Mcp gene wb assurance type monoclonal antibody of grouper iridovirus and preparation method thereof

Abstract

The application discloses a monoclone antibody of a grouper iridovirus MCP gene WB guarantee type and a preparation method thereof. The monoclone antibody is produced by a hybridoma cell strain SGIV-MCP-7C8 1F4, and the preservation number of the hybridoma cell strain SGIV-MCP-7C8 1F4 is GDMCC No: 64609. The successful preparation of the monoclone antibody of the SGIV MCP in the application lays a foundation for the establishment of an immunological detection method of the SGIV and the research on a pathogenic mechanism of virus infection, and the monoclone antibody can be used for quantitative and positioning analysis of the SGIV MCP in and out of the body.

Description

Technical Field

[0001] This invention belongs to the interdisciplinary field of immunology and virology, specifically relating to a WB-protective monoclonal antibody against the MCP gene of grouper iridovirus and its preparation method. Background Technology

[0002] Grouper, an important marine economic fish, has significant economic value in aquaculture in southern regions. However, infection with Singapore grouper iridovirus (SGIV) poses a serious threat to the aquaculture industry, leading to high mortality rates and substantial economic losses. SGIV is a highly pathogenic virus that can cause spleen hemorrhage and swelling in grouper, with a mortality rate exceeding 90% within one week of infection. Currently, SGIV detection mainly relies on PCR technology, but this method suffers from problems such as susceptibility to contamination, high false positive rates, high equipment costs, and operational inconvenience.

[0003] To overcome the shortcomings of existing detection methods, it is urgent to develop a rapid, accurate, highly specific, and low-cost detection method. Monoclonal antibodies are considered an ideal detection tool due to their high specificity and sensitivity. However, the preparation process of monoclonal antibodies is complex, time-consuming, and carries the risk of preparation failure. Therefore, developing a monoclonal antibody preparation method that can guarantee the quality of monoclonal antibodies, especially ensuring positive results in Western Blot (WB) detection, is of great significance for improving detection efficiency and accuracy.

[0004] In existing technologies, researchers have constructed prokaryotic expression vectors to express the major capsid protein (MCP) of SGIV and used this recombinant protein to immunize animals, thus preparing polyclonal antibodies. These antibodies have shown good specificity and sensitivity in the detection of SGIV. However, due to their molecular diversity, polyclonal antibodies may have limitations in some applications. In contrast, monoclonal antibodies offer higher concordance and reproducibility, which is crucial for ensuring the reliability of detection results. Summary of the Invention

[0005] In view of this, the present invention aims to provide a WB guarantee monoclonal antibody targeting the SGIV MCP gene and its preparation method, in order to improve the accuracy and efficiency of SGIV detection, help promote the development of grouper disease prevention and control technology, and provide technical support for the sustainable development of grouper aquaculture.

[0006] The first objective of this invention is to provide a hybridoma cell line SGIV-MCP-7C8 1F4 capable of producing a WB guarantee monoclonal antibody against the MCP gene of grouper iridovirus, which was deposited on May 11, 2024, at the Guangdong Provincial Microbial Culture Collection Center (GDMCC), located at Building 59, No. 100 Xianlie Middle Road, Guangzhou, 510070, China, with accession number GDMCC No: 64609.

[0007] The second objective of this invention is to provide a WB-guarantee monoclonal antibody against the MCP gene of grouper iridovirus, which is produced by the hybridoma cell line SGIV-MCP-7C8 1F4.

[0008] A third objective of this invention is to provide the application of the hybridoma cell line SGIV-MCP-7C8 1F4 in the production of a WB-guaranteed monoclonal antibody against the MCP gene of grouper iridovirus.

[0009] The fourth objective of this invention is to provide the application of a WB-protective monoclonal antibody against the MCP gene of grouper iridovirus in the preparation of products for detecting grouper iridovirus.

[0010] Preferably, the application of a WB-guarantee monoclonal antibody against the MCP gene of grouper iridovirus is provided in the preparation of products for detecting the MCP protein antigen of grouper iridovirus.

[0011] Preferably, the product is selected from any one of reagents or kits.

[0012] Preferably, the kit is selected from any one of colloidal gold immunoassay kits, chemiluminescence immunoassay kits, radioimmunoassay kits, enzyme-linked immunosorbent assay kits, or fluorescence immunoassay kits.

[0013] The fifth objective of this invention is to provide a product for detecting grouper iridovirus, comprising a WB-protective monoclonal antibody against the MCP gene of the grouper iridovirus.

[0014] The sixth objective of this invention is to provide a method for detecting grouper iridovirus, using the aforementioned grouper iridovirus MCP gene WB guarantee monoclonal antibody, or the aforementioned product for detecting grouper iridovirus, to detect the sample to be tested.

[0015] The seventh object of the present invention is to provide the application of the WB guarantee monoclonal antibody for the MCP gene of the grouper iridovirus or the product for detecting grouper iridovirus in the detection of grouper iridovirus.

[0016] This invention uses purified recombinant SGIV MCP protein as an antigen to immunize BALB / c mice. After cell fusion, fused hybridoma cells are generated. These cells are then screened using an indirect enzyme-linked immunosorbent assay (ELISA) to obtain a stable hybridoma cell line (7C8 1F4) that secretes a Western blot guarantee monoclonal antibody against the grouper iridovirus MCP gene. Immunoblotting results show that the monoclonal antibody 7C8 1F4 of this invention has excellent specificity, specifically recognizing SGIV prokaryotic expression products and viral MCP in infected cells. The successful preparation of the SGIV MCP monoclonal antibody in this invention lays the foundation for the establishment of SGIV immunological detection methods, antiviral immunomodulators, and research on the pathogenesis of viral infection.

[0017] The hybridoma cell line SGIV-MCP-7C8 1F4 was deposited on May 11, 2024, at the Guangdong Provincial Microbial Culture Collection Center (GDMCC), located at Building 59, No. 100 Xianlie Middle Road, Guangzhou, 510070, China, with accession number GDMCC No: 64609. Attached Figure Description

[0018] Figure 1 This is an SDS-PAGE electrophoresis image of the purified recombinant SGIV MCP protein. In the image, 1 represents the protein molecular weight standard (marker), and 2 represents the purified recombinant SGIV MCP protein.

[0019] Figure 2 Immunoblot screening was used to select hybridoma-positive cells. 1 is the culture supernatant of hybridoma cells 7C8 1F4; 2 is the culture supernatant of hybridoma cells 4A9 1E7; and 3 is the culture supernatant of hybridoma cells 7H8 2F7.

[0020] Figure 3 SDS-PAGE identification of purified monoclonal antibodies. In this diagram, 1 represents the protein molecular weight standard (Marker), and 2 represents the monoclonal antibody purified from ascites fluid prepared from hybridoma cells 7C8 1F4.

[0021] Figure 4 This is a Western blot analysis of purified monoclonal antibodies against MCP protein in virus-infected cells. In Figure 1, SGIV-infected cells were used as the detection antigen, and the antibody prepared from hybridoma cells 7C81F4 was used as the primary antibody.

[0022] Figure 5 This study describes the specificity of purified monoclonal antibodies against viruses. SGIV represents grouper iridovirus, RGNNV represents nerve necrosis virus, ISKNV represents mandarin fish infectious spleen and kidney necrosis virus, LMBV represents California bass iridovirus, and control represents uninfected cell samples. Detailed Implementation

[0023] The following embodiments are further illustrations of the present invention, but not limitations thereof. Specific experimental conditions and methods are not specified in the following embodiments, and the techniques used are generally conventional methods well known to those skilled in the art.

[0024] Example 1: Construction and protein expression of recombinant plasmid for prokaryotic expression of grouper iridovirus MCP

[0025] (1) The open reading frame sequence of the SGIV MCP gene (as shown in SEQ ID NO.1) was cloned into the prokaryotic expression vector pET-B2m (purchased from Wuhan Jinkairui Biotechnology Co., Ltd.) using restriction endonucleases BamHI and XhoI to construct the recombinant expression vector pET-B2m-SGIV MCP; the recombinant plasmid pET-B2m-SGIV MCP was transformed into Escherichia coli BL21 competent cells, positive bacteria were screened by colony PCR and sequenced for verification.

[0026] >SEQ ID NO.1

[0027] ATGACTTGTACAACGGGTGCTGGCGTAACCAGTGGCTTCATAGATTTGGCCACGTACG

[0028] ACAATCTCGACAGAGCGTTATACGGCGGAAAGGACGCCACTACGTACTTTATCAAAGA

[0029] GCATTATCCCGTAGGATGGTTCACCAAGCTTCCCACCATGGCCACCAGAGTGTCTGGA

[0030] AACCCAGCGTTCGGGCAAGAGTTTTCGGTCGGGGTTCCCAGGTCGGGCGATTACGTG

[0031] CTCAACGCCTGGCTCACTCTTAAAACCCCCGAAATTAAACTGCTCGAAACAAATAGGC

[0032] TCGGCGCAAACGGTACCGTGAGGTGGACCAAAAACCTAATGCACAACGCTGTAGAGC

[0033] ACGCTTCTCACCTTCAACGAATTTGCGCGCAGCAGTTTAACACAGCGTATTTAGAC

[0034] GCTTGGACACAGTTTAACATGTGCGAAGGTAAACGCATAGGTTACGACAACATGATCG

[0035] GGAACACCAGCGACATGACCAACCCCACTCCCGCTCAGGGTCAGGACGGCGCAAGG

[0036] ACACTACCTTCCAAAAATTTAGTGCTCCCGTTGCCGTTCTTTTTCAGCAGAGACTGCG

[0037] GATTGGCTCTGCCCACCGTAGTGTTGCCCTATAATGAAATCAGAATCAACATTAAACTG

[0038] AGGTCGCTTCAGGAGCTTTTAGTGTTTCAGAACAAAGACACCGGAAATGTGATTCCTA

[0039] TCTCTGCTACCGACATAGCCGGCGGGCTCGCCGACACCGTGGAAGCTTACGTGTATAT

[0040] GACCGTGGGTCTCGTTTCCAACGTGGAAAGGTGCGCCATGGCAGGGACCGTCAGGGA

[0041] TATGGTCGTAGAACAAATGCAGGCCGCCCCCACACACATCGTTAACCCTCAAAACACA

[0042] AATAACGTCCACGTAGACATGAGGTTCTCGCACGCCGTGAAAGCCCTCTTTTTCATGG

[0043] TGCAAAACGTCACTTATAAATCTGTGGGTTCAAATTATACGTGTGTAACACCAGTTAAC

[0044] GGTCCGGGCAACACCGTGATGGAGCCCGCCATGTCCGTTGATCCCATCAAAAGCGCCA

[0045] GCCTCACGTACGAAAATACGACCAGGTTGGCAAATATGGGTGTAGAGTATTACTCTCTG

[0046] GTACAACCTTGGTATTTTTCAGCCTCCATTCCAGTGTACACCGGATACCACATGTATTCA

[0047] TACGCCCTAAACGTGGGCAGCGTTCATCCTTCGGGGTCTACCAATTACGGAAGATTGA

[0048] CCAACGCTAGCATCACTGTAACAATGTCCCCGAGTCTGTCGTCGCCGCAGCAGGAGG

[0049] AGGTAACAATAATTCTGGTTACAACGAACCTCAGAGGTTCGCGTTGGTAGTGATCGCCGTAAACCATAACGTCATCAGAATCATGAACGGTTCCATGGGGTTCCCTATCTTGTAA.

[0050] (2) The positive bacteria with correct sequencing were placed in LB liquid medium containing 50 μg / mL kanamycin and cultured overnight at 37°C with shaking. The next day, the bacterial culture was diluted 1:100 by volume and cultured until the bacterial OD600 was about 0.6. Then, isopropyl β-D-thiogalactoside (IPTG) was added to a final concentration of 0.5 mmol / L to induce protein expression.

[0051] (3) Inclusion body protein purification. The protein was purified according to the inclusion body protein purification method. The specific procedure is as follows: ① Collect the bacterial culture, resuspend the bacterial cells in pre-cooled NTA-0 buffer, incubate on ice for 30 min, sonicate for 25-30 min (parameters set to power 200W, working for 3s, pausing for 4s), centrifuge at 16000rpm / min and 4℃ for 50 min, and discard the supernatant. ② Resuspend the precipitate in STET buffer (1 mM DTT), sonicate for 10 min (power 200 W, 3 s on, 3 s off); centrifuge at 10000 rpm / min, 4℃ for 10 min, and discard the supernatant; ③ Repeat step ② three times until the supernatant is clear; ④ Resuspend the precipitate in PBS, sonicate (power 200 W, 3 s on, 3 s off, 5 min); centrifuge at 16000 rpm / min, 4℃ for 10 min, and discard the supernatant; ⑤ Resuspend the inclusion bodies in 4 mL of SKL (sodium dodecyl sarcosinate), add 5 mM DTT, and vortex at 37℃ until all inclusion bodies are dissolved. Centrifuge at 10000 rpm / min, 4℃ for 10 min, and collect the supernatant protein solution.

[0052] (4) Inclusion body protein refolding. ① Dilute the protein solution with 2 times the volume of 3M guanidine hydrochloride, and add it dropwise at 4℃ to 200mL of refolding solution (weigh 0.077g oxidized glutathione, 0.385g reduced glutathione, 0.186g EDTA·2Na, 17.42g arginine, 3.03g Tris base, dissolve in deionized water, adjust pH to 8.0 with concentrated hydrochloric acid, and bring the volume to 250mL). Stir at maximum speed for 24h; reduce speed and continue stirring for 24h; ② Transfer the protein solution to a dialysis bag, concentrate with PEG20000 to 50-100mL, and dialyze overnight in TE buffer at 4℃; ③ Transfer the protein solution, concentrate with PEG20000 to 2-4mL, dialyze overnight in TE buffer at 4℃, and perform SDS-PAGE analysis.

[0053] (5) Affinity purification of renatured proteins. ① The renatured protein solution from step (5) above was filtered through a 0.22 μm filter and purified using a Ni-NTA column; ② The protein solution was loaded onto the column at a flow rate of 1 mL / min; the column was washed with NTA-0 buffer (pH 8.0) until the eluent was free of protein (G250 detection solution did not change color); ③ The column was eluted with eluents containing 20 mM, 60 mM, 200 mM, and 500 mM imidazole, respectively, and the eluent was collected in fractions until the G250 detection solution did not change color; ④ The column material was washed with 3 column volumes of deionized water, and the column was sealed with 20% ethanol. The collected eluent was then analyzed by SDS-PAGE electrophoresis. ⑤ The fraction that met the purity requirements was dialyzed with TE at 4 °C; the dialyzed product was concentrated by ultrafiltration at 4 °C, and the protein purification status was detected by SDS-PAGE. SDS quality control results showed that the MCP recombinant protein, after inclusion body purification, protein refolding, and Ni-NTA column purification, had a target band with a molecular weight of 60 kDa, a protein concentration of approximately 3 mg / mL, and a purity of approximately 85%. Figure 1 This yielded purified recombinant SGIV MCP protein, which meets the requirements for subsequent immunization.

[0054] Example 2: Preparation of WB-protective monoclonal antibody against MCP gene of grouper iridovirus

[0055] (1) Immunity

[0056] SPF-grade female BALB / c mice were immunized using purified recombinant SGIV MCP protein as the antigen. A total of eight mice were immunized in this invention. Immunization was performed in four subcutaneous injections: ① First immunization: Each mouse was subcutaneously injected with 50 μg of purified recombinant SGIV MCP protein and an equal volume of Freund's complete adjuvant (V / V), immunization time 2-3 weeks; ② Second immunization: Each mouse was subcutaneously injected with 50 μg of purified recombinant SGIV MCP protein and an equal volume of Freund's incomplete adjuvant (V / V), immunization time 2 weeks; ③ Third immunization: Each mouse was subcutaneously injected with 50 μg of purified recombinant SGIV MCP protein and an equal volume of Freund's incomplete adjuvant (V / V), immunization time 1 week. The titer was determined by ELISA after the third immunization; ④ Fourth immunization: Each mouse was subcutaneously injected with 50 μg of purified recombinant SGIV MCP protein and an equal volume of Freund's incomplete adjuvant (V / V), immunization time 2 weeks. The titer was determined by ELISA after the fourth immunization. ⑤ Intraperitoneal shock: Each mouse was injected intraperitoneally with 50 μg of purified recombinant SGIV MCP protein, and the immunization period was 3 days.

[0057] (2) Cell fusion

[0058] ① Preparation of immune spleen cells: Blood was collected from immunized BALB / c mice after enucleation, and the serum was separated to serve as a positive control serum for antibody detection. Mice were euthanized by cervical dislocation, and the spleens were aseptically removed and placed in a 3.5cm culture dish. Fat and connective tissue were removed from the spleens. The spleens were ground with a grinding rod to allow the lymphocytes to pass through a silk screen to form a single-cell suspension. The suspension was collected in a 15mL centrifuge tube. The cells were centrifuged at 1000rpm / min for 5min, the supernatant was discarded, and the precipitate was resuspended in RPMI-1640 solution for later use.

[0059] ②Preparation of SP2 / 0 myeloma cells: Resuscitate SP2 / 0 myeloma cells frozen at -80℃, and rapidly thaw them in a 37℃ water bath; centrifuge at 1000 rpm / min for 5 min, aspirate the supernatant, add 1 mL of GIT medium (Hyclone DMEM, Thermo), and transfer to 24-well plates. Perform expanded passage culture the next day. Observe cell status approximately two days later, and select cells with good growth and morphology in the logarithmic growth phase for subsequent fusion. Change the medium 12 hours before fusion.

[0060] ③ Feeder layer cell preparation: The spleens of healthy BALB / c mice were removed under sterile conditions and a single spleen cell suspension was prepared in HAT medium containing 20% ​​fetal bovine serum. The suspension was then pre-coated into 96-well plates according to the number of plates to be plated.

[0061] ④ SP2 / 0 myeloma cells and spleen cells were mixed in a certain ratio (1:5), treated with 50% PEG1450 for 1 min, and the mixture was diluted with DMEM basal medium to stop the reaction. After low-speed centrifugation, the cells were gently resuspended and mixed with HAT medium containing 20% ​​fetal bovine serum.

[0062] ⑤ Fusion cells are fused at a rate of 2 × 10 7 Each cell / plate was seeded into a pre-prepared feeder plate and incubated at 37°C with 5% CO2. Cell growth and contamination were checked daily after fusion. Once the fused cells formed cell clusters, the culture supernatant was collected for screening.

[0063] (3) Screening, cloning and subtype identification of hybridoma cells

[0064] 1) Fusion plate detection: After the medium in the fusion plate is changed, the cells grow to a medium size of approximately 1×10⁻⁶. 4 Testing begins when there are more than [number] cells. Indirect enzyme-linked immunosorbent assay (ELISA) is used to screen for positive hybridoma cells. The specific steps are as follows: ① Antigen coating: Purified recombinant SGIV [cells are coated with antigen]. ① Coat the microplate with MCP protein at a concentration of 1 μg / mL and incubate overnight at 4°C; ② Block: Block with 5% skim milk powder at 37°C for 2 h, and wash 3 times with TBST; ③ Add different dilutions of the hybridoma cell culture supernatant to the 96-well plate, 100 μL / well, and incubate at 37°C for 1 h, with PBS as a blank control; ④ After primary antibody incubation, wash 3 times with TBST, add 1:10000 horseradish peroxidase (HRP)-labeled goat anti-mouse IgG secondary antibody, 100 μL / well, and incubate at 37°C for 40 min; after secondary antibody incubation, wash 5 times with TBST; ⑤ Color development: Add 90 μL of substrate chromogenic agent (TMB chromogenic solution) to each well and incubate at room temperature in the dark for 15 min; ⑥ Stop the reaction and measure the colorimetric value: Add 50 μL of H2SO4 to each well to stop the reaction, and measure the absorbance at 450 nm using a microplate reader. After the ELISA quality control is qualified (i.e., negative control <0.2, positive control >1.0), select positive wells (generally OD450≥0.5) for subcloning.

[0065] 2) Subcloning Method and Detection: Cell lines with high titers and affinity were selected from the fusion plates and subjected to limiting dilution. Subcloning was performed by counting 60% of the single-clone wells per plate. Each time, single-clone wells with high positive values ​​were selected for limiting dilution. ELISA detection was performed 4-5 days after each subcloning. After two rounds of subcloning screening, single-clone cell lines that stably secreted positive antibodies were finally selected for fixed-line expansion culture. The supernatant from each round of subcloned cell culture was detected using the ELISA method described above. After ELISA detection, this invention screened out 8 cell lines that stably secreted positive antibodies.

[0066] 3) Cell line establishment and expansion culture: Stable cell lines secreting positive antibodies, selected during the subcloning stage, were expanded and cultured in 24-well plates. After expansion, the supernatant was collected, and the recognition of antigens by antibodies in the supernatant was detected by Western blotting. Cells were then collected and expanded into 10cm culture dishes, and the supernatant was collected again to detect the antibody titer. The specific steps of the immunoblotting method are as follows: SGIV-infected cells were used as samples. Proteins were separated by SDS-PAGE, and the proteins on the gel were transferred to a polyvinylidene fluoride (PVDF) membrane using an electroporator. The membrane was blocked with PBS solution containing 1% casein for 30 min. Monoclonal antibody hybridoma cell supernatant and immunized mouse serum were added, and the membrane was incubated overnight at 4°C. After washing three times with PBS solution (PBS solution containing 0.05% Tween-20), alkaline phosphatase-labeled goat anti-mouse IgG antibody (1:10000 dilution) was added, and the membrane was incubated at 37°C for another 1.5 h. The membrane was then washed three times with PBS solution (PBS solution containing 0.05% Tween-20). The substrate mixture was then added for visualization and observation. Immunoblotting results showed that eight hybridoma cell lines were identified after subcloning. Endogenous samples from the supernatant of cells with high antibody titers were analyzed by Western blotting. The results indicated that the culture supernatants of hybridoma cells 7C8 1F4, 4A9 1E7, and 7H8 2F7 could all effectively detect relatively single target bands, with hybridoma cell line 7C8 1F4 showing the best results. Figure 2 Subsequently, hybridoma cells 7C8 1F4 were selected to prepare ascites.

[0067] The hybridoma cell line 7C8 1F4 was named SGIV-MCP-7C8 1F4 and was deposited on May 11, 2024, at the Guangdong Provincial Microbial Culture Collection Center (GDMCC), located at Building 59, No. 100 Xianlie Middle Road, Guangzhou, 510070, China, with accession number GDMCC No. 64609.

[0068] 4) Ascites preparation and purification

[0069] First, liquid paraffin was injected into the peritoneal cavity of mice. One week later, hybridoma cells 7C8 1F4 were inoculated into the peritoneal cavity of mice. After 7-10 days, the ascites fluid was collected for purification. After pretreatment, the collected ascites fluid was purified using a Protein G-agarose affinity chromatography column. The specific steps are as follows: ① Buffer preparation: The starting buffer was pH 7.0, 20 mmol / L phosphate buffer; the elution buffer was pH 3, 0.1 mmol / L glycine hydrochloride; ② Collection tube preparation: Take 1.5 mL centrifuge tubes and add 70 μL of pH 9.0, 0.1 mmol / L Tris-HCl to each centrifuge tube; ③ Sample preparation: The sample obtained by 50% SAS precipitation was dialyzed overnight in the starting buffer and filtered through a 0.22 μm microporous membrane; ④ Purification process: Column pretreatment: Wash 3-5 times with 10 column volumes of deionized water at a flow rate of 1 mL / min. Equilibrate the Protein G-agarose affinity chromatography column (HiTrap Protein G 1 mL, Pharmacia Biotech) with 10 column volumes of starting buffer (containing 0.3 M NaCl), wash 3-5 times at a flow rate of 1 mL / min. Sample loading: Load 15-25 mL of the sample to be purified (ascites fluid diluted with starting buffer) onto the column at a flow rate of 0.6 mL / min. Washing: Wash with starting buffer until no protein is detected (G250 does not turn blue), at a flow rate of 1.5 mL / min. Antibody elution: Elute with elution buffer, collect the eluent, and detect the eluent with G250 until it does not turn blue. pH adjustment: Adjust the pH of the eluent to neutral with saturated sodium carbonate. Sample concentration: Concentrate the sample to 1-5 mL using a 10 kDa ultrafiltration tube. Dialysis: Dialyze overnight with 5 L of 0.01 M pH 7.4 PBS, changing the medium once the next day. Purity and activity identification: Identify the purity of the purified monoclonal antibody using SDS-PAGE.

[0070] In this implementation plan, 7.5 mL of ascites fluid was collected from each sample, and one antibody strain was purified. SDS-PAGE analysis of the purified monoclonal antibody showed two protein bands with molecular weights of approximately 51 kDa and 25 kDa, respectively. Figure 3 The antibody purity was above 90%, indicating that the purified antibody had high purity.

[0071] Example 3: Characterization of the properties of WB-protective monoclonal antibody against MCP gene of grouper iridovirus

[0072] 1) Determination of antibody concentration in purified ascites fluid from monoclonal antibodies

[0073] The concentration of purified monoclonal antibody from ascites fluid was determined using an indirect ELISA method. The purified recombinant SGIV MCP protein was used as the coating antigen to determine the concentration of the purified antibody. ELISA results showed that the antibody concentration prepared from 7C8 1F4 was 3 mg / mL.

[0074] 2) Identification of monoclonal antibody subtypes

[0075] Thermo Scientific monoclonal antibody typing kit was used to identify the subtypes of the supernatants from the selected monoclonal cells using an indirect ELISA method. The results showed that the antibodies in all eight cell lines were of a single subtype (Table 1).

[0076] Table 1 Results of Clonal Subtype Detection at Established Plants

[0077] Subtype IgG1 IgG1 IgG1 IgG1 IgG2b IgG1 IgG1 IgG1

[0078] 3) Monoclonal antibody titer detection

[0079] The titer of the antibody prepared from 7C8 1F4 was determined using an indirect ELISA method. The purified recombinant SGIVMCP protein was used as the coating antigen to determine the antibody titer of 7C8 1F4. The results are shown in Table 2.

[0080] Table 2. 7C8 1F4 Antibody Titer Detection

[0081]

[0082]

[0083] The results of indirect ELISA showed that the 7C8 1F4 antibody had good affinity and high detection sensitivity.

[0084] 4) Specific recognition and identification of monoclonal antibodies

[0085] The immunoblotting method described above was used to detect the recognition of endogenous MCP by antibody 7C81F4 obtained after purification of ascites fluid. The results showed that a positive band of MCP, approximately 51 kDa, could be detected in samples of SGIV-infected cells. Figure 4 This indicates that the monoclonal antibody 7C8 1F4 described in this invention can recognize the major capsid protein MCP of SGIV.

[0086] Example 4: Application of WB-protective monoclonal antibody against MCP gene of grouper iridovirus

[0087] A WB-protective monoclonal antibody against the MCP gene of grouper iridovirus is used for specific detection of viral infection.

[0088] The Western blot assay was used to determine the WB guarantee monoclonal antibody for the grouper iridovirus MCP gene in this invention for specific detection of viral infection. Results showed that a positive band of MCP (approximately 51 kDa) was detectable in SGIV-infected cell samples, while no band was detected in cell samples infected with nerve necrosis virus (RGNNV), mandarin fish infectious spleen and kidney necrosis virus (ISKNV), or California bass iridovirus (LMBV), or in uninfected cell samples. Figure 5 This demonstrates that the monoclonal antibody 7C8 1F4 described in this invention can specifically detect viral infection.

[0089] The above are merely preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be considered as limitations on the present invention, and the scope of protection of the present invention should be determined by the scope defined in the claims. For those skilled in the art, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Hybridoma cell line SGIV-MCP-7C8 1F4, with accession number GDMCC No: 64609.

2. A grouper iridovirus MCP gene WB guarantee monoclonal antibody, characterized in that, It is produced by the hybridoma cell line SGIV-MCP-7C8 1F4 as described in claim 1.

3. The use of the hybridoma cell line SGIV-MCP-7C8 1F4 as described in claim 1 in the production of WB guarantee monoclonal antibody against the MCP gene of grouper iridovirus.

4. The application of the grouper iridovirus MCP gene WB guarantee monoclonal antibody as described in claim 2 in the preparation of products for detecting grouper iridovirus.

5. The application according to claim 4, characterized in that, It is used in the preparation of products for detecting grouper iridovirus MCP protein antigen.

6. The application according to claim 4 or 5, characterized in that, The product is selected from any one of the reagents or kits.

7. The application according to claim 6, characterized in that, The kit is selected from any one of colloidal gold immunoassay kits, chemiluminescence kits, radioimmunoassay kits, enzyme-linked immunosorbent assay kits, or fluorescence immunoassay kits.

8. A product for detecting iridovirus in grouper, characterized in that, The monoclonal antibody containing the WB guarantee type of the MCP gene of the grouper iridovirus as described in claim 2.

9. A method for detecting grouper iridovirus for non-disease diagnosis and treatment purposes, characterized in that, The sample to be tested is tested using the grouper iridovirus MCP gene WB guarantee monoclonal antibody as described in claim 2, or the grouper iridovirus detection product as described in claim 8.

10. The use of the grouper iridovirus MCP gene WB guarantee monoclonal antibody of claim 2 or the product for detecting grouper iridovirus of claim 8 in the non-disease diagnosis and treatment purposes for the detection of grouper iridovirus.

Images