A real-time fluorescent PCR primer probe composition, kit and method for detecting a K virus of rodents
Patent Information
- Application Number
- CN202411687005.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2024-09-05
- Filing Date
- 2024-11-25
- Publication Date
- 2026-09-08
- Estimated Expiration
- 2044-11-25
AI Technical Summary
而K病毒PCR检测方法的灵敏度大约低八倍,且通用PCR检测方法的灵敏度最低
[0022] The beneficial effects of this invention are: short detection cycle and simple operation; high specificity, reducing background fluorescence and false positives; and the introduction of an anti-contamination system to eliminate the influence of amplification product contamination on the qPCR reaction.
Smart Images

Figure CN119464569B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of virus detection technology, specifically to a real-time fluorescent PCR primer and probe composition, kit, and method for detecting rodent K virus. Background Technology
[0002] Laboratory animals are fundamental and supporting conditions for life science research, and their microbiological quality significantly affects animal welfare as well as the validity and reproducibility of research data. Therefore, establishing a laboratory animal health monitoring (HM) program is crucial for breeding and experimental facilities.
[0003] Mucinous papillomavirus (K virus) mouse polyomavirus K virus First discovered by Kilham in 1952, it was classified as a papillomavirus in 1963. papovavirus MptV (Murine Pneumotropic Virus) belongs to the family Papillomavirus (MPV) and is classified as type II. The genome of MptV is a supercoiled, double-stranded, closed circular DNA molecule. The pathogen is transmitted through the ingestion of contaminated feces. To date, MptV and polyomavirus are the only confirmed mouse members of the genus Papillomavirus. The biological and biochemical characteristics of MptV are primarily limited by the lack of cell culture systems for its propagation. When inoculated into newborn mice, it can cause fatal pneumonia. Infection with MptV in newborn mice 6-15 days after birth induces pneumonia, with animals exhibiting sudden respiratory distress and usually dying. Infection after 18 days of age is asymptomatic; gross lesions of the lungs are visible in infected newborn mice, histologically showing interstitial pneumonia with hemorrhage, edema, and atelectasis. Histopathological examination reveals intranuclear inclusions in various tissues, but these are difficult to observe in tissues other than the lungs. Interstitial pneumonia in 6-15 day old mice or immunodeficient mice suggests MptV infection. Unlike PyV (polyomavirus), MptV induces low-titer antibody production and can be detected by ELISA, IFA, or MFIA™. Although K virus differs from polyomaviruses and other well-defined papillomaviruses because it does not induce tumors, it has been shown to transform mouse cells in culture. Therefore, mouse papillomavirus K virus is a recommended detection item among highly infectious pathogens in laboratory mice. Studies on the use of PCR detection for identifying mouse polyomavirus in biological samples have involved designing and optimizing PCR detection methods to improve the specificity and sensitivity of mouse polyomavirus and K virus detection. Universal PCR detection methods were compared with mouse bioassays for diagnosing infected cell samples. Results showed that the PCR detection method had high specificity; the mouse polyomavirus PCR detection was the most sensitive method, detecting as few as 2000 copies. The K virus PCR detection method had approximately eight times lower sensitivity, and the universal PCR detection method had the lowest sensitivity.
[0004] Therefore, it is of great significance to develop a primer-probe combination and detection method for detecting K virus in experimental rodents that is more sensitive, has a shorter experimental time, and is suitable for large-scale sample testing. Summary of the Invention
[0005] To address the shortcomings of existing technologies, this invention provides a real-time fluorescent PCR primer and probe composition and method for detecting rodent K virus. The primer and probe composition has high specificity and sensitivity, and the detection method is simple, rapid, and quick, making it suitable for detecting rodent K virus in large-scale experimental studies.
[0006] To achieve the above objectives, the first aspect of the present invention provides a real-time fluorescent PCR primer-probe composition for detecting rodent K virus, comprising a primer pair and a TaqMan probe, wherein the nucleotide sequence of the forward primer of the primer pair is shown in SEQ ID NO.1, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.2; the nucleotide sequence of the TaqMan probe is shown in SEQ ID NO.3, wherein the nucleotide sequences are as follows: Forward primer: KV-F: 5'-CAGCTGCTGCTAAGGTTG-3' (SEQ ID NO.1); Reverse primer: KV-R: 5'-TGAGTGCGCAATCCTCCTAT-3' (SEQ ID NO.2); TaqMan probe: KV-P:X-5'-AGGACCGGTAAATAGCCA-3' (SEQ ID NO. 3)-Y.
[0007] Furthermore, the TaqMan probe includes a 5'-terminal modified fluorescent group X and a 3'-terminal modified quenching group Y. The 5'-terminal modified fluorescent group X is any one of FAM, VIC, ROX, HEX, and CY5, and is not limited to the above. The 3'-terminal modified quenching group Y is any one of BHQ1, BHQ2, BHQ3, MGB, and TAMARA, and is not limited to the above.
[0008] Conventional PCR is the process of amplifying and detecting specific DNA sequences or genes using PCR (polymerase chain reaction) technology. PCR is a method for amplifying DNA fragments in vitro, and its basic principle is based on DNA replication and the enzymatic activity of DNA polymerase. It has certain disadvantages, such as relatively low sensitivity, long experimental time, and the ability to only qualitatively analyze, not accurately quantify. Real-time fluorescence polymerase chain reaction (RT-PCR), on the other hand, adds specific fluorescent probes to the reaction system based on conventional PCR. It uses the accumulation of fluorescence signals to detect the entire PCR process in real time. By detecting the fluorescence emission signal in each cycle, it indirectly reflects the amount of the target gene amplified by PCR. Finally, it uses the amplification curve to perform qualitative or quantitative analysis of unknown templates. Compared to conventional PCR, RT-PCR has higher sensitivity, can detect lower concentrations of DNA template, and can detect fluorescence signals during DNA amplification in real time, thus accurately measuring the amount of starting template and shortening the detection time.
[0009] Based on the K virus genomic DNA, this invention designs and synthesizes a pair of specific primers and a specific probe. The probe is labeled with a reporter fluorescent group and a quencher fluorescent group at both ends, respectively. The fluorescence signal generated by the interaction of the two genes is accepted by the detection instrument, thereby detecting the nucleic acid template by detecting the fluorescence signal.
[0010] Furthermore, the experimental rodent can be any one of mice, rats, hamsters, or guinea pigs, or other rodents.
[0011] In a second aspect, the present invention provides a kit containing the above-described real-time fluorescent PCR primer and probe composition for detecting rodent K virus.
[0012] Specifically, it also includes the following substances: PCR premix 2×AceQ qPCR Probe Master Mix, negative control and positive control; the negative control is ddH2O; the positive control is KV-400g plasmid, the effective nucleotide sequence of which is shown in SEQ ID NO.4.
[0013] The KV-400g plasmid is a positive recombinant plasmid obtained by cloning the amplification product of K virus using the above primers into a vector, transforming it into DH5α competent cells, identifying it through enzyme digestion, and sequencing. It can be used as a positive control reference sequence. Its effective nucleotide sequence is as follows: GTTAGCCGCTAGGTTTGATAAATTATTTGAAAGATTGGAAGTAATATTGAGTGCGCAATCCCTATACAATTAGCATGTTTATGGCAGGCATTGTTTGGTTTGAAAATCTTTTTCCAGGCCAGTCATTTAAAGACCTCCTTTTGGAACTCCTTGAATGTATGGTTTCAAACATCCCTAAGAGAAGATATTGGCTATTTACC GGTCCTGTTAATACTGGTAAAACAACCTTAGCAGCAGCTGTCCTAGATCTTTGTGGAGGTAAAGCATTAAATATAAATATGCCATTTGATAAACTAAATTTTGAGCTGGGAGTTGCAATAGATCAATTCATGGTTGTGTTTGAAGATGTTAAAGGACAGAAAAGTGAAAATAAAGATTTGCCACCCGGGCAAGGAATA (SEQ ID NO.4).
[0014] A third aspect of the present invention also provides the application of the above-described reagent kit in the detection of K virus for non-disease diagnostic purposes.
[0015] In a fourth aspect, the present invention provides a method for detecting rodent K virus for non-disease diagnostic purposes, comprising the steps of: (a) Extracting DNA from the sample to be tested; (b) Using the extracted sample DNA as a template, perform RT-PCR amplification using the above kit to obtain the amplification product; (c) Perform curve analysis on the amplification curve to determine whether the sample to be tested contains K virus.
[0016] The DNA source for the samples in this invention can be organ tissues, cecal contents or feces, blood, swabs, or cell cultures from mice, rats, hamsters, or guinea pigs.
[0017] Furthermore, the above result judgment method is as follows: if the sample to be tested has a fluorescence amplification curve and the Ct value should be ≤35, it is judged as positive; if the Ct value of the sample to be tested is between 35 and 40, real-time fluorescence PCR should be re-tested. If the Ct value is ≥40 after re-testing, the sample is judged as negative. If the Ct value after re-testing is still between 35 and 40, the sample is judged as suspicious positive and further sequencing is required.
[0018] Specifically, the results analysis and condition setting are as follows: Read the test results directly. The baseline and threshold settings are adjusted according to the noise level of the instrument, with the threshold line just exceeding the highest point of the amplification curve of a normal negative sample. Quality control standards: The blank control showed no Ct value and no fluorescence amplification curve, remaining a horizontal line throughout. The negative control showed no Ct value and no fluorescence amplification curve, remaining a horizontal line throughout. If the positive control Ct value is ≤35 and there is a clear fluorescence amplification curve, it indicates that the reaction system is running normally; otherwise, the experiment is invalid and real-time fluorescence PCR amplification needs to be repeated.
[0019] Result determination: If the sample to be tested does not show a fluorescence amplification curve, then the sample is determined to be negative for K virus nucleic acid; If the sample to be tested has a fluorescence amplification curve and the Ct value is ≤35, then the sample is judged to be positive for K virus nucleic acid; If the Ct value of the sample to be tested is between 35 and 40, real-time fluorescent PCR testing should be performed again. If the Ct value is ≥40 after retesting, the sample K virus nucleic acid is considered negative. If the Ct value after retesting is still between 35 and 40, the sample K virus nucleic acid is considered suspiciously positive and further sequencing is required.
[0020] Furthermore, the system for the RT-PCR amplification reaction is as follows: 2×AceQ qPCR Probe Master Mix10μL Forward primer (10 µmol / L) 0.8 μL 0.8 μL of reverse primer (10 µmol / L) TaqMan probe (10 µmol / L) 0.8 μL Sample DNA / Negative Control / Positive Control 2μL ddH2O 5.6μL Total volume 20μL.
[0021] Furthermore, the RT-PCR reaction procedure is as follows: 37℃ for 2 min; 95℃ for 10 min; 95℃ for 15 s; 60℃ for 30 s, for 40 cycles, with fluorescence signal acquisition at 60℃. In this technical solution, reacting at 37℃ for 2 min first can effectively remove contaminants in the system and improve purity.
[0022] The beneficial effects of this invention are: short detection cycle and simple operation; high specificity, reducing background fluorescence and false positives; and the introduction of an anti-contamination system to eliminate the influence of amplification product contamination on the qPCR reaction.
[0023] This invention designs primer-probe compositions based on conserved sequences of the K virus genome, which specifically bind to the K virus and show no cross-reactivity with other common viruses such as mouse pneumonia virus, rat parvovirus, rotavirus, reovirus type 3, mouse norovirus, mouse parvovirus, polyomavirus, and pathogenic bacteria such as Staphylococcus aureus, Escherichia coli, Pasteurella multocida, and Pseudomonas aeruginosa. The composition exhibits high specificity and high reliability for quantifying low-abundance genes. Furthermore, the primers designed in this invention have high specificity requirements, avoiding non-specific amplification or primer dimer formation.
[0024] This invention uses a standard sample with a strength of 1.58-1.58 × 10⁻⁶. 8 It can efficiently detect the K virus within a certain copy number range, with good accuracy and higher sensitivity.
[0025] The detection method of this invention is simple and fast, greatly shortening the detection time. It can be applied to the detection of K virus in a large number of samples, such as experimental rodents like mice, rats, hamsters, and guinea pigs, providing an effective technical means for the rapid detection of K virus. Attached Figure Description
[0026] Figure 1 This is an amplification map of plasmid KV-400g synthesized from the K virus gene at different dilutions in the real-time fluorescence quantitative PCR reaction system of Example 3 of the present invention; Figure 2 This is the amplification pattern of different pathogens and viruses in the real-time fluorescence quantitative PCR reaction system of Example 4 of the present invention; Figure 3 This is the amplification pattern of the real-time fluorescence quantitative PCR reaction system in Example 5 of the present invention for different samples and comparisons.
[0027] The present invention will be further described below with reference to the accompanying drawings and embodiments. Detailed Implementation
[0028] To better illustrate the technical solution of the present invention, the following will explain the solution of the present invention in conjunction with embodiments. Those skilled in the art will understand that the following embodiments are only for illustrating the present invention and should not be considered as limiting the scope of the present invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques described in literature or reference books in the field or according to the product instructions. Reagents or instruments used, unless otherwise specified, are all conventional products.
[0029] The above-described technical features of the present invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions.
[0030] Example 1: Primer and probe design The complete genome sequence of the K virus was searched and compared on the NCBI website. Primers and probes were designed using Primer Premier 5 software based on the conserved sequences of the K virus genome. The nucleotide sequences are as follows: Forward primer: KV-F: 5'-CAGCTGCTGCTAAGGTTG-3' (SEQ ID NO.1); Reverse primer: KV-R: 5'-TGAGTGCGCAATCCTCCTAT-3' (SEQ ID NO.2); TaqMan probe: KV-P: FAM-5'-AGGACCGGTAAATAGCCA-3' (SEQ ID NO. 3)-BHQ1.
[0031] The primers used in this invention were synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0032] Example 2: A kit for detecting rodent K virus A kit for detecting K virus in laboratory rodents includes: (1) PCR premix 2×AceQ qPCR Probe Master Mix (2) The primers used in Example 1 were: forward primer SEQ ID NO:1, reverse primer SEQ ID NO.2; TaqMan probe SEQ ID NO.3; (3) Negative control: ddH2O; (4) Positive control: KV-400g plasmid is a positive recombinant plasmid obtained by cloning the amplification product of K virus using the above primers into a vector and transforming it into DH5α competent cells, followed by enzyme digestion identification and sequencing. Its effective nucleotide sequence (SEQ ID NO:4) is as follows: GTTAGCCGCTAGGTTTGATAAATTATTTGAAAGATTGGAAGTAATATTGAGTGCGCAATCCTCCTATACAATTAGCATGTTTATGGCAGGCATTGTTTGGTTTGAAAATCTTTTTCCAGGCCAGTCATTTAAAGACCTCCTTTTGGAACTCCTTGAATGTATGGTTTCAAACATCCCTAAGAGAAGATATTGGCTATTTA CCGGTCCTGTTAATACTGGTAAAACAACCTTAGCAGCAGCTGTCCTAGATCTTTGTGGAGGTAAAGCATTAAATATAAATATGCCATTTGATAAACTAAATTTTGAGCTGGGAGTTGCAATAGATCAATTCATGGTTGTGTTTGAAGATGTTAAAGGACAGAAAAGTGAAAATAAAGATTTGCCACCCGGGCAAGGAATA.
[0033] Specifically, the reaction system includes: 2×AceQ qPCR Probe Master Mix10 μL Forward primer (10 µmol / L) 0.8 μL 0.8 μL of reverse primer (10 µmol / L) TaqMan probe (10 µmol / L) 0.8 μL Negative control / Positive control / (sample) 2 μL ddH2O 5.6 μL Total volume 20 μL.
[0034] The RT-PCR reaction parameters are shown in Table 1: Table 1
[0035] Results analysis and condition setting: Read the test results directly. The baseline and threshold settings are adjusted according to the instrument's noise level, with the threshold line just exceeding the highest point of the amplification curve of a normal negative sample.
[0036] Quality control standards: The blank control showed no Ct value and no fluorescence amplification curve, remaining a horizontal line throughout.
[0037] The negative control had no Ct value and no fluorescence amplification curve, remaining a horizontal line throughout.
[0038] If the positive control Ct value is ≤35 and there is a clear fluorescence amplification curve, it indicates that the reaction system is running normally; otherwise, the experiment is invalid and real-time fluorescence PCR amplification needs to be repeated.
[0039] Result determination: If the sample to be tested does not show a fluorescence amplification curve, then the sample is considered negative for pathogen nucleic acid.
[0040] If the sample to be tested has a fluorescence amplification curve and the Ct value is ≤35, then the sample is considered to be positive for pathogen nucleic acid.
[0041] If the Ct value of the sample to be tested is between 35 and 40, real-time fluorescent PCR testing should be performed again. If the Ct value is ≥40 after retesting, the sample is considered negative for pathogen nucleic acid. If the Ct value after retesting is still between 35 and 40, the sample is considered suspiciously positive for pathogen nucleic acid and further sequencing is required.
[0042] Example 3: Sensitivity Test Using plasmid KV-400g synthesized from the K virus gene as a template, serial dilutions were performed, and real-time fluorescence PCR detection was conducted, with conditions as described in Example 2.
[0043] The concentration of the extracted plasmid was determined, and the copy number per μL of plasmid was calculated. The plasmid was diluted to a concentration of 1.58 × 10⁻⁶. 8 1.58×10 7 1.58×10 6 1.58×10 5 1.58×10 4 1.58×10 3 1.58×10 2 The number of copies was 15.8 per μL, as shown in Table 2.
[0044] Table 2
[0045] Real-time quantitative PCR detection results are as follows Figure 1 As shown.
[0046] from Figure 1 The results show that the real-time fluorescence quantitative PCR technology provided by this invention has good accuracy, and each concentration detection system can achieve accurate detection of the corresponding K virus with high sensitivity.
[0047] Example 4: Specificity Experiment Staphylococcus aureus, Escherichia coli, Pasteurella multocida, Pseudomonas aeruginosa, mouse pneumonia virus (PVM), rat parvovirus H-1, rotavirus (RRV), reovirus type 3 (REO-3), mouse norovirus (MNV), mouse parvovirus (MPV), polyomavirus (POLY), and K virus were detected using the kits, reaction systems, and parameters described in Example 2. The results are shown in Table 3, with the real-time quantitative PCR results as follows: Figure 2 As shown.
[0048] Table 3
[0049] from Figure 2 As can be seen from the results in Table 3, the kit and method of the present invention have no cross-reactivity with the above-mentioned pathogens and viruses, and have high specificity.
[0050] Example 5: Application of the K virus reagent kit (1) Collect 6 mouse feces. Take 1.0-2.0g of the sample to be tested into a sterile 5 mL centrifuge tube, add 5 times the volume of sterile PBS, homogenize thoroughly for 1-2 min using a homogenizer, centrifuge at 8000g for 5 min, and transfer the supernatant into another sterile 5 mL centrifuge tube, and label it M01, M02, M03, M04, M05 and M06 for later use.
[0051] (2) Extract viral nucleic acid from the above samples using the FastPure Viral DNA / RNA Mini Kit and label them for later use.
[0052] (3) Prepare the reaction solution according to the sample and control quantities n, at a ratio of n+5%n, mix thoroughly, and then dispense. The kit from Example 2 was used for detection; the reaction system is shown below: 2×AceQ qPCR Probe Master Mix10 μL Forward primer (10 µmol / L) 0.8 μL 0.8 μL of reverse primer (10 µmol / L) TaqMan probe (10 µmol / L) 0.8 μL Negative control / Positive control / (sample) 2 μL ddH2O 5.6 μL Total volume 20 μL.
[0053] (4) Add 2µL of template (including positive control, negative control and nucleic acid product extracted from the submitted sample) to each of the above reaction tubes, so that the total volume of each tube reaches 20µL. After tightening the cap, shake to mix, and centrifuge at 500r / min for 30s.
[0054] The RT-PCR reaction parameters are shown in Table 4. Table 4
[0055] (5) The results are shown in Table 5, where the results of real-time quantitative PCR detection are as follows: Figure 3 As shown.
[0056] Table 5
[0057] From Table 5 and Figure 3 The results show that none of the six samples tested using the kit of this invention were infected with K virus, indicating that the kit of this invention can be applied to clinical sample testing.
[0058] Finally, it should be emphasized that the above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention can have various changes and modifications. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A real-time fluorescent PCR primer and probe composition for detecting rodent K virus, characterized in that, The device includes a primer pair and a TaqMan probe. The nucleotide sequence of the forward primer of the primer pair is shown in SEQ ID NO.2, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.
1. The nucleotide sequence of the TaqMan probe is shown in SEQ ID NO.
3. The rodent is a mouse.
2. The real-time fluorescent PCR primer and probe composition for detecting rodent K virus according to claim 1, characterized in that, The TaqMan probe includes a 5'-terminal modified fluorescent group X and a 3'-terminal modified quenching group Y. The 5'-terminal modified fluorescent group X is any one of FAM, VIC, ROX, HEX, and CY5, and the 3'-terminal modified quenching group Y is any one of BHQ1, BHQ2, BHQ3, MGB, and TAMARA.
3. A kit containing the real-time fluorescent PCR primer and probe composition for detecting rodent K virus as described in any one of claims 1-2.
4. The reagent kit according to claim 3, characterized in that, It also includes the following substances: PCR premix 2×AceQqPCR Probe Master Mix, negative control, and positive control; the negative control was ddH2O.
5. The application of the kit as described in claim 3 or 4 in the detection of mouse K virus for non-disease diagnostic purposes.
6. A method for detecting rodent mouse K virus for non-disease diagnostic purposes, characterized in that, Includes the following steps: (a) Extracting DNA from the sample to be tested; (b) Using the extracted sample DNA as a template, perform Real-Time PCR amplification reaction using the kit described in claim 3 or 4 to obtain amplification products; (c) Perform curve analysis on the amplification curve to determine whether the sample to be tested contains K virus.
7. The method according to claim 6, characterized in that, The judgment method is as follows: if the sample to be tested has a fluorescence amplification curve and the Ct value should be ≤35, it is judged as positive; if the Ct value of the sample to be tested is between 35 and 40, real-time fluorescence PCR should be re-tested. If the Ct value after re-testing is ≥40, the sample is judged as negative. If the Ct value after re-testing is still between 35 and 40, the sample is judged as suspicious positive and further sequencing is required.
8. The method according to claim 6, characterized in that, The Real-Time PCR amplification reaction system consisted of: 10 μL of 2×AceQ qPCR Probe Master Mix; 0.8 μL of forward primer; 0.8 μL of reverse primer; TaqMan probe 0.8 μL; Sample DNA / Negative control / Positive control 2μL; ddH2O 5.6μL; Total volume 20μL.
9. The method according to any one of claims 6-8, characterized in that, The procedure for the real-time PCR reaction was as follows: 37℃ for 2 min; 95℃ for 10 min; 95℃ for 15 s; 60℃ for 30 s; 40 cycles, with fluorescence signal collected at 60℃.
Citation Information
Patent Citations
Detection of low abundance viruses
CN115943207A
Detection of low abundance nucleic acids
US20230129100A1