A Penicillium mi. strain with broad-spectrum antibacterial activity and its application

Abstract

This invention discloses a Penicillium mi. strain with broad-spectrum antibacterial activity and its applications, relating to the field of biocontrol fungal screening technology. This strain was deposited at the China General Microbiological Culture Collection Center on June 3, 2024, and is classified as *Penicillium fructuariae-cellae*. This fungus can significantly inhibit the growth of plant pathogens such as *Fusarium graminearum*, *Botrytis cinerea*, *Helicobacter pylori*, *Anthracnose graminearum*, *Alternaria alternata*, *Phytophthora capsici*, and *Erwinia carotenoides* (carrot soft rot pathogenic form). Seed treatment with the conidial powder of this fungus effectively controls wheat stem rot. Therefore, this fungus can be used to prepare biocontrol agents, which are simple to use, effective, safe, and reliable, showing promising market application prospects.

Description

Technical Field

[0001] This invention relates to the field of biocontrol fungal screening technology, and more specifically to a Penicillium fructuariae-cellae mi strain with broad-spectrum antibacterial activity and its application. Background Technology

[0002] Currently, the control of plant diseases mainly relies on chemical pesticides. However, the overuse of chemical pesticides not only leads to excessive pesticide residues, endangering human health, but also causes environmental pollution, disrupts the ecological balance, enhances the drug resistance of pathogens, and ultimately affects the sustainable and healthy development of agriculture. Biological control is one of the important measures for plant disease control. Biocontrol bacteria can produce active substances that inhibit pathogenic fungi, or hyperparasitize or induce plant resistance, thereby preventing or mitigating the occurrence of plant diseases.

[0003] Green agriculture is the development trend of agriculture, with the reduction of chemical fertilizers and pesticides and the increase of efficiency as its core content, and biological control as the main technical support. Therefore, it is crucial to vigorously develop biological control technologies, improve control levels, and achieve biological control and ecological restoration of plant diseases. Screening for novel and highly efficient biocontrol bacteria is the foundation of biological control. Insects, as the most abundant species on Earth, possess a vast number of gut microbiota, containing enormous microbial resources, which may include novel biocontrol fungi for plant diseases.

[0004] Therefore, screening novel, highly efficient, and broad-spectrum biocontrol fungi from insects is a technical problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0005] In view of this, the present invention is hereby proposed.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] The first aspect of this invention provides a Penicillium mi strain isolated from the intestines of millipedes and possessing broad-spectrum antibacterial activity. This strain was deposited on June 3, 2024, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC NO.41254; and classified as Penicillium fructuariae-cellae.

[0008] The second aspect of the present invention provides the application of the aforementioned Penicillium fructuariae-cellae mi strain in the preparation of antagonistic plant pathogen agents.

[0009] Preferably, the plant pathogens include *Fusarium graminearum*, *Botrytis cinerea*, *Helicobacter pylori*, *Anthracis granatum*, *Alternaria alternata*, *Phytophthora capsici*, *Erwinia carotenoides* (a type of carotenoid soft rot pathogen), and other pathogens causing soft rot.

[0010] The third aspect of the present invention provides a method for treating wheat seeds with conidial powder of the mi strain to reduce wheat stem base rot, including the aforementioned Penicillium fructuariae-cellae mi strain.

[0011] As can be seen from the above technical solution, compared with the prior art, this invention isolates a strain of *P. fructuariae-cellae* from the millipede intestine. This bacterium can significantly inhibit the growth of plant pathogens such as *Fusarium graminearum*, *Botrytis cinerea*, *Helicobacter pylori*, *Anthracnose graminearum*, *Alternaria alternata*, *Phytophthora capsici*, and *Erwinia carotenoides* (carrot soft rot pathogen). Therefore, this strain can be used to prepare a seed treatment agent, thereby enhancing plant resistance to pathogens. Furthermore, this biocontrol agent is simple to use, effective, safe, and reliable, and has good market application prospects. Attached Figure Description

[0012] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0013] Figure 1 The attached image shows the morphology of mi colonies and conidiophores.

[0014] Figure 2 The attached figure is a phylogenetic tree of the ITS sequence of the mi strain.

[0015] Figure 3 The attached figure shows the evolutionary tree of microtubule proteins in the mi strain.

[0016] Figure 4 The attached figure is a phylogenetic tree of calmodulin from the mi strain.

[0017] Figure 5 The attached figure shows the inhibitory effect of strain mi on Fusarium graminearum.

[0018] Figure 6 The attached figure shows the inhibitory effect of the mi strain on Botrytis cinerea.

[0019] Figure 7 The attached figure shows the inhibitory effect of the mi strain on *Anthracis granatum*.

[0020] Figure 8 The attached figure shows the inhibitory effect of the mi strain on *Leptochloa chinensis*, a species of causal agent of leaf spot.

[0021] Figure 9 The attached figure shows the inhibitory effect of the mi strain on Alternaria.

[0022] Figure 10 The attached figure shows the inhibitory effect of the mi strain on Phytophthora capsici.

[0023] Figure 11 The attached figure shows the inhibitory effect of strain mi on the carrot soft rot pathogenic form of Erwinia carota. Detailed Implementation

[0024] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0025] Example 1: Isolation, Screening, and Identification of Strains

[0026] I. Isolation and Screening of Strains

[0027] In mid-September 2023, ten adult millipedes were collected from a cornfield in Qiliying Town, Xinxiang City, and brought back to the laboratory for surface disinfection. The millipedes were immersed in a 0.5% sodium hypochlorite solution for 1 minute, then transferred to 75% alcohol for 3 minutes. The millipedes were rinsed three times with sterile water, and the skin was cut open with sterile scissors. The intestines were removed with sterile forceps and placed in a 1.5 mL sterile centrifuge tube, along with 200 mL of sterile water. The intestines were homogenized using a handheld electric grinder. After standing for 5 minutes, the supernatant was serially diluted to a concentration of 10. -2 10 -3 10 -4 10 -5 Take 100 mL of a 10% concentration. -3 Spread the diluted solution onto PDA plates (with streptomycin sulfate added to a final concentration of 50-100 μg / ml), for a total of 20 plates. Incubate the plates at 25°C for 4 days. After colonies have grown, transfer them to new PDA plates for purification.

[0028] Using *Fusarium graminearum* as the target bacterium, fungi with biocontrol activity were screened. *Fusarium graminearum* mycelial cakes were inoculated into the center of PDA plates, and isolated fungal mycelial cakes were inoculated 2 cm around the perimeter using a cross-inoculation method. The control treatment was inoculated only with *Fusarium graminearum* mycelial cakes. The plates were incubated at 25°C. Once the control *Fusarium graminearum* had completely colonized the plates, the width of the inhibition zone on the opposing plates was measured. The fungus with the best antifungal effect was selected and named *mi*.

[0029] II. Classification and Identification of Mi Strains

[0030] 1. Morphological identification:

[0031] The *Mi* strain was inoculated onto PDA plates and cultured at 25°C for 7 days. Colony morphology and conidia morphology were observed. Results are attached. Figure 1 The colonies of strain mi exhibit well-developed but short, felt-like hyphae. Initially, the hyphae are white, later turning green. The conidiophores are broom-shaped, and the conidia are spherical, arranged in chains on the conidiophores. These are typical characteristics of the Penicillium genus, thus confirming that strain mi is a Penicillium fungus.

[0032] 2. Molecular identification:

[0033] DNA was extracted from *Mi* strain using the CTAB method, and the ITS region, tubulin gene, and calmodulin gene were amplified by PCR. The primers for the ITS sequence were:

[0034] ITS1:TCCGTAGGTGAACCTGCGG, SEQ ID NO.1;

[0035] ITS4:TCCTCCGCTTATTGATATGC, SEQ ID NO.2.

[0036] The primers for the tubulin gene are:

[0037] Bt2a: GGTAACCAAATCGGTGCTGCTTTC, SEQ ID NO.3;

[0038] Bt2b:ACCCTCAGTGTAGTGACCCTTGGC, SEQ ID NO.4.

[0039] The primers for the calmodulin gene are:

[0040] CAL-F: GARTWCAAGGAGGCCTTCTC, SEQ ID NO.5;

[0041] CAL-R:TTTTTGCATCATGATTGGAC, SEQ ID NO. 6.

[0042] The PCR reaction system was as follows: 2×PCR Mix: 12.5 μl; Primer 1: 1 μl; Primer 2: 1 μl; DNA template: 1 μl; ddH2O: 9.5 μl. The PCR reaction program was: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, annealing for 30 s (annealing temperatures for ITS, tubulin, and calmodulin genes were 52℃, 59℃, and 50℃, respectively), extension at 72℃ for 0.5 min, repeated for 30 cycles; annealing at 72℃. The PCR products were sent to a sequencing company for sequencing.

[0043] The obtained sequences were submitted to the NCBI database. The ITS accession number is PQ222852, the tubulin gene accession number is PQ279581, and the calmodulin gene accession number is PQ240628. BLAST alignment was performed in NCBI, and sequences of the same genus were downloaded. A phylogenetic tree was constructed using MEGA software with the neighbor-joining method. From the phylogenetic tree... Figure 2 , Figure 3 and Figure 4 The *mi* strain belongs to the same clade as *P. fructuariae-cellae*, with a similarity exceeding 99%. Based on morphological characteristics, the *mi* strain was identified as *P. fructuariae-cellae*. This strain is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC NO. 41254; its taxonomic name is *Penicillium fructuariae-cellae*.

[0044] Example 2: Determination of the biocontrol effect of P. fructuariae-cellae mi strain

[0045] 1. Inhibitory effect of mi strains on mycelial growth of plant pathogenic fungi

[0046] *Fusarium graminearum*, *Botrytis cinerea*, *Helicobacter pylori*, *Anthracnose graminearum*, and *Alternaria alternata* were inoculated onto PDA plates and activated at 25°C for 5 days for later use. *Mi* mycelium cakes were inoculated onto one side of a PDA plate, and plant pathogenic fungal cakes were inoculated 2 cm away from the *Mi* mycelium cakes, and incubated at 25°C. The control group was inoculated only onto corresponding new PDA plates. After the pathogenic fungi had completely colonized the culture dishes, the colony diameter of the pathogenic fungi under the control treatments was measured, and the inhibitory effect was calculated. Inhibition rate (%) = (Control colony diameter - Treated colony diameter) / Control colony diameter × 100. Figure 5 , Figure 6 , Figure 7 , Figure 8 and Figure 9 As shown in the figure, the results indicate that strain mi has a good inhibitory effect on the mycelial growth of five pathogenic fungi.

[0047] Calculations showed that the *Mi* strain inhibited the mycelial growth of *Fusarium graminearum* by 55.5%; *Mi* strain inhibited the mycelial growth of *Botrytis cinerea* by 54.4%; *Mi* strain inhibited the mycelial growth of *Anthracnose graminearum* by 64.6%; *Mi* strain inhibited the mycelial growth of *Helicobacter pylori* by 60.5%; and *Mi* strain inhibited the mycelial growth of *Alternaria alternata* by 57.5%.

[0048] Microscopic examination revealed malformed hyphae of the plant pathogenic fungus, with swollen, vesicular tips that had lost their apical growth ability. This indicates that the fungal hyphae were inhibited by the antifungal substances of the mi strain.

[0049] 2. The test method for the inhibitory effect of strain mi on the mycelial growth of plant pathogenic oomycetes is the same as before. For example... Figure 10 As shown, the results indicated that the mi strain had a good inhibitory effect on the mycelial growth of *Phytophthora capsici*, with an inhibition rate of 51.6%. However, the *Phytophthora capsici* mycelia did not exhibit abnormal changes. *Phytophthora capsici* belongs to the oomycetes, and its cell wall is composed of cellulose. This means that the inhibitory effect of the mi strain on *Phytophthora capsici* differs from that of fungi.

[0050] 3. Inhibitory effect of mi strains on the growth of plant pathogenic bacteria

[0051] Erwinia carotene, a pathogenic bacterium causing soft rot in carrots, was inoculated into LB broth and cultured at 30°C with shaking for 24 hours. The *Mi* strain was inoculated into the center of a PDA plate and cultured for 5 days. A bacterial suspension was then spread around the *Mi* strain and cultured at 25°C for 48 hours. Figure 11 The results indicate that no bacteria grew within 1.1 cm of the MI strain, suggesting that the bacteria were killed by the antibacterial substances secreted by the MI strain. The MI strain has a good control effect on bacteria.

[0052] Example 3: Determination of the control efficacy of strain mi against wheat stem base rot in pots.

[0053] First, the *Mi* strain was inoculated onto PDA medium and cultured at 25°C for 7 days. After conidia formation, the conidia were scraped into 50 mL sterile centrifuge tubes, and the conidia concentration was adjusted to 10⁻⁶ with sterile water. 6 / mL. Then take 1mL to a new centrifuge tube, add 20 wheat seeds, and mix thoroughly with the conidium suspension to allow the conidia to adhere to the seed surface, serving as a seed dressing treatment. The experiment included two treatments: wheat seeds without treatment (CK); and wheat seeds coated with conidium powder (T).

[0054] The main pathogen of wheat stem rot in Yanjin County, Xinxiang City, Henan Province is *Fusarium graminearum*. The soil in severely affected fields contains a large amount of *Fusarium graminearum*, therefore soil samples were taken from these fields for natural inoculation. A five-point sampling method was used, collecting soil samples at a depth of 5-20 cm. The soil was sieved and filled into flowerpots, with 300g of soil in each pot. Seed-treated wheat seeds were sown into the soil, 10 seeds per pot. Nine pots were used per treatment, with three replicates.

[0055] Thirty days after wheat growth, the occurrence of stem rot was investigated. The wheat was graded according to the length of browning on the stem below the first leaf sheath: Grade 0, no disease; Grade 1, browning length less than 25%; Grade 2, browning length 25%–<50%; Grade 3, browning length 50%–<75%; Grade 4, browning length 75% and above. The disease index and control effect were calculated using formulas (1) and (2).

[0056] D=100×∑(s×n) / (S×N) (1)

[0057] E=(Dc-Dt) / Dc (2)

[0058] In formulas (1) and (2): D represents the disease index, s represents the representative value of each disease level, n represents the number of plants at each disease level, S represents the highest representative value of the disease level, N represents the total number of plants surveyed; E represents the control effect, Dc represents the disease index of the control group, and Dt represents the disease index of the treatment group.

[0059] Using the above methods, pot experiments on wheat stem base rot with *Mi* strain showed that, in the control group, the disease index was 68.0. After treatment with *Mi* conidia, the disease index was 24.7, with a control effect of 63.7%. These results indicate that *Mi* strain has good control efficacy against wheat stem base rot and has broad application potential.

[0060] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on the differences from other embodiments. The same or similar parts between the various embodiments can be referred to each other.

[0061] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A Penicillium mi. strain with broad-spectrum antibacterial activity, characterized in that, This strain was deposited on June 3, 2024, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC NO.41254; classified and named... Penicillium fructuariae-cellae .

2. The application of the Penicillium mi strain according to claim 1 in the preparation of antagonistic plant pathogen agents, characterized in that, The plant pathogens mentioned are Fusarium graminearum, Botrytis cinerea, Helicobacter pylori, Anthracnoseus graminearum, Alternaria alternata, Phytophthora capsici, and Erwinia carotoxin (carrot soft rot pathogen).

3. A microbial inoculant, characterized in that, Includes the Penicillium mi strain as described in claim 1.

Images