of forward and reverse primers (10 μM), 4 μL 5×FastPfu Buffer, 2 μL Fast Pfu DNA polymerase, and ddH2O to a total volume of 20 μL.

[0134] The PCR reaction procedure was as follows: denaturation at 94℃ for 5 min; denaturation at 94℃ for 30 sec, annealing at 60℃ for 30 sec, extension at 72℃ for 1 min, for a total of 35 cycles; extension at 72℃ for 10 min.

[0135] After the amplified products were detected by agarose gel electrophoresis, the target band was cut off, and the total amount of DNA was estimated according to the brightness of the band in the Mark electrophoresis. An appropriate amount of elution buffer was added to make the final DNA concentration suitable for subsequent experiments, and the target fragment was recovered using the Tiangen DNA Recovery Kit.

[0136] (2) Constructing an intermediate carrier

[0137] The intermediate vector was constructed using a 9zf vector with a UBI promoter and homologous recombination. First, the 9zf vector was linearized by EcoRV digestion. The target fragment for homologous recombination was amplified using primers 9zf-RIN4-FW / 9zf-RIN4-RV (prepared in step (1)). Homologous sequences were added to both sides of the vector insertion site at the 5' end of the primers. The target gene was ligated into the 9zf vector using the principle of homologous recombination to construct the intermediate vector 9zf-ZmRIN4-Tnos. Subsequently, E. coli transformation and identification of positive recombinants were performed. First, 5 μL of the ligation product was added to 50 μL of Trans1-T1 competent E. coli cells thawed on ice, gently mixed, and incubated on ice for 30 min. Then, the cells were heat-shocked in a 42℃ water bath for 42 sec and immediately placed on ice for 2 min. Finally, 500 μL of antibiotic-free liquid LB medium was added, and the cells were cultured at 37℃ with shaking at 200 rpm for 1 h. Centrifuge at 3,000g for 2 min, discard some of the supernatant, and gently pipette the bacterial cells until fully resuspended. Spread the entire bacterial culture onto solid LB agar plates containing ampicillin and incubate overnight at 37°C. Select medium-sized single colonies and incubate in 5 mL of LB liquid medium containing antibiotics at 37°C with shaking at 200 rpm for approximately 10–16 h. Extract plasmids for restriction enzyme digestion, PCR, and sequencing identification. Sequencing results show that the structure of the intermediate vector 9zf-ZmRIN4-Tnos is: replacing the fragment between the two EcoRV restriction enzyme recognition sites of the 9zf vector with the DNA molecule whose nucleotide sequence is SEQ ID No. 1, while keeping the other nucleotide sequences of the 9zf vector unchanged. The correctly sequenced clones were used for subsequent construction of overexpression vectors.

[0138] The nucleotide sequences of primers 9zf-RIN4-FW / 9zf-RIN4-RV are as follows (5'-3'):

[0139] 9zf-RIN4-FW: GTTACTTCTGCAGGAATTCGATATC ATGGCGGAGGAATCAGGC (underlined parts are homologous arms);

[0140] 9zf-RIN4-RV: TAACGAGCTCTAGAAGCTTGATATC TCAGGATTGCGTAGGGCTGG (underscores indicate the homologous arm).

[0141] (3) Construction of overexpression vectors

[0142] The overexpression vector was constructed using pCAMBIA3301 via enzyme ligation. Based on the multiple cloning site on the vector, the pCAMBIA3301 vector and the intermediate vector 9zf-ZmRIN4-Tnos were double-digested with restriction endonucleases BamHI and AflII. The large fragment of pCAMBIA3301 and the small fragment of the intermediate vector 9zf-ZmRIN4-Tnos were recovered, and the two fragments were ligated together using T4 DNA ligase to construct the overexpression vector pCAMBIA3301-ZmRIN4-Tnos.

[0143] Vector linearization enzyme digestion system (20μL system): approximately 5μg of vector, 0.5μL of BamHI / AflII, 2μL of 10×CutSmart, and sterile water to a final volume of 20μL.

[0144] Enzyme digestion conditions: 37℃ water bath digestion (16h).

[0145] The enzyme digestion products were detected by 1% agarose gel electrophoresis, and the linearized vector was recovered according to the instructions of the Tiangen DNA Recovery Kit. The recombinant reaction system was designed based on the Seamless Assembly Cloning Kit from Sino-American Taihe Biotechnology Co., Ltd., using 20-60 ng of linearized vector and DNA fragments at a molar ratio of 3:1 to the vector.

[0146] The recombination reaction system is as follows (10 μL): 0.5-5 μL of target fragment, 0.5-5 μL of linearized vector, 5 μL of 2×SeamlessMaster Mix, and ddH2O to make up to a total volume of 10 μL.

[0147] Conditions for the recombination reaction: 50℃ for 15 min.

[0148] Subsequently, *E. coli* transformation and identification of positive recombinants were performed. 5 μL of the ligation product was added to 50 μL of *Trans1-T1* competent *E. coli* cells thawed on ice, gently mixed, and incubated on ice for 30 min. The cells were then heat-shocked at 42°C for 42 sec, immediately placed on ice for 2 min, and then added to 500 μL of antibiotic-free liquid LB medium. The cells were incubated at 37°C with shaking at 200 rpm for 1 h. After centrifugation at 3,000 g for 2 min, some supernatant was discarded, and the cells were gently resuspended by pipetting. All bacterial culture was spread onto solid LB agar plates containing kanamycin (hereinafter referred to as antibiotics) and incubated overnight at 37°C. Medium-sized single colonies were picked and incubated in 5 mL of antibiotic-containing LB liquid medium at 37°C with shaking at 200 rpm for approximately 10–16 h. Plasmids were extracted for enzyme digestion, PCR, and sequencing identification. Clones with correct sequencing were used for subsequent genetic transformation. The overexpression vector pCAMBIA3301-ZmRIN4 has a size of 10.749 kb. The nucleotide sequence of the recombinant vector pCAMBIA3301-ZmRIN4 is shown in Table 1. In the nucleotide sequence of pCAMBIA3301-ZmRIN4, positions 8428-10414 are the Ubi promoter sequence, positions 10433-10675 are the coding sequence of the Zm00001eb280910 gene (i.e., the gene encoding the ZmRIN4 protein), and positions 1-223 are the NOS terminator sequence. The map of pCAMBIA3301-ZmRIN4 is shown below. Figure 1 As shown.

[0149] 2.2 Construction of overexpression plants

[0150] Genetic transformation of maize was performed using the immature embryo transformation method, completed by the Life Science and Technology Center (Wuhan) of China Seed Group Co., Ltd. The overexpression recipient was the maize inbred line KN5585. Transgenic T0 seedlings were screened for herbicide resistance and identified as positive transgenic plants by PCR. After continuous self-pollination and genotyping, homozygous transgenic (OE-3, OE-4, OE-6, and OE-9) T3 generation seeds were obtained in the winter of 2021 and used for phenotypic testing in Hainan in 2022 and 2023. T3 generation plants were self-pollinated and multiplied to obtain the T4 generation, used for phenotypic testing in Changji, Xinjiang in the summer of 2023. T4 generation plants were self-pollinated and multiplied to obtain the T5 generation, used for phenotypic testing in Urumqi, Xinjiang in 2024. The preparation method of T0 transgenic maize is as follows:

[0151] The recombinant vector pCAMBIA3301-ZmRIN4 was introduced into Agrobacterium tumefaciens EHA105 to obtain recombinant Agrobacterium tumefaciens containing the recombinant vector pCAMBIA3301-ZmRIN4.

[0152] Callus induction was performed on the immature embryos of the maize inbred line KN5585 to obtain callus tissue of the maize inbred line KN5585. The callus tissue of the maize inbred line KN5585 was then infected with recombinant Agrobacterium tumefaciens containing pCAMBIA3301-ZmRIN4 to obtain T0 generation transformants. The method for PCR identification of positive transgenic plants in the T0 generation transformants is as follows:

[0153] (1) Method

[0154] The PCR primers Ubi-Fw / Tnos-Rv were designed based on the gene sequence, with an expected amplification fragment size of 445 bp.

[0155] The nucleotide sequence of primer Ubi-Fw / Tnos-Rv is as follows (5'-3'):

[0156] Ubi-Fw: AGCCCTGCCTTCATACGCTA;

[0157] Tnos-Rv:AATCATCGCAAGACCGGCAA;

[0158] Genomic DNA was extracted and amplified according to the following PCR parameters:

[0159] Reaction system: 30 ng template DNA, 2.0 μL 10× buffer, 1.0 μL 2 mM dNTPs, 1.5 μL 25 mM MgCl2, 0.4 μL 10 μM primers, 1.5 U Taq enzyme, and ddH2O to bring the total volume to 20 μL.

[0160] Reaction program: 94℃ denaturation for 5 min; 94℃ denaturation for 30 sec, 60℃ annealing for 30 sec, 72℃ extension for 45 sec, for a total of 35 cycles; 72℃ extension for 5 min.

[0161] (2) Results

[0162] PCR detection of the transformant plants showed that the size of the target gene amplification fragment in the transformant plants was consistent with the size of the amplification fragment in the positive plasmid control PCR, approximately 445 bp, indicating that the ZmRIN4 gene overexpression cassette had been integrated into the maize genome.

[0163] 2.3 Gene overexpression level

[0164] T3 generation ZmRIN4 overexpression events OE-3, OE-4, OE-6 and OE-9 were selected, and the non-transgenic control KN5585 was sown in Changji City, Xinjiang Uygur Autonomous Region for field trials. Three replicates were planted in 6-row plots with 12 plants per row (2023), and normal water and fertilizer management was implemented.

[0165] On the day of silking, female ears of non-transgenic control KN5585 and T3 generation overexpression lines OE-3, OE-4, OE-6 and OE-9 were taken from plants with uniform growth in the field. They were quickly placed in liquid nitrogen, and RNA was extracted and reverse transcribed into cDNA. The relative expression level of ZmRIN4 gene in each line was determined by qPCR.

[0166] ZmActin1-Fw:ACCTCACCGACCACCTAATG;

[0167] ZmActin1-Rv:CTGAACCTTTCTGACCCAAT;

[0168] R4-qPCR-Fw:ATGTCAACGATCCCGGCTTCC;

[0169] R4-qPCR-Rv: AGACTCCACCTCTCCAGTCC;

[0170] The reaction system consisted of: 10 μL of 2×SYBR Mix, 0.5 μL of Forward Primer (10 μM), 0.5 μL of Reverse Primer (10 μM), 7 μL of cDNA, and ddH2O to a final volume of 20 μL.

[0171] Quantitative analysis was performed using an ABI 7500 real-time PCR instrument. The qPCR reaction program was: 95℃, 3 min; (95℃, 5 sec, 60℃, 30 sec) × 40 cycles.

[0172] The results showed that the relative expression levels of the ZmRIN4 gene in OE-3, OE-4, OE-6, and OE-9 were 14.2, 45.6, and 19.5 times higher than those in the non-transgenic control KN5585, respectively. Figure 2 ).

[0173] Example 3: Preparation of knockout lines

[0174] 3.1 Construction of CRISPR-Cas9 vector

[0175] (1) Design of sgRNA

[0176] Using the sgRNA design website: http: / / www.rgenome.net / cas-designer / , we designed sgRNAs targeting the genomic sequence of the ZmRIN4 protein. The final nucleotide sequences of the target sgRNAs obtained through screening are as follows:

[0177] sgRNA: GGCCGTCCCTTGCCAAAGTT TGG(The underlined part is the PAM sequence, and the rest are the target sequences. The target sequences are positions 16-35 of SEQ ID No. 1 and positions 2759-2778 of SEQ ID No. 3).

[0178] (2) Amplification of the U6 promoter

[0179] The U6 promoter was amplified using a plasmid containing the U6 promoter as a template, and the amplification primers were MU61-3F / MU61-1R.

[0180] The PCR reaction system is as follows: 1 μL Template, 2 μL 2.5 mM dNTPs, 0.5 μL Forward Primer (10 μM), 0.5 μL Reverse Primer (10 μM), 4 μL 5×FastPfu Buffer, 2 μL FastPfu DNA polymerase, and ddH2O to a final volume of 20 μL.

[0181] The nucleotide sequences of primers MU61-3F / MU61-1R are as follows (5'-3'):

[0182] MU61-3F: TGCACTGCACAA;

[0183] MU61-1R: AATTCGGTGCTTGCCGGCTC;

[0184] The PCR reaction procedure was as follows: denaturation at 94℃ for 5 min; denaturation at 94℃ for 30 sec, annealing at 60℃ for 30 sec, extension at 72℃ for 1 min, for a total of 35 cycles; extension at 72℃ for 10 min.

[0185] (3) Fusion of U6 and sgRNA

[0186] Using the PCR product and synthesized sgRNA from the previous step as templates, U6 and sgRNA were fused together by overlap PCR using primers MUsgR-1F and MUsgR-2R to obtain a DNA fragment containing the sgRNA expression cassette. The PCR system and procedure are the same as in step (2).

[0187] The nucleotide sequences of primers MUsgR-1F and MUsgR-2R are as follows (5'-3'):

[0188] MUsgR-1F:GAGCCGCAAGCACCGAATTGGCCGTCCCTTGCCAAAGTT;

[0189] MUsgR-2R: GGCCAGTGCCAAGCTTAAAAAAAGCACCGACTCG;

[0190] (4) Finally, the DNA fragment containing the sgRNA expression cassette was fused into the CRISPR-Cas9 vector CPB using the principle of homologous recombination to obtain the CRISPR-ZmRIN4 vector. The nucleotide sequence (5′→3′) of the CRISPR-ZmRIN4 vector contains the Cas9 coding gene at positions 435-4535, the U6 promoter at positions 6680-7179, and the gRNA gene at positions 7180-7282 (the gRNA target sequence is at positions 7180-7199, and the sgRNA gene structural sequence (gRNA scaffold) is at positions 7200-7282).

[0191] Following this, ligation transformation and identification of positive recombinants were performed. 5 μL of the ligation product was added to 50 μL of Trans1-T1 competent E. coli cells thawed on ice, gently mixed, and incubated on ice for 30 min; followed by heat shock at 42°C for 42 s; immediately placed on ice for 2 min; 500 μL of antibiotic-free liquid LB medium was added, and the cells were incubated at 37°C with shaking at 200 rpm for 1 h; centrifuged at 3,000 g for 2 min, discarding some of the supernatant, and the cells were gently resuspended by pipetting. All bacterial culture was spread onto solid LB agar plates containing kanamycin and incubated overnight at 37°C; medium-sized single colonies were picked and incubated in 5 mL of antibiotic-containing LB liquid medium at 37°C with shaking at 200 rpm for approximately 10-16 h; plasmids were extracted for enzyme digestion, PCR, and sequencing identification. Clones with correct sequencing were used for subsequent genetic transformation.

[0192] 3.2 Preparation of Maize Knockout Lines

[0193] Genetic transformation of maize was performed using the maize immature embryo transformation method, completed by the Life Science and Technology Center (Wuhan) of China Seed Group Co., Ltd. The recipient of CRISPR / Cas9 gene editing was the maize inbred line C01. CRISPR / Cas9 gene-edited T0 generation seedlings were screened for herbicide resistance and identified as positive transgenic plants by PCR. After continuous self-pollination and genotyping, homozygous CRISPR / Cas9 gene-edited (KO-1, KO-2, KO-3, KO-21, and KO+1) T3 generation seeds were obtained in the winter of 2021 and used for phenotypic testing in Hainan in 2022 and 2023. T3 generation plants were self-pollinated and multiplied to obtain the T4 generation, used for phenotypic testing in Changji, Xinjiang in the summer of 2023. T4 generation plants were self-pollinated and multiplied to obtain the T5 generation, used for phenotypic testing in Urumqi, Xinjiang in 2024. The preparation method of the CRISPR / Cas9 gene-edited maize T0 lines is as follows:

[0194] The recombinant vector CRISPR-ZmRIN4 was introduced into Agrobacterium tumefaciens EHA105 to obtain recombinant Agrobacterium tumefaciens containing the recombinant vector CRISPR-ZmRIN4.

[0195] Callus induction was performed on immature embryos of maize inbred line C01 to obtain callus tissue of maize inbred line C01. The callus tissue of maize inbred line C01 was then infected with recombinant Agrobacterium tumefaciens containing CRISPR-ZmRIN4 to obtain CRISPR / Cas9 gene-editing lines. Homozygous lines were screened by self-pollination of the CRISPR / Cas9 gene-editing lines, and sequencing was used to determine the editing site and type. T0 generation knockout lines were self-pollinated to obtain T1 generation, and continuous self-pollination yielded homozygous gene knockout lines T3. Sequencing identification revealed homozygous mutants including KO-2 and KO-21.

[0196] The sequencing identification methods and results are as follows:

[0197] (1) Method

[0198] PCR primers RIN4-Crispr-F / RIN4-Crispr-R were designed based on the gene sequence, using the genomic DNA of maize inbred line C01 as a template, with an expected amplified fragment size of 663 bp.

[0199] The nucleotide sequences of primers RIN4-Crispr-F / RIN4-Crispr-R are as follows (5'-3'):

[0200] RIN4-Crispr-F: ATCTGCTTGCAGAAGCCTGT

[0201] RIN4-Crispr-R:GCTGGCTGTCACACAACAAA

[0202] Genomic DNA was extracted and PCR amplified according to the following reaction system:

[0203] Reaction system: 30 ng template DNA, 2.0 μL 10× buffer, 1.0 μL 2 mM dNTPs, 1.5 μL 25 mM MgCl2, 0.4 μL 10 μM primers, 1.5 U Taq enzyme, and ddH2O to a final volume of 20 μL.

[0204] The reaction procedure was as follows: denaturation at 94℃ for 5 min; denaturation at 94℃ for 30 sec, annealing at 60℃ for 30 sec, extension at 72℃ for 45 sec, for a total of 35 cycles; extension at 72℃ for 5 min.

[0205] (2) Results

[0206] Sanger sequencing confirmed the gene knockout homozygous line. The sequencing results of the knockout homozygous line are as follows: Figure 3 The mutations in the homozygous mutants KO-1, KO-2, KO-3, KO-21, and KO+1 are as follows:

[0207] Homozygous mutant KO-2: Compared with wild-type C01, the target gene in the two homologous chromosomes of mutant KO-2 undergoes the following changes: nucleotide AA is deleted at positions 2773-2774 of SEQ ID No.3, resulting in a frameshift mutation in the target gene, which in turn leads to the inability of the target protein to be expressed normally, thus achieving the knockout of the target gene.

[0208] Homozygous mutant KO-21: Compared with wild-type C01, the target gene in the two homologous chromosomes of mutant KO-21 undergoes the following changes: nucleotides AAGTTGGTGAATGGGATGTC at positions 2776-2796 of SEQ ID No.3 are deleted, resulting in a mutation in the target gene, which in turn leads to the inability of the target protein to be expressed normally, thus achieving the knockout of the target gene.

[0209] Homozygous mutant KO-1: Compared to wild-type C01, the target gene in the two homologous chromosomes of mutant KO-1 undergoes the following changes: nucleotide A at position 2773 of SEQ ID No.3 is deleted, resulting in a frameshift mutation in the target gene, which in turn leads to the inability of the target protein to be expressed normally, thus achieving the knockout of the target gene.

[0210] Homozygous mutant KO-3: Compared with wild-type C01, the target gene in the two homologous chromosomes of mutant KO-3 undergoes the following changes: nucleotide A at positions 2772-2774 of SEQ ID No.3 is deleted, resulting in a frameshift mutation in the target gene, which in turn leads to the inability of the target protein to be expressed normally, thus achieving the knockout of the target gene.

[0211] Homozygous mutant KO+1: Compared to wild-type C01, the target gene in the two homologous chromosomes of mutant KO+1 undergoes the following changes: nucleotides AAA at positions 2773-2775 of SEQ ID No.3 are replaced with AAAA, resulting in a frameshift mutation in the target gene, which in turn leads to the inability of the target protein to be expressed normally, thus achieving the knockout of the target gene.

[0212] Example 4, Properties Determination

[0213] 4.1 Root development during the seedling stage

[0214] Seedling stage experimental methods: KO-21 and KO-2 were selected as ZmRIN4 gene knockout materials, along with wild-type C01. ZmRIN4 overexpression events were selected at OE-3, OE-6, and OE-9. The non-transgenic control was KN5585. One hundred plump, uniformly sized seeds were selected from each type. Excess impurities were removed, and the seeds were repeatedly washed with clean water, followed by washing with distilled water. They were then soaked in 10% H2O2 for half an hour. After rinsing, the seeds were neatly arranged on moist germination paper. Germination was achieved using germination paper. Once the seeds reached the one-leaf-one-heart stage, half of the material was wrapped in germination paper and placed in a 15% PEG6000 aqueous solution to simulate drought stress. The other half served as a control, wrapped in germination paper and placed in water. The climate chamber was set with a day / night temperature of 28 / 23℃, a relative humidity of 60%, and a light duration of 14 hours. One week later, root changes in overexpression and gene knockout materials were observed under normal environmental and drought stress conditions. Roots were scanned using a root scanner (EPSONPerfection V800Photo), and images were analyzed using WinRHIZO software to obtain traits such as total root length, number of branches, root surface area, taproot projected area, and number of root tips. Statistical analysis of conventional phenotypic data was performed using the Student's t-test method in Excel (Excel 2013, Microsoft) (*: P < 0.05, **: P < 0.01, ***: P < 0.001).

[0215] 4.1.1 Root length:

[0216] Under normal conditions, the roots of ZmRIN4 overexpressing plants were shorter, ranging from 64.57 to 86.33 cm, which was 23.87% to 43.06% shorter than the non-transgenic control KN5585 (mean root length 113.40 cm). The roots of gene-edited plants (KO-2, KO-21) were longer, ranging from 124.35 to 125.07 cm, which was 73.90% to 74.91% longer than the wild-type C01 (mean root length 71.50 cm). Under drought stress, the root length of ZmRIN4 overexpressing plants decreased, ranging from 52.37 to 61.26 cm, which was 20.31% to 31.88% shorter than that of the non-transgenic control KN5585 (mean root length 76.88 cm). Gene-edited plants (KO-2, KO-21) showed increased root length, ranging from 73.00 to 117.03 cm, which was 31.74% to 79.68% longer than that of the wild-type C01 (mean root length 55.41 cm). Figure 4 ).

[0217] 4.1.2 Number of root branches:

[0218] Under normal conditions, ZmRIN4 overexpressing plants showed a decrease in branch number, ranging from 157 to 205, a reduction of 41.04% to 55.01% compared to the non-transgenic control KN5585 (mean branch number 349). Gene-edited plants (KO-2, KO-21) showed an increase in branch number, ranging from 322 to 373, an increase of 72.35% to 99.78% compared to the wild-type CO1 (mean branch number 186). Under drought stress, ZmRIN4 overexpressing plants showed a decrease in branch number, ranging from 67 to 124, a reduction of 48.00% to 71.99% compared to the non-transgenic control KN5585 (mean branch number 238). Gene-edited plants (KO-2, KO-21) showed an increase in branch number, ranging from 175 to 188, an increase of 97.51% to 112.59% compared to the wild-type CO1 (mean branch number 86). Figure 5 ).

[0219] 4.1.3 Root surface area

[0220] Under normal conditions, the root surface area of ​​ZmRIN4-overexpressing plants is reduced, ranging from 12.73 to 18.27 cm². 2 Compared to the non-GMO control KN5585 (mean root surface area 23.27 cm²), 2 The root surface area of ​​gene-edited plants (KO-2, KO-21) decreased by 21.47%-45.27%, while the root surface area increased to 21.27-21.83 cm². 2 Compared to wild type C01 (mean root surface area 16.83 cm²), 2 The root surface area of ​​ZmRIN4-overexpressing plants increased by 32.83%-34.20% under drought stress, with a reduction to 8.68-9.10 cm². 2 Compared to the non-GMO control KN5585 (mean root surface area 11.17 cm²), 2 The root surface area of ​​gene-edited plants (KO-2 and KO-21) decreased by 21.47%-45.27%, while the root surface area increased to 16.38-18.96 cm². 2 Compared to wild type C01 (mean root surface area 10.17 cm²), 2 Increased by 61.11%-86.51% Figure 6 ).

[0221] 4.1.4 Projected area of ​​the main root:

[0222] Under normal conditions, the projected area of ​​the taproot in ZmRIN4-overexpressing plants is reduced, ranging from 4.05 to 5.82 cm². 2 Compared to the non-GMO control KN5585 (mean taproot projection area 7.41 cm²), 2The percentage of genetically modified organisms (GMOs) decreased by 21.47%-45.27%; the projected area of ​​the taproot of gene-edited plants (KO-2, KO-21) increased, with a projected area of ​​6.55-6.71 cm². 2 Compared to wild type C01 (mean taproot projection area 5.18 cm²), 2 The percentage of ZmRIN4-overexpressing plants increased by 26.39%-29.50%. Under drought stress, the projected area of ​​the taproot of ZmRIN4-overexpressing plants decreased to 3.06-3.24 cm². 2 Compared to the non-GMO control KN5585 (mean taproot projection area 3.90 cm²), 2 The percentage of chlorogenic acid decreased by 16.82%-21.48%; the projected area of ​​the taproot in gene-edited plants (KO-2, KO-21) increased, ranging from 5.21 to 6.03 cm². 2 Compared to wild type C01 (mean taproot projection area 3.50 cm²), 2 Increased by 48.97%-72.45% Figure 7 ).

[0223] 4.1.5 Number of apical roots:

[0224] Under normal conditions, the number of root tips in ZmRIN4 overexpressing plants decreased to 319-324, which was 6.74%-7.73% lower than that in the non-transgenic control KN5585 (mean root tip number 346). The number of root tips in gene-edited plants (KO-2, KO-21) increased to 648-818, which was 73.67%-119.33% higher than that in wild-type C01 (mean root tip number 373). Under drought stress, the number of root tips decreased in ZmRIN4 overexpressing plants, ranging from 439 to 454, a decrease of 3.08% to 6.27% compared to the non-transgenic control KN5585 (mean root tip number 468); the number of root tips increased in gene-edited plants (KO-2, KO-21), ranging from 492 to 578, an increase of 52.53% to 79.16% compared to the wild-type C01 (mean root tip number 322). Figure 8 ).

[0225] 4.2 Root development during flowering period

[0226] The T3 generation ZmRIN4 gene knockout materials were selected as KO-21, KO-2 and wild-type C01, T3 generation ZmRIN4 overexpression events OE-3, OE-6, OE-9 and non-transgenic control KN5585 (a total of 7 lines). They were sown in the experimental field in Hainan in the winter of 2022 and 2023, respectively. According to the randomized block design, each line was planted with three replicates, and each replicate was set up with 2 rows and 12 plants per row.

[0227] T4 generation ZmRIN4 gene knockout materials were selected from KO-21, KO-2 and wild-type C01, T4 generation ZmRIN4 overexpression events OE-3, OE-6, OE-9 and non-transgenic control KN5585 (a total of 7 lines). They were sown in the experimental field in Changji City, Xinjiang Uygur Autonomous Region in the summer of 2023. According to the randomized block design, each line was planted with three replicates, and each replicate was set with 6 rows and 12 plants per row.

[0228] Eight lines were selected: T5 generation ZmRIN4 gene knockout materials KO-21, KO-2, and wild-type C01; T5 generation ZmRIN4 overexpression events OE-3, OE-6, and OE-9; and the non-transgenic control KN5585. These were sown in the summer of 2024 in an experimental field in Urumqi, Xinjiang Uygur Autonomous Region. A randomized block design was used, with two treatments: water stress and drought stress. In the drought stress treatment, irrigation was stopped at the jointing stage and resumed 14 days after silking. Each line was planted in triplicate, with each replicate consisting of six rows of 12 plants per row.

[0229] Experimental method for root development during flowering period: ZmRIN4 gene knockout materials were selected as KO-21, KO-2, wild-type C01, ZmRIN4 overexpression events were selected as OE-3, OE-6, OE-9, and non-transgenic control KN5585. Plump and uniformly sized seeds were selected and sown in Hainan (2022, 2023) and Xinjiang (2023). Roots were dug up during the flowering period, washed clean, and photographed to observe root development under different ecological environments. The results showed that under five natural environments—2022 Hainan (A), 2023 Xinjiang (B), 2023 Hainan (C), and 2024 Xinjiang (D normal irrigation, E drought treatment)—overexpression of the ZmRIN4 gene significantly inhibited root development. Compared with the non-transgenic control KN5585, OE-3, OE-6, and OE-9 showed shorter root length, smaller root volume, and significantly reduced root biomass. ZmRIN4 gene knockout promoted root development. Compared with the wild-type C01, the knockout lines KO-21 and KO-2 showed increased root length, larger root volume, significantly increased root biomass, and more developed aerial roots. Figure 9 The above results indicate that the ZmRIN4 gene can participate in regulating maize root development under natural and drought stress conditions.

[0230] Experimental method for aerial root layer number: Eight plants with uniform growth were selected from each row, and the number of aerial root layers per plant was investigated. Root development was observed under different ecological environments by taking photos. Statistical analysis revealed that in the natural environment of Xinjiang in 2024, ZmRIN4 gene knockout promoted root development, significantly increasing the number of aerial root layers, which was more developed compared to the control. Figure 10In the figure, the vertical axis represents the number of stem nodes above the location of the aerial roots, i.e., the number of aerial root layers. These results indicate that the ZmRIN4 gene is involved in regulating maize root development in the field environment.

[0231] Table 1: Main sequences in this application

[0232]

[0233]

[0234]

[0235]

[0236]

[0237]

[0238]

[0239]

[0240] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. An application, characterized in that, The application refers to the use of biological materials that have knocked out the gene encoding the ZmRIN4 protein in any of the following: A1) Application in promoting the development of underground roots in maize; A2) Application in the preparation of products that promote the development of maize underground root systems; A3) Application in maize root development promotion breeding; The ZmRIN4 protein has the amino acid sequence shown in SEQ ID No.

2. The biomaterial is any one of the following: B1) A nucleic acid molecule encoding the gRNA of the gene that targets the ZmRIN4 protein; B2), an expression cassette containing the nucleic acid molecule described in B1); B3), a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3).

2. The application according to claim 1, characterized in that, The nucleotide sequence of the target of the gRNA described in B1) is positions 2759-2778 of SEQ ID No.

3.

3. A method for promoting maize root development, characterized in that, The recipient maize contains the gene encoding the ZmRIN4 protein as described in claim 1, and the method is to promote maize root development by knocking out the gene encoding the ZmRIN4 protein in the recipient maize using a CRISPR / Cas system.

4. The method according to claim 3, characterized in that, The method includes introducing a gRNA gene that targets the gene encoding the ZmRIN4 protein and a gene encoding the Cas protein into the recipient maize.

5. The method according to claim 3, characterized in that, The method involves mutating any one of the following M2-1)-M2-5) mutations in the gene of the recipient maize; M2-1), the nucleotide AA at positions 2773-2774 of the DNA molecule in the genome of the recipient maize is deleted, which has the nucleotide sequence of SEQ ID No. 3; M2-2), the nucleotide sequence of the DNA molecule with the nucleotide sequence of SEQ ID No. 3 in the genome of the recipient maize is deleted from positions 2774-2794; M2-3), the nucleotide A at position 2773 of the DNA molecule in the genome of the recipient maize is deleted, which has the nucleotide sequence of SEQ ID No. 3; M2-4), the CAA nucleotides at positions 2772-2774 of the DNA molecule in the genome of the recipient maize, which has the nucleotide sequence of SEQ ID No. 3, are deleted; M2-5), replace nucleotides AAA at positions 2773-2775 of the DNA molecule with the nucleotide sequence SEQ ID No.3 in the genome of the recipient maize with AAAA.

Images