Animal model of alcoholic liver disease of gata4 and application in prophylactic and therapeutic drugs

Abstract

This invention discloses the construction of an animal model of alcoholic liver disease using the Gata4 gene and its application in preventive and therapeutic drugs, belonging to the field of mouse model construction technology; the method for constructing this animal model is as follows: Gata4... flox Transgenic heterozygous mice were crossed with Vil1-Cre transgenic mice to obtain the F1 generation. The F1 generation was then classified with the Gata4 genotype. flox / + Transgenic Vil1-Cre mice were self-crossed to obtain F2 generation mice. The genotypes of these mice were identified using polymerase chain reaction (PCR) amplification. After screening, mice with the genotype Gata4 were obtained. flox / flox Vil1-Cre Gata4 intestinal-specific knockout mice were then fed a Lieber-DeCarli liquid alcohol diet to Gata4 intestinal-specific knockout mice, resulting in a Gata4 intestinal-specific knockout alcoholic liver injury mouse model after 7 weeks. This invention provides a method for constructing an animal model of alcoholic liver disease with specific knockout of the intestinal Gata4 gene, and the application of Gata4 as a target in the preparation of drugs for the prevention and treatment of alcohol-induced liver injury, liver disease, and related conditions, which has significant clinical potential.

Description

Technical Field

[0001] This invention relates to the field of animal model construction, and more specifically, to an animal model of alcoholic liver disease with intestinal-specific knockout of the Gata4 gene, its construction method and application, and the application of the Gata4 gene as a target in the development of drugs for the prevention and treatment of ALD. Background Technology

[0002] Alcoholic liver disease (ALD) is a liver condition caused by long-term heavy alcohol consumption. The progression of this damage typically involves several stages: fatty liver, alcoholic hepatitis, liver fibrosis, and cirrhosis. Initially, ALD usually presents as simple fatty liver, which can then develop into alcoholic hepatitis, liver fibrosis, and cirrhosis. Severe alcohol abuse can induce widespread hepatocellular necrosis and even liver failure. The toxic effects of alcohol on the liver are primarily achieved through the production of acetaldehyde in the liver. Accumulation of acetaldehyde directly damages hepatocellular cells and triggers a series of inflammatory responses, leading to liver damage. Although comprehensive symptomatic treatment can significantly improve prognosis, liver transplantation becomes the only effective treatment for patients who progress to severe acute liver failure, and these patients have a high mortality rate.

[0003] Pathologically, Alcoholic Lung Disease (ALD) presents as a multi-stage process, progressing from hepatic steatosis (fatty liver) to alcoholic hepatitis and then to alcoholic cirrhosis. Fatty liver is a common early manifestation; hepatitis is characterized by ballooning degeneration of hepatocytes and the formation of Mallory bodies; cirrhosis is characterized by extensive fibrosis and the formation of regenerating hepatocyte nodules, which may lead to portal hypertension and liver failure, ultimately increasing the risk of liver cancer. Clinically, early liver disease may be asymptomatic or present with only mild fatigue and upper abdominal discomfort. As the disease progresses, patients may develop symptoms such as jaundice, loss of appetite, tenderness in the liver area, and fever. In the late stage of cirrhosis, patients commonly experience ascites, edema, and bleeding tendencies, and may even exhibit hepatic encephalopathy. If the disease further progresses to liver cancer, symptoms such as a mass in the liver area, severe pain, and severe weight loss may occur. Laboratory tests reveal elevated serum levels of AST (aspartate aminotransferase), ALT (alanine aminotransferase), GGT (gamma-glutamyl transferase), TBil (total bilirubin), PT (prothrombin time), MCV (mean corpuscular volume), and CDT (glucose-deficient transferrin). Imaging studies such as ultrasound, CT, MRI, or transient elastography can reveal structural and functional abnormalities in the liver. Extensive research has been conducted on the development, progression, and repair of alcoholic liver injury; however, specific drugs targeting alcoholic liver injury remain lacking in clinical practice. Therefore, in-depth exploration of the molecular mechanisms of hepatocyte proliferation and repair during the development of acute liver injury is crucial for identifying more effective intervention targets for acute liver injury.

[0004] Currently, clinical treatment for ALD primarily focuses on alcohol abstinence, nutritional support, symptom improvement, and prevention of complications. New drug development for ALD is progressing slowly. Some drugs, such as corticosteroids (prednisolone), pentoxifylline, and TNF-α inhibitors (infliximab), are still in clinical trials. However, most of these drugs have single targets and are unlikely to slow or stop the progression of alcoholic liver disease. Therefore, a deeper understanding of the pathogenesis of alcoholic liver disease and the development of safe and effective anti-ALD drugs are of great significance. However, there are still many shortcomings and areas for improvement in ALD research and technology, especially the lack of specific treatments for alcohol-induced liver injury in clinical practice, which urgently needs to be addressed. Summary of the Invention

[0005] To address the problems existing in the prior art, the first objective of this invention is to provide an animal model of alcoholic liver disease with intestinal-specific knockout of the Gata4 gene. Compared with the traditional alcoholic liver injury model constructed by the Lieber-DeCarli liquid alcohol diet, this animal model exhibits more severe pathological damage such as transaminase levels, hepatic steatosis, and inflammation. The second objective of this invention is to provide the application of the Gata4 gene as a target in drugs for the prevention and treatment of alcoholic liver injury.

[0006] To solve the above problems, the present invention adopts the following technical solution.

[0007] The method for constructing an animal model of alcoholic liver disease by intestinal-specific knockout of the Gata4 gene is as follows: The Gata4 gene is... flox Transgenic heterozygous mice and Vil1-Cre transgenic mice were crossed to obtain the F1 generation. The F1 generation was then screened, and the genotype of the mice was determined to be Gata4. flox / + Vil1-Cre transgenic mice were self-crossed to obtain F2 generation mice. A 1 mm tail was removed from each mouse, and the mice were digested with 250 μL of lysis buffer. Genomic DNA was extracted, primers were designed, and polymerase chain reaction (PCR) amplification was used to identify the mouse genotype. After screening, the genotype Gata4 was obtained. flox / flox Vil1-Cre Gata4 intestinal-specific knockout mice were then fed a Lieber-DeCarli liquid alcohol diet to Gata4 intestinal-specific knockout mice, resulting in a Gata4 intestinal-specific knockout alcoholic liver injury mouse model after 7 weeks.

[0008] Furthermore, the PCR amplification reaction system was 25 μL, containing 9 μL ddH2O, 12.5 μL Premix Taq Polymerase, 1.5 μL DNA template, and 1 μL primers. The reaction conditions were as follows: pre-denaturation at 94 °C for 3 min, denaturation at 94 °C for 30 s, annealing at 62 °C for 35 s, and extension at 72 °C for 35 s. The denaturation-annealing-extension steps were repeated for 35 cycles. Finally, DNA extension was performed at 72 °C for 5 min, and the DNA was held at 12 °C after extension. The PCR products were detected by 1% agarose gel electrophoresis to analyze the mouse genotype and determine whether the mice were Gata4 intestinal-specific knockout mice.

[0009] The present invention also provides an animal model of alcoholic liver disease with intestinal-specific knockout of the Gata4 gene, which is obtained by the above-mentioned method for constructing an animal model of alcoholic liver disease with intestinal-specific knockout of the Gata4 gene.

[0010] This invention also provides an application of an animal model of alcoholic liver disease with intestinal-specific knockout of the Gata4 gene, for studying the effect of the intestinal Gata4 gene on alcoholic liver disease.

[0011] The present invention also provides the application of the Gata4 gene as a target in drugs for the prevention or treatment of alcoholic liver disease, wherein the Gata4 gene is used as a drug target for the prevention or treatment of alcoholic liver disease.

[0012] Furthermore, the Gata4 gene is used in the preparation of drugs for alleviating alcohol-induced liver dysfunction.

[0013] Furthermore, the Gata4 gene is used in the preparation of drugs for improving alcohol-induced liver inflammation and steatosis.

[0014] Furthermore, the Gata4 gene is used in the preparation of drugs for improving alcohol-induced disorders of intestinal bile acid and cholesterol metabolism.

[0015] This invention also provides a method for constructing an animal model of alcoholic liver disease with intestinal overexpression of the Gata4 gene. The method includes constructing an adeno-associated virus (OE-Gata4-AAV9) containing the Gata4 coding region sequence, injecting OE-Gata4-AAV9 into C57BL / 6 mice via intraperitoneal injection, and detecting intestinal Gata4 protein expression after 3 weeks. Increased Gata4 expression indicates successful construction of mice with intestinal overexpression of Gata4. After one week of acclimatization feeding, the control group mice were given a non-alcoholic liquid diet with the same calories, while the alcohol group was given a Lieber-DeCarli alcoholic liquid diet. After a 12-hour fast following the last feeding, samples were collected for analysis.

[0016] Compared with the prior art, the advantages of this invention are: I. Compared with the traditional Lieber-DeCarli liquid alcohol diet-based alcoholic liver injury model, the animal model prepared by this invention has more severe pathological damage such as transaminase levels, hepatic steatosis, and inflammation.

[0017] II. This invention constructed a mouse model with intestinal-specific Gata4 gene knockout and established an animal model of alcohol-induced liver injury by feeding mice a 5% liquid alcohol diet (Lieber-DeCarli liquid alcohol diet) for 7 weeks. Control group mice were given a non-alcoholic liquid diet with the same caloric content. Mice were fasted for 12 hours after the last feeding and samples were collected for analysis. Post-experiment analysis showed that long-term alcohol intake caused significant liver dysfunction and liver damage, and that intestinal Gata4 knockout exacerbated alcohol-induced liver damage and increased the level of inflammation in the body.

[0018] Third, the application of the Gata4 gene as a target in preventive and therapeutic drugs provided by this invention addresses the current lack of specific treatments for alcohol-induced liver injury in clinical practice, and expands the application of the intestinal Gata4 gene in the prevention and treatment of alcoholic liver injury.

[0019] IV. This invention also constructed an adeno-associated virus (OE-Gata4-AAV9) containing the Gata4 coding region sequence, and established a mouse model of intestinal Gata4 overexpression via intraperitoneal injection. After successful establishment, mice were fed a Lieber-DeCarli alcoholic liquid diet to induce an alcoholic liver injury model. After the last feeding, mice were fasted for 12 hours and samples were collected for analysis. The results showed that intestinal Gata4 overexpression significantly improved transaminase abnormalities, hepatic steatosis, and inflammatory responses induced by chronic alcoholism. Attached Figure Description

[0020] Figure 1 The liver function and liver pathology results of Gata4 intestinal-specific knockout mice (Gata4-CKO), littermate negative control mice (WT), and intestinal overexpressing Gata4 mice injected intraperitoneally with OE-Gata4-AAV9 (AAV-Gata4) are shown in the figure. Figure 2 The graph shows the expression levels of liver inflammatory cytokines CXCL5 and IL-33 in Gata4 gut-specific knockout mice (Gata4-CKO), littermate negative control mice (WT), and intestinal overexpression Gata4 mice after intraperitoneal injection of OE-Gata4-AAV9 (AAV-Gata4). Figure 3The figure shows the effect of intraperitoneal injection of OE-Gata4-AAV9 on the expression levels of intestinal Gata4 and ASBT in Gata4-specific knockout mice (Gata4-CKO), littermate negative control mice (WT), and mice with intestinal overexpression of Gata4. Figure 4 Figure 1 shows the effects of cholesterol deposition in the liver and the expression of FGFR4 and CYP7A1 proteins in the liver tissue of Gata4 intestinal-specific knockout mice (Gata4-CKO), littermate negative control mice (WT), and mice with intestinal overexpression of Gata4 after intraperitoneal injection of OE-Gata4-AAV9. Detailed Implementation

[0021] Example 1: Establishment of an animal model of alcoholic liver disease in Gata4 gut-specific knockout mice I. Experimental Animals and Principles for Constructing Gata4 Intestinal-Specific Knockout Mice: The mice used in this invention are Gata4 mice. flox and Vil1-Cre transgenic mice. Gata4 flox The mice possess a LoxP site flanking an exon of the GATA-binding protein 4 (Gata4) gene. Gata4 is a zinc finger transcription factor belonging to the GATA family. Villin-Cre is a transgenic mouse model that utilizes the Vil1 gene promoter to control Cre recombinase expression, and Vil1 is the gene encoding the villin 1 protein. Vil1-Cre mice carry a Cre recombinase expression element driven by the endogenous mouse Vil1 promoter. When crossed with mice containing the LoxP flanking sequence, Cre recombinase-mediated recombination results in the deletion of the sequence between two unidirectional LoxP sites on the chromosome in the villi and crypt epithelial cells of the small and large intestines of the progeny mice. Expression of this Cre recombinase transgene begins at 12.5 days post-fertilization, and some chimeric activity is also observed in the colon.

[0022] II. Animal Source: All experimental animals used in this invention were constructed, fed, and bred at the animal center of Cyagen (Suzhou) Biotechnology Co., Ltd. The mice were housed in an SPF-grade clean environment with a temperature controlled at 18–22 °C and humidity at 50–70%, using automatic light control (12 hours of light / 12 hours of darkness). Cages, feed, and bedding were all sterilized, and drinking water was sterilized by high-temperature and high-pressure sterilization. The housing was disinfected daily to ensure the environment met SPF-grade animal environmental requirements, and bedding was changed every 3 days. Animal feeding, maintenance, and experimental procedures were all performed in accordance with the guidelines of the ethics committee.

[0023] III. The method for constructing the Gata4 intestinal-specific knockout mouse model of the present invention includes the following steps: (1) Gata4 floxTransgenic heterozygous mice and Vil1-Cre transgenic mice were crossed to obtain the F1 generation.

[0024] The identification methods and results for F1 generation mice are shown below: (1.1) PCR identification (a) PCR primer information Gata4 flox The primer sequences for genotype identification are as follows: F: TAGAGTACCACAGACCAGAAAGC; R:CACCTAACCTACTCAGACTCTTTTCTTC.

[0025] The primer sequences for Vil1-Cre genotyping are as follows: F: CATATTGGCAGAACGAAAACGC; R: CCTGTTTCACTATCCAGGTTACGG.

[0026] (b) The PCR product was amplified according to the reaction system and reaction conditions shown below: The amplification reaction system consisted of 25 μL, including 9 μL of ddH2O, 12.5 μL of Premix Taq Polymerase, 1.5 μL of DNA template, and 1 μL of primers. The reaction conditions were as follows: pre-denaturation at 94 °C for 3 min, denaturation at 94 °C for 30 s, annealing at 62 °C for 35 s, and extension at 72 °C for 35 s. The denaturation-annealing-extension process was repeated for 35 cycles. Finally, DNA extension was performed at 72 °C for 5 min. After extension, the PCR product was obtained and stored at 12 °C.

[0027] (1.2) Agarose gel electrophoresis The PCR amplification products obtained in step (1.1) were subjected to 1% agarose gel electrophoresis; and the identification results were obtained by comparing with the judgment criteria.

[0028] (a) Judgment Indicators I. Gata4 flox The genotype determination criteria are: Gata4 is characterized by the presence of two genotypes, with both approximately 282 bp and 242 bp bands appearing simultaneously. flox The heterozygous genotype (flox / +) with only a band of about 242 bp is the wild type; II. The criteria for determining the Vil1-Cre genotype are: there are two genotypes, the one with a band of about 413 bp is the Vil1-Cre genotype, and the one without a band is the wild type.

[0029] (b) Result of the identification There are four genotypes in the F1 generation of mice: ①Gata4 flox / + ,Vil1-Cre;②Gata4 flox / + ③Vil1-Cre and ④Wild-type mice.

[0030] (2) The genotype of Gata4 in step (1) flox / + The F1 generation of Vil1-Cre transgenic mice were self-crossed to obtain the F2 generation of mice.

[0031] The identification methods and results for the F2 generation mice are shown below: (2.1) PCR identification (a) PCR primer information Gata4 flox The primer sequences for genotyping transgenic mice are as follows: F: TAGAGTACCACAGACCAGAAAGC; R:CACCTAACCTACTCAGACTCTTTTCTTC.

[0032] The primer sequences for genotyping Vil1-Cre transgenic mice are as follows: F:CATATTGGCAGAACGAAAACGC; R: CCTGTTTCACTATCCAGGTTACGG.

[0033] (b) The PCR product was amplified according to the reaction system and reaction conditions shown below: The amplification reaction system consisted of 25 μL of ddH2O, 12.5 μL of Premix Taq Polymerase, 1.5 μL of DNA template, and 1 μL of primers. Reaction conditions: pre-denaturation was performed at 94 °C for 3 min, followed by denaturation at 94 °C for 30 s, annealing at 62 °C for 35 s, and extension at 72 °C for 35 s. The denaturation-annealing-extension process was repeated for 35 cycles. Finally, DNA extension was performed at 72 °C for 5 min. After extension, the PCR product was obtained and stored at 12 °C.

[0034] (2.2) Agarose gel electrophoresis The PCR amplification products obtained in step (2.1) were subjected to 1% agarose gel electrophoresis, and the identification results were obtained by comparing with the judgment criteria.

[0035] (a) Judgment criteria: I. Gata4 flox Genotype determination criteria: There are 3 genotypes; the one showing only a band of approximately 282 bp is Gata4. flox homozygous genotype (Gata4) flox / flox The simultaneous appearance of bands of approximately 282 bp and 242 bp indicates the Gata4 FLOX heterozygous genotype (Gata4). flox / + (); those with only about 242 bp bands are wild-type.

[0036] II. Criteria for determining the results of Vil1-Cre gene knockout: The appearance of a band of approximately 413bp indicates the Vil1-Cre genotype, while the absence of a band indicates the wild type; (b) Result of the identification: There are 6 genotypes in the F2 generation of mice: ①Gata4 flox / flox, Vil1-Cre (Gata4 gut-specific knockout mouse); ②Gata4 flox / flox (flox homozygous); ③Gata4 flox / + (flox heterozygote); ④Gata4 flox / + , Vil1-Cre; ⑤ Vil1-Cre and ⑥ wild-type mice.

[0037] After identification, the obtained F2 generation Gata4 gene-specific homozygous knockout mice (Gata4) were confirmed to be homozygous. flox / flox Vil1-Cre), namely the Gata4 intestinal-specific knockout mouse model.

[0038] IV. Establishing an animal model of alcoholic liver injury The alcoholic liver injury model of Gata4 intestinal-specific knockout mice was established as follows: After breeding a sufficient number of Gata4 intestinal-specific knockout mice, we selected age- and weight-uniform control mice (WT group, littermate negative control mice) and intestinal knockout Gata4 male mice (Gata4... flox / flox (Vil1-Cre). Normal control liquid feed and alcohol-containing Lieber-DeCarli liquid feed were prepared according to the feed instructions. After one week of acclimatization feeding with the normal control liquid feed, a paired-feeding method was used for seven weeks to establish an alcoholic liver injury model. After completion, tissue samples were dissected and relevant experimental indicators were measured.

[0039] The biochemical indicators of the two animal models of alcoholic liver injury were compared, and the results are shown in Table 1.

[0040] Table 1. Comparison of biochemical indicators between two animal models of alcoholic liver injury

[0041] Detailed scoring criteria for hepatic steatosis and inflammation (Final score = steatosis score + hepatocellular ballooning degeneration score + inflammation score): 1. Steatosis: Score 0-3, divided into no steatosis (0 points), mild (<33% hepatocytes, 1 point), moderate (33-66% hepatocytes, 2 points) and severe (>66% hepatocytes, 3 points).

[0042] 2. Ballooning degeneration of hepatocellular cells: The score ranges from 0 to 2 points, and is divided into no ballooning degeneration (0 points), mild (1 point), and significant (2 points).

[0043] 3. Inflammation: Scored from 0 to 3 points, divided into no inflammation (0 points), mild (inflammatory cell infiltration in a single lobule, 1 point), moderate (inflammation in the lobule and portal vein area, 2 points), and severe (extensive inflammation in the lobule and portal vein area, 3 points).

[0044] 4. Total score: 0-8 points. The activity and severity of alcoholic liver disease in mice are assessed by comprehensively evaluating steatosis, hepatocyte ballooning degeneration, and inflammation (the higher the final score, the more severe the steatosis and inflammation in the liver tissue).

[0045] As shown in Table 1, the animal model of alcoholic liver injury provided by this scheme has more severe liver damage phenotypes, such as transaminase levels, hepatic steatosis, and inflammation, compared with the traditional alcoholic liver injury model constructed by the Lieber-DeCarli liquid alcohol diet.

[0046] Example 2:

[0047] I. Experimental Animals: This invention used C57BL / 6 mice, all males aged 7-8 weeks. All experimental animals were housed at the Experimental Animal Center of Zhejiang University of Traditional Chinese Medicine, with room temperature maintained at 18-22℃ and humidity at 50-70%. Alternating light (12 hours light / 12 hours dark) was provided, along with free access to water and food. Animal husbandry, maintenance, and experimental procedures were all performed in accordance with the guidelines of the Ethics Committee of Zhejiang University of Traditional Chinese Medicine.

[0048] II. Intraperitoneal injection, as a technique for regulating gene expression at the animal level, has been widely used in liver research and other fields. To further explore the function of Gata4 in alcohol-induced liver injury, we used intraperitoneal injection of mouse OE-Gata4-AAV9 virus to achieve overexpression of Gata4 in the intestine.

[0049] III. Method for constructing the Gata4 gene into the GPAAV-CMV-MCS-WPRE vector: First, Gata4 primers were designed and synthesized to amplify the target fragment, which was then ligated into the enzyme-digested vector. The ligation product was transformed into prepared competent bacterial cells. The resulting single-clone colonies were sent to a sequencing company for sequencing. The correctly aligned clones were considered successfully constructed vectors. Next, a highly purified, endotoxin-free adeno-associated virus vector and its auxiliary packaging element vector plasmid were extracted. Using HG transgenereagent, the constructed viral vector and its auxiliary packaging element plasmid were co-transfected into AAV Pro-293T cells. After 6-8 hours of transfection, the medium was replaced with fresh medium and enhancing buffer. After culturing for another 72 hours, the cells detached, and the cells and supernatant rich in viral particles were collected. After concentration and purification, a high-titer viral concentrate was obtained. The AAV-Gata4 primer sequences constructed in this experiment are: 46671FW-60046: CGCGAATTCGAAGTATACCTCGAGGCCACCATGTACCAAAGCCTGGCCATGG; 46671RW-60047: GACTGTGTCTGACTGTGTCGGATCCTTACGCGGTGATTATGTCCCCA.

[0050] IV. Preparation of a mouse model of intestinal overexpression of Gata4 by intraperitoneal injection of OE-Gata4-AAV9: Age- and weight-uniform experimental mice (25-30g) were selected, and each mouse was injected with 2 x 10... 11 The viral load was diluted with 0.1 mL of physiological saline. The mouse was held upright with its abdomen exposed and its head tilted downwards. The injection needle was inserted subcutaneously 3-5 mm into the lower abdomen, approximately 5 mm from the midline, at a point about 1 / 3 to 1 / 4 of the way down. The needle was then inserted into the peritoneum at a 45° angle towards the head. Once inside the peritoneal cavity, if there was no resistance, the plunger was pulled back. If no blood, urine, or intestinal contents flowed in, the viral injection solution was injected. To prevent leakage, the needle was gently rotated before being slowly withdrawn. The injection site was disinfected with an alcohol swab.

[0051] V. The alcoholic liver injury model in Gata4-overexpressing mice was established as follows: C57BL / 6 mice were injected intraperitoneally with OE-Gata4-AAV9. Three weeks later, intestinal GATA4 protein expression was assessed; increased Gata4 expression indicated successful establishment of intestinal overexpression Gata4 mice. Intestinal overexpression Gata4 mice and age-matched WT mice were selected for subsequent alcoholic liver injury model establishment. Normal control liquid diet and alcohol-containing Lieber-DeCarli liquid diet were prepared according to the feed instructions. After one week of adaptation feeding with the normal control liquid diet, the Lieber-DeCarli alcohol liquid diet was introduced, and the alcoholic liver injury model was established after seven weeks of liquid diet feeding.

[0052] VI. Reagents: The alcoholic liquid feed used in this invention was purchased from Nantong Trofi Feed Technology Co., Ltd., the HE dye kit was purchased from Wuhan Saiweier Co., Ltd., the Filipin staining kit was purchased from Shanghai Beyotime Co., Ltd., and the CXCL5 and IL-33 ELISA detection kit was purchased from Hangzhou Lianke Biotechnology Co., Ltd. OE-Gata4-AAV9 adeno-associated virus was purchased from Shanghai Heyuan Biotechnology Co., Ltd. Gata4, ASBT, FGFR4, and CYP7A1 antibodies (rabbit) were purchased from ABCAM, AFFNINTY, and ABCLONE Ltd., and GAPDH antibody (rabbit) was purchased from Wuhan Sanying Biotechnology Co., Ltd.

[0053] Experimental methods: Gata4 intestinal-specific knockout mice obtained in Example 1 with uniform age and weight, intestinal overexpression Gata4 mice obtained by intraperitoneal injection of OE-Gata4-AAV9, and littermate negative control mice were selected. Normal control liquid diets and Lieber-DeCarli liquid diets containing alcohol were prepared according to the feed instructions. After one week of acclimatization, a paired-feeding method was used. The control group was given a non-alcoholic liquid diet with the same calories, while the alcohol group was fed a 5% Lieber-DeCarli alcohol liquid diet. After seven weeks of feeding, the mice were fasted for 12 hours after the last feeding, but water was allowed. After preparation, the mice were dissected, and various indicators were measured.

[0054] The detection methods for various indicators in mice are as follows: (1) Determination of biochemical indicators: The levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in the serum of the above-mentioned mice were detected using a biochemical analyzer. The results are as follows: Figure 1 As shown.

[0055] (2) HE staining analysis: (a) The mouse liver tissue obtained after dissection was fixed overnight by immersing it in 4% neutral formaldehyde solution. Then, the tissue was dehydrated using a fully automated tissue dehydrator. Paraffin was heated to embed the tissue. After complete embedding, the paraffin block was frozen at -20 °C and then serially sectioned using a paraffin microtome. (b) The slices obtained in step (a) were baked at 65 °C for 15 min, and then subjected to a routine dewaxing process; (c) The tissue sections that underwent routine dewaxing in step (b) were immersed in hematoxylin for 3 min and the nuclear staining was observed under a microscope. Then they were rinsed with tap water for 2 min. (d) Differentiate the tissue sections rinsed in step (c) with 1% hydrochloric acid alcohol for a few seconds, and rinse with tap water for 2 minutes after differentiation. (e) Stain the material rinsed in step (d) with eosin for 3 min, and rinse with tap water for 2 min after staining; (f) The rinsing and material in step (e) are subjected to gradient alcohol dehydration treatment, and then cleared with xylene for 3 minutes, and cleared 3 times in a row; (g) Seal the transparent material from step (f) with neutral resin and air dry the film in a fume hood; (h) Take a picture of the dried slide obtained in step (g) using a regular upright optical microscope.

[0056] (3) Filipin staining to observe cholesterol content in liver tissue: (a) Preparation of staining solution: Stock solution preparation: Add 1 mg of phenelzine powder to 1 mL of DMSO (dimethyl sulfoxide) and dissolve completely to prepare a stock solution of 1 mg / mL. Aliquot and freeze the stock solution, avoiding repeated freeze-thaw cycles. Store in the dark. Working solution preparation: Before use, take an appropriate amount of stock solution and add it to PBS (phosphate buffered saline) to dilute it to a certain concentration of working solution (e.g., 0.1 mg / mL) for later use. (b) Wash the fixed liver tissue with PBS buffer 2-3 times, 5 min each time, and then immerse the sample in the working solution of step (a) and incubate at room temperature in the dark for 30-60 min; (c) After staining, wash with PBS 2-3 times, each time for 5 minutes; (d) Observe the fluorescence signal of cholesterol stained with Filipin under a fluorescence microscope using 360 nm ultraviolet excitation light. Free cholesterol stained with Filipin usually shows blue fluorescence at 480 nm.

[0057] (4) QAH-TH-1 chip detection of inflammatory factors in liver tissue: (a) Tissue homogenization: Mouse liver tissue was weighed and transferred to a micro-volume manual glass homogenizer and homogenized in ice water for 5 min. 1×PBS buffer was added at a 1 / 8 body weight-to-volume ratio to wash the homogenized tissue and transfer it to a 1.5 ml EP tube. The homogenized tissue was diluted 1:1 and centrifuged at 1000×g for 10 min at 4 °C in a low-temperature high-speed centrifuge. After centrifugation, the supernatant was transferred to another 1.5 ml EP tube and centrifuged at 25000 r / min for 20 min at 4 °C. The supernatant was used to determine the concentrations of CXCL5 and IL-33. (b) Remove the glass slide chip from the box, allow it to equilibrate at room temperature for 20-30 minutes, open the packaging bag, remove the sealing strip, and then place the chip in a vacuum desiccator or dry at room temperature for 1 hour; (c) Preparation of BSA standard solutions: Prepare BSA protein standards with concentration gradients of 2000 μg / mL, 1500 μg / mL, 1000 μg / mL, 750 μg / mL, 500 μg / mL, 250 μg / mL, 125 μg / mL, 25 μg / mL and 0 μg / mL; (d) Chip operation: 1. Add 100µL of liver homogenate diluent to each well, incubate on a shaker at room temperature for 1 h, and then block the quantitative antibody chip.

[0058] 2. Remove the buffer solution from each well, add 100 µL of standard solution and sample to the well, and incubate overnight on a shaker at 4 °C.

[0059] 3. Cleaning: The slides were cleaned using a Thermo Scientific Wellwash Versa chip washer in two steps. First, the slides were cleaned with 1× Wash Solution I, 250 µL per well, for 10 washes, with agitation for 10 seconds each time. Then, the slides were cleaned with 1× Wash Solution II, 250 µL per well, for 6 washes, with agitation for 10 seconds each time.

[0060] 4. Incubation of the antibody mixture: Centrifuge the antibody mixture tube, then add 1.4 mL of sample diluent, mix thoroughly, and centrifuge again quickly. Add 80 µL of CXCL5 and IL-33 antibodies to each well and incubate on a shaker at room temperature for 2 h.

[0061] 5. Cleaning: The slides were cleaned using a Thermo Scientific Wellwash Versa chip washer in two steps. First, the slides were cleaned with 1× Wash Solution I, 250 µL per well, for 10 washes, with agitation for 10 seconds each time. Then, the slides were cleaned with 1× Wash Solution II, 250 µL per well, for 6 washes, with agitation for 10 seconds each time.

[0062] 6. Incubation of Cy3-Streptavidin: Centrifuge the Cy3-Streptavidin tubes, then add 1.4 mL of sample diluent, mix well, and centrifuge again quickly. Add 80 µl of Cy3-Streptavidin to each well, cover the slide with aluminum foil to protect from light, and incubate on a shaker at room temperature for 1 h.

[0063] 7. Cleaning: The slides were cleaned using a Thermo Scientific Wellwash Versa chip washer in two steps. First, the slides were cleaned with 1× Wash Solution I, 250 µL per well, for 10 washes, with agitation for 10 seconds each time. Then, the slides were cleaned with 1× Wash Solution II, 250 µL per well, for 6 washes, with agitation for 10 seconds each time.

[0064] 8. Fluorescence detection: Remove the slide frame, being careful not to touch the antibody-printed side of the slide with your hands. Use a laser scanner such as the InnoScan 300 to scan the signal, employing the Cy3 or green channel (excitation frequency = 532 nm).

[0065] 9. Use QAH-TH-1 data analysis software for data analysis.

[0066] (5) RNA-seq of intestinal tissue RNA-Seq is the science that studies the overall expression of all transcripts (mainly mRNA) within cells or tissues at specific times or under specific conditions. The main goal of RNA-Seq is to reveal gene expression patterns and regulatory mechanisms under different conditions, thereby helping us understand gene function in different physiological and pathological states. To further explore the role of gut-specific Gata4 knockout in alcohol-induced liver injury, we performed RNA-Seq analysis on the ileum of mice from each group. The specific analysis steps are as follows: (a) Preparation of tissue samples: Take out the ileum stored at -80 °C, remove the intestinal contents, and wash the intestinal tissue sample with pre-cooled HBSS (Hanks balanced salt solution); (b) Total RNA extraction: Intestinal tissue samples were homogenized in an appropriate amount of TRIzol lysis buffer. The homogenate was treated with chloroform to separate RNA from proteins and DNA. Isopropanol was added to precipitate RNA, which was then collected by centrifugation. The RNA precipitate was washed with 75% ethanol and then dried. The dried RNA was dissolved in RNase-free water. RNA purity and quantification were determined using a NanoDrop 2000 spectrophotometer (ThermoScientific, USA). (c) RNA quality control and library construction: RNA integrity was assessed using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). Transcriptome libraries were constructed using the VAHTS Universal V5 RNA-seq Library Prep kit according to the manufacturer's instructions. (d) Library quality control and sequencing: The quality and concentration of the library were checked using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA) to ensure uniform fragment distribution. Sequencing was performed using the Llumina Novaseq 6000 sequencing platform to generate 150 bp paired-end reads. The FASTQ format raw reads were processed using FASTP software to remove low-quality reads and obtain clean reads for subsequent data analysis. (e) Data Analysis: Reference genome alignment was performed using HISAT2 software, and gene expression levels were calculated. Gene read counts were obtained using HTSeq-count. Differentially expressed genes were analyzed using DESeq2 software; genes meeting the thresholds of p < 0.05 and |Log2(fold change) > 1| were defined as differentially expressed genes (DEGs). Transcriptome sequencing and analysis were performed by Shanghai Ouyi Biotechnology Co., Ltd.

[0067] (6) Western Blot method to detect the expression of FGFR4 and CYP7A1 in liver tissue (a) Preparation of 10% PAGE gel: Prepare the gel according to the operating steps of the Yaxin PAGE Gel Rapid Preparation Kit. Taking 4 gels as an example, after the kit has warmed to room temperature, take 16 mL of the lower gel solution and lower gel buffer from each gel, and add 320 μL of coagulant. After thorough mixing, quickly add the mixture to the fixed gel plate, and gently add anhydrous ethanol to seal the gel. Let it stand for 15-20 min, and after the lower separating gel has fully solidified, thoroughly remove the anhydrous ethanol. Prepare the lower gel again, taking 6 mL of the lower gel solution and lower gel buffer from each gel. Add 120 μL of coagulant to the lower gel solution and lower gel buffer, mix thoroughly, and immediately add the mixture to the gel plate. Quickly and slowly insert the corresponding comb, and let it stand at room temperature for 20-30 min. (b) Electrophoresis: Add 1000 mL of prepared electrophoresis buffer to the fixed gel plate after step (a) has been stationary. Then remove the comb, add an equal mass of protein sample, add the protein marker and set the electrophoresis conditions: upper layer compression gel (constant voltage 70 V), lower layer separating gel (constant current 320 mA). Stop electrophoresis when the bands reach the appropriate position. (c) Transfer: Carefully remove the gel and immerse it in the transfer solution. Then immerse it in methanol and activate the PVDF membrane. Perform the transfer using a wet transfer apparatus: Place the filter paper, gel and PVDF membrane in the order of black gel and white membrane. Remove air bubbles from the filter paper. Transfer the membrane under constant current at 320mA for 60 min. (d) Sealing: Place the PVDF membrane obtained in step (c) in the sealing solution and seal at room temperature for 60 min; (e) Incubate with primary and secondary antibodies separately: After blocking, add primary antibody to the blocking buffer and incubate overnight at 4 °C. On the second day, wash three times with 1 x TBST buffer, 5 min each time. Add secondary antibody, incubate at room temperature for 60 min, and wash four times with 1 x TBST buffer, 5 min each time. (f) Protein development: Prepare chemiluminescent solution and use the Bio-Rad protein gel imaging system to develop the PVDF membrane.

[0068] (7) Immunofluorescence method for detecting GATA4 and ASBT expression in intestinal tissue (a) Tissue fixation: Mouse intestinal tissue was fixed at room temperature for 24 h using 4% paraformaldehyde (PFA) solution to maintain the stability of tissue structure and antigens. After fixation, the tissue was thoroughly washed with PBS buffer (pH 7.4) to remove residual fixative.

[0069] (b) Dehydration and embedding: The fixed tissue was dehydrated with sucrose solutions of varying concentrations for 1-2 hours per stage until the tissue settled. After dehydration, the tissue was embedded in an OCT (Optimal Cutting Temperature) compound, rapidly frozen in liquid nitrogen or dry ice, and cryopreserved.

[0070] (c) Sectioning: Using a cryostat, the frozen tissue from step (b) was sectioned into 5-10 μm thick sections and placed on glass slides. The sections were then frozen and stored at -80 °C.

[0071] (d) Drying and fixing of sections: Dry the sections at room temperature for 10-15 min. Fix with cold methanol at -20 ℃ for 10 min to maintain cell morphology; then wash with PBS 3 times, 5 min each time.

[0072] (e) Blocking: Add an appropriate amount of 10% normal goat serum to the slices obtained in step (d) for blocking, and incubate at room temperature for 30 min to block nonspecific binding. Wash three times with PBS, 5 min each time.

[0073] (f) Primary antibody incubation: Add an appropriately diluted primary antibody solution to the tissue sections obtained in step (e) and incubate overnight at 4 °C. After incubation, wash three times with PBS for 5 min each time.

[0074] (g) Secondary antibody incubation: Add the diluted fluorescently labeled secondary antibody to the slide obtained in step (f) and incubate at room temperature in the dark for 1 h. After the secondary antibody incubation is complete, rinse three times with PBS for 5 min each time to prevent nonspecific fluorescence background.

[0075] (h) DAPI staining of nuclei: Incubate the cell nuclei with diluted DAPI solution (1 μg / mL) for 5 min in the dark. Rinse the sections with PBS 2-3 times, 5 min each time.

[0076] (i) Mounting and observation: Add anti-fluorescence quenching mounting solution to the slide. Gently cover with a coverslip, avoiding air bubbles, and fix the coverslip in place with light pressure. After mounting, store at 4 °C in the dark and observe under a fluorescence microscope.

[0077] Test results as follows Figure 1 As shown, Figure 1In the diagrams, A and C represent the changes in serum ALT and AST levels in Gata4 intestinal-specific knockout mice and littermate negative control mice (WT) after normal diet and after administration of alcoholic liquid diet, respectively; B and D represent the changes in serum ALT and AST levels in intestinal-overexpressing Gata4 mice (AAV-Gata4) injected intraperitoneally with OE-Gata4-AAV9 and littermate negative control mice (WT) after normal diet and after administration of alcoholic liquid diet, respectively; E represents the liver HE pathological changes in littermate negative control mice, Gata4 intestinal-specific knockout mice, and intestinal-overexpressing Gata4 mice under normal diet or alcoholic diet, respectively.

[0078] We found that Gata4 gut-specific knockout mice (not given an alcoholic liquid diet) showed significantly elevated levels of ALT and AST in their blood. Figure 1 (A, C), liver HE staining showed some liver tissue damage ( Figure 1 E). Alcoholic liquid diet treatment exacerbated hepatic steatosis and inflammation in Gata4 gut-specific knockout mice, manifested as a significant increase in ALT and AST levels. Figure 1 In Gata4 gut-specific knockout mice, the lipid droplet vacuolar region was significantly increased in liver tissue, and neutrophil infiltration was significantly increased. Figure 1 The above results confirm that gut-specific knockout of Gata4 significantly aggravates alcohol-induced liver injury. Furthermore, gut-overexpressing Gata4 mice significantly reversed alcohol-induced liver dysfunction in mice. Figure 1 In B and D), pathological results showed that intestinal overexpression of Gata4 significantly alleviated alcohol-induced hepatic steatosis and inflammation. Figure 1 (E).

[0079] Figure 2 The image shows the results of QAH-TH-1 chip-based detection of the expression levels of inflammatory cytokines CXCL5 and IL-33 in liver tissue (Normal represents control mice fed a normal liquid diet, EtOH represents control mice fed an alcoholic diet, Gata4-CKO represents Gata4 intestinal-specific knockout mice fed a normal liquid diet, Gata4-CKO+EtOH represents Gata4 intestinal-specific knockout mice fed an alcoholic diet, and OE Gata4+EtOH represents mice fed an alcoholic diet with intestinal overexpression of Gata4). Figure 2 It is known that chronic alcohol intake leads to a significant increase in the levels of inflammatory factors CXCL5 and IL-33 in mice. After intestinal-specific knockout of Gata4, the levels of inflammatory factors CXCL5 and IL-33 in mice will further increase, while intestinal overexpression of Gata4 can significantly reduce the levels of inflammatory factors CXCL5 and IL-33.

[0080] Depend on Figure 3 As shown in the volcano plot, differentially expressed genes were obtained between the EtOH and WT groups under the condition p < 0.05 & |LogFoldChange > 0.58|. Figure 3 Differential genes were obtained in the Gata4-CKO+EtOH group and the Gata4-CKO group (A). Figure 3 (B) From Figure 3 As shown in A and B, chronic alcohol stimulation can induce abnormal changes in the Gata4 / ASBT / FGF15 signaling pathway in the intestine of WT mice.

[0081] In Gata4 gut-specific knockout mice, the Gata4 / ASBT / FGF15 signaling pathway in the ileum showed abnormalities, and chronic alcohol stimulation further exacerbated the disruption of this signaling axis. Figure 3 (C). Immunofluorescence staining results were consistent with RNA-Seq data, indicating that chronic alcohol stimulation leads to abnormalities in the intestinal Gata4 / ASBT signaling pathway in WT mice, and in Gata4 gut-specific knockout mice, the abnormalities in the ileum Gata4 / ASBT signaling pathway were further exacerbated by chronic alcohol stimulation. Figure 3 (D). Figure 3 In the table, WT represents control mice fed a normal liquid diet, EtOH represents control mice fed an alcoholic diet, Gata4CKO represents Gata4 intestinal-specific knockout mice fed a normal liquid diet, and Gata4 CKO+EtOH represents Gata4 intestinal-specific knockout mice fed an alcoholic diet.

[0082] Therefore, the above results indicate that intestinal-specific knockout of Gata4 significantly aggravates alcohol-induced disorder of bile acid metabolism gene expression in the intestine.

[0083] To further explore its molecular mechanism, we used Western blot to detect the expression levels of FGFR4 and CYP7A1, key proteins closely related to bile acid and cholesterol metabolism in the liver. Figure 4 The results of Filipin staining of cholesterol in mouse liver tissue showed that long-term alcohol intake can induce elevated cholesterol levels in the mouse liver. In Gata4 intestinal-specific knockout mice, this cholesterol accumulation in the liver caused by chronic alcohol stimulation was even more severe. Figure 4(A). The results showed that long-term alcohol exposure significantly reduced the expression of FGFR4 and CYP7A1 in the liver of mice. This decline was even more pronounced in Gata4 intestinal-specific knockout mice. This may be related to Gata4 inhibiting ASBT, leading to increased ASBT expression after knockout, increased intestinal bile acid reabsorption, negative feedback inhibition of CYP7A1, and thus obstruction of the cholesterol-to-bile-acid metabolism pathway, resulting in cholesterol accumulation and increased inflammation in hepatocytes. Figure 4 (Chinese BC).

[0084] In summary, we first achieved specific knockout of the Gata4 gene in the mouse intestine using the Cre-LoxP system, and obtained a sufficient number of Gata4 intestinal-specific knockout mice through identification. Subsequently, we obtained intestinal-overexpressing Gata4 mice by intraperitoneal injection (injection of AAV adeno-associated virus packaged with a murine GATA4 overexpression plasmid) and by detecting intestinal GATA4 protein expression. Following the Liber-Decarli alcoholic liver injury model, after one week of adaptive feeding, control mice were given a non-alcoholic liquid diet with the same calories, while Gata4 intestinal-specific knockout mice, intestinal-overexpressing Gata4 mice, and littermate negative control mice were all given a liquid diet containing 5% alcohol. After 7 weeks of feeding, samples were collected for analysis after a 12-hour fast following the last feeding. The results show that chronic alcohol intake can lead to abnormal liver function, hepatic steatosis and cholesterol deposition, and exacerbated inflammatory responses in mice, while also causing disordered expression of bile acid metabolism genes in the liver and intestine. It is noteworthy that the damage trend in Gata4 gut-specific knockout mice significantly exacerbates the aforementioned alcoholic liver injury, while Gata4 gut overexpression mice show significantly improved liver function abnormalities and liver pathological damage. On one hand, this study provides an ALD animal model with more severe liver damage phenotypes, including transaminase levels, hepatic steatosis, and inflammation, compared to the traditional Liber-Decarli alcoholic liver injury model. On the other hand, this study fully demonstrates that Gata4 can serve as an effective target for the prevention or treatment of ALD and has important guiding significance in the development of drugs for the prevention and treatment of this disease.

Claims

1. A method for constructing an animal model of alcoholic liver disease with intestinal-specific knockout of the Gata4 gene, characterized in that, The construction method is as follows: Use Gata4 flox Transgenic heterozygous mice and Vil1-Cre transgenic mice were crossed to obtain the F1 generation. The F1 generation was then screened, and the genotype of the mice was determined to be Gata4. flox / + Vil1-Cre transgenic mice were self-crossed to obtain F2 generation mice. A 1mm tail was removed from each mouse, and the mice were digested with 250 μL of lysis buffer. Genomic DNA was extracted, primers were designed, and polymerase chain reaction (PCR) amplification was used to identify the mouse genotype. After screening, the genotype obtained was Gata4. flox / flox Vil1-Cre Gata4 gut-specific knockout mice; then Gata4 gut-specific knockout mice were fed Lieber-DeCarli liquid alcohol diet, and after 7 weeks, a Gata4 gut-specific knockout alcoholic liver injury mouse model was obtained. The PCR amplification reaction system consisted of 25 μL of ddH2O, 12.5 μL of Premix Taq Polymerase, 1.5 μL of DNA template, and 1 μL of each primer. The reaction conditions were as follows: pre-denaturation at 94 °C for 3 min, denaturation at 94 °C for 30 s, annealing at 62 °C for 35 s, and extension at 72 °C for 35 s. This process was repeated for 35 cycles, with a final DNA extension at 72 °C for 5 min. After extension, the cells were held at 12 °C. The PCR products were detected by 1% agarose gel electrophoresis to analyze the mouse genotype and screen for Gata4 intestinal-specific knockout mice.

Images