A novel library of adeno-associated virus variants for gene and cell therapy and construction and use thereof

Abstract

The application discloses a novel adeno-associated virus variant library for gene and cell therapy and construction and application thereof, and belongs to the field of biological medicine. Through high-throughput sequencing and gene editing, an AAV variant library containing a large number of mutants is constructed, the construction efficiency is improved, and the diversity of the mutants is ensured. The variant library is reformed on the cap gene of AAV through site-directed mutagenesis technology, the transduction efficiency on human immune cells is improved, the limitation of existing AAV reforming methods is overcome, the novel AAV variant library has higher packaging efficiency, lower cytotoxicity and better adaptability, and more choices are provided for the development of gene therapy drugs. The screened novel AAV6 variant P482L has significant advantages in transduction efficiency, safety and the like, and becomes a potential candidate vector in the field of gene therapy. The application not only accelerates the development process of new drugs, but also provides new tools and methods for treating genetic diseases, tumors and the like, and promotes the development of the field of gene therapy.

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, specifically relating to a novel adeno-associated virus variant library for gene and cell therapy, its construction, and its application. Background Technology

[0002] Adeno-associated virus (AAV) is a small, non-enveloped virus with a diameter of approximately 26 nanometers. Its viral particles consist of an icosahedral capsid protein and a single-stranded DNA genome of approximately 4.7 kb. As a key viral vector in gene therapy, AAV has achieved significant success in this field due to its high safety and low immunogenicity. Seven AAV gene therapies have been approved for marketing. Furthermore, research has reported the use of artificial intelligence to guide the design of novel AAV capsids, finding that the resulting usable mutants are significantly superior to random mutagenesis, providing a powerful design method for the engineering of AAV capsid proteins. Among the currently discovered serotypes, including 13 naturally occurring types and several variants, AAV6 has demonstrated outstanding advantages in the in vitro transduction of human immune cells, especially when combined with gene editing technologies (such as CRISPR). This provides new possibilities for the genetic engineering of difficult-to-target cell types (such as primary T cells), for example, producing chimeric antigen receptor T cells (CAR-T cells) with immunotherapeutic effects from primary T cells. Although AAV6 has advantages in transducing human immune cells, its transduction efficiency still cannot meet the needs of practical applications, limiting its widespread use in gene therapy. Due to the limitation of transduction efficiency, current methods still rely on high multiples of infection (MOI, 1×10⁻⁶). 6 Gene delivery not only increases production costs but may also lead to potential toxic side effects; existing AAV6-based mutant libraries have limited diversity and lack a large-scale viral mutant library targeting human immune cells, which limits the full exploitation of the AAV6 capsid protein modification potential.

[0003] To address these challenges, researchers have begun exploring methods to engineer AAV capsid proteins to improve transduction efficiency and expand applications. Current research on engineered AAVs focuses on enhancing the targeting of vectors to different cells and tissues, and reducing the potential for vector inactivation caused by neutralizing antibodies. For example, novel AAV variants obtained through fragment recombination and single-point mutation, such as the AAV12 / 6 chimera and the AAV6-S663V / T492V variant, have improved transduction efficiency to some extent. However, these modification methods have not yet significantly improved the transduction efficiency of AAV6 on human immune cells. Therefore, further research and exploration are needed. While some studies have reported large-scale screening of AAV6, these studies targeted mouse T cells, resulting in limited variant diversity and a lack of a large-scale viral mutant library based on AAV6 for human immune cells. The application potential of AAV6 remains to be further explored.

[0004] Although there are existing methods for modifying AAV6, such as single-point mutations and fragment recombination of the Cap protein, these modifications have not significantly improved its transduction efficiency to human immune cells and still cannot meet the needs of practical applications. Secondly, due to the limitation of transduction efficiency, current gene delivery still relies on the use of high MOI (multiple of infection), which not only increases production costs but also increases the risk of potential toxic side effects. In addition, the diversity of existing mutant libraries is relatively limited, and there is a lack of large-scale viral mutant libraries based on AAV for human immune cells, which fails to fully explore the modification potential of the AAV capsid protein. Summary of the Invention

[0005] Given that existing AAV modification methods cannot significantly improve transduction efficiency to human immune cells, require high viral infection multiples for gene delivery, and increase the risk of toxic side effects, and considering the current lack of diversity in existing AAV mutant libraries and the absence of a large-scale viral mutant library specifically designed for human immune cells based on AAV, this invention aims to provide a method for constructing a novel adeno-associated virus variant library for gene and cell therapy.

[0006] To achieve the above objectives, the present invention employs the following technical solution: This invention provides a method for constructing a novel adeno-associated virus variant library for gene and cell therapy, comprising: S1, based on the amino acid sequence of the cap gene of natural serotype adeno-associated virus, identifies non-conserved regions of adeno-associated virus, performs single-point saturation mutations on the non-conserved regions of adeno-associated virus, and generates a library of single-point saturation mutants of adeno-associated virus. S2, based on the adeno-associated virus single-point saturated mutant virus library, single-point mutations were introduced by high-throughput oligonucleotide DNA sequence synthesis to construct an adeno-associated virus mutant plasmid library; S3, Based on the adeno-associated virus mutant plasmid library, construct an adeno-associated virus mutant virus library; S4, based on an adeno-associated virus mutant virus library, screens, extracts genomes, and sequences and identifies them to obtain a novel adeno-associated virus variant library for gene and cell therapy.

[0007] The naturally occurring serotype of adeno-associated virus is any one of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, and AAV13.

[0008] Furthermore, the naturally occurring serotype of adeno-associated virus is AAV6.

[0009] In S1, the amino acid sequence of the cap gene was compared using the Clustal Omega tool.

[0010] S2 specifically includes: S21, based on the cap gene sequence of adeno-associated virus, an oligonucleotide DNA sequence containing a single-point mutation was synthesized using high-throughput oligonucleotide DNA sequencing. S22, design an 8bp barcode sequence, add an 8bp barcode to each oligonucleotide DNA sequence containing a single point mutation; S23 employs a two-round GoldenGate Assembly strategy, inserting oligonucleotides with single-point mutations and barcodes into the corresponding positions in the cap6 gene; S24, through electroconversion, coating and counting, and shaking, plasmids were extracted to construct an adeno-associated virus mutant plasmid library.

[0011] Furthermore, the 8bp Barcode sequence is designed using Python or MATLAB software.

[0012] S3 specifically includes: obtaining helper plasmids, packaging plasmids, and target plasmids; transfecting the plasmids into 293LX cells using calcium phosphate transfection; virus packaging; collecting and purifying the virus; and obtaining a mutant virus library by titer detection.

[0013] S4 includes: inoculating immune cells with adeno-associated virus mutant virus library, screening cells that have successfully transduced the virus using drugs; extracting and sequencing the genome after culture, identifying and obtaining a novel adeno-associated virus variant library for gene and cell therapy.

[0014] Cells that successfully transduced the virus using the drug were then screened using puromycin.

[0015] The above-described construction method yields a novel adeno-associated virus variant library for gene and cell therapy.

[0016] The application of the aforementioned novel adeno-associated virus variant library in the preparation of gene and cell therapy drugs.

[0017] The above-mentioned novel adeno-associated virus variant library is used in screening for novel adeno-associated virus capsid protein variants with high transduction efficiency and safety.

[0018] A novel adeno-associated virus (AAV) capsid protein variant, obtained by screening the aforementioned library of novel AAV variants for gene and cell therapy.

[0019] Furthermore, the screening includes the steps of constructing novel viral vectors in vitro and testing them in human primary T cells.

[0020] Furthermore, the novel adeno-associated virus capsid protein variant is a novel AAV6 variant P482L.

[0021] Compared with the prior art, the present invention has the following beneficial effects: This invention provides a method for constructing a novel adeno-associated virus (AAV) variant library for gene and cell therapy. Utilizing high-throughput sequencing and gene editing technologies, this invention constructs a novel AAV variant library containing a large number of mutants. This method not only improves construction efficiency but also ensures the diversity and randomness of mutants, providing abundant resources for subsequent screening and application. The method employs site-directed mutagenesis to modify the cap gene of AAV6 to obtain a novel AAV variant library with specific biological characteristics. By identifying non-conserved regions and performing single-point saturation mutations, the diversity of AAV mutants can be significantly increased, potentially allowing the screening of AAV variants with higher transduction efficiency to human immune cells. This solves the problem that existing AAV modification methods cannot significantly improve transduction efficiency to human immune cells. Therefore, it meets the targeting needs of different tissues and cells in gene and cell therapy, overcoming the tissue tropism limitations of natural serotype AAV. This approach enhances the infection efficiency and gene transduction capacity of viral vectors in specific tissues. Modifying the cap gene reduces the risk of viral vectors being recognized and cleared by the human immune system, thereby improving the safety and stability of adeno-associated virus (AAV) variants, which is crucial for the long-term efficacy and safety of gene and cell therapies. The construction methods for novel AAV variant libraries provide more options for gene and cell therapy, applicable to the treatment of various genetic diseases and tumors. Furthermore, it can be combined with other gene editing technologies (such as the CRISPR-Cas system) to further improve the precision and effectiveness of gene therapy. It shortens the development cycle of novel AAV vectors, reduces R&D costs, and helps advance the development of gene therapy drugs. High-throughput screening and sequencing identification technologies can rapidly obtain a large number of novel viral vectors with potential clinical applications, providing strong support for the development of gene therapy drugs.

[0022] The novel adeno-associated virus (AAV) variant library obtained by this invention can effectively maintain mutant diversity. The variant library mutants exhibit higher packaging efficiency, lower cytotoxicity, and better adaptability, making them a key focus for further research and optimization. In-depth analysis of the characteristics and mechanisms of these advantageous mutants can further optimize AAV vector design, improving the efficiency and safety of gene therapy. This invention demonstrates significant technical effects in addressing transduction efficiency issues, increasing mutant library diversity, constructing targeting human immune cells, and promoting the development of gene therapy. It not only improves the tissue tropism and safety of viral vectors, broadening their clinical applications, but also accelerates the research and development of gene therapy drugs. With the continuous development of genetic engineering technology, by continuously screening and optimizing advantageous mutants, more efficient, safe, and specific gene therapy vectors can be developed, driving the development of the gene therapy field.

[0023] The applications provided by this invention include AAV variant libraries that can be used in the research and development of gene and cell therapy drugs, accelerating the process of new drug development and providing new tools for treating hereditary diseases and tumors. By screening mutants with specific properties, more efficient and safer gene therapy vectors can be developed, which is of great significance for treating diseases requiring high-efficiency gene expression. By screening mutants with low immunogenicity and low cytotoxicity, safer gene therapy vectors can be developed, reducing adverse reactions and complications during treatment. The application of novel AAV variant libraries is not limited to the traditional field of gene therapy, but can also be extended to cell therapy, gene editing, and other fields, providing new ideas and methods for the treatment of more diseases.

[0024] This invention utilizes a novel adeno-associated virus capsid protein variant, the novel AAV6 variant P482L, screened from an AAV variant library. This variant has shown significant technical effects in terms of transduction efficiency, safety, gene expression, and clinical application, making it a promising candidate vector for gene therapy and providing new options for the treatment of more diseases. Attached Figure Description

[0025] Figure 1 This invention provides an amino acid sequence alignment analysis of the VP protein of 13 natural serotypes of AAV. Figure 2 Design of a single-point saturation mutant library for AAV6 in this invention; Figure 3 This is the molecular cloning construction scheme for the AAV6 mutant plasmid library of the present invention; Figure 4 This invention involves high-throughput deep sequencing analysis of barcode sequences extracted from genomic DNA of AAV6 mutant plasmid libraries, viral libraries, and transduced target cells after screening. Figure 5 This invention provides a comparative analysis of high-throughput deep sequencing detection results for AAV6 mutant plasmid libraries and viral libraries. Figure 6 This invention provides a comparative analysis of high-throughput deep sequencing results of AAV6 mutant virus library and Jurkat cell genomic DNA samples. In this paper, A represents the analysis of Jurkat cell results transduced with high MOI from the virus library, and B represents the analysis of Jurkat cell results transduced with low MOI from the virus library. Figure 7 The efficiency of the mutants was evaluated by using the enrichment index ES and the proportion order fcellrank of each mutant in Jurkat cell samples. Here, A represents the results analysis of Jurkat cells transduced with high MOI from the viral library, and B represents the results analysis of Jurkat cells transduced with low MOI from the viral library. Figure 8To screen for mutant AAV6-P482L, wild-type AAV6 WT, and AAV6.2FF, flow cytometry was used to count GFP-positive cell data 48 h after transduction into Jurkat cells. In the figure, A is the flow cytometry result of Jurkat cells transduced at MOI 10000, B is the flow cytometry result of Jurkat cells transduced at MOI 25000, and C is the statistical results of the proportion of GFP-positive cells and the average fluorescence intensity under the two conditions. Figure 9 To detect the proportion of GFP-positive cells in human primary T cells transduced with the virus of this invention, cells were collected by flow cytometry after 48 hours. Among them, A is the negative control group, B is AAV6-WT, C is AAV6.2FF, and D is AAV6-P482L. Detailed Implementation

[0026] To enable those skilled in the art to better understand the present invention, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings of the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of the present invention.

[0027] The present invention will now be described in further detail with reference to the accompanying drawings: Example 1 The examples provide methods for designing and constructing novel adeno-associated virus variant libraries for gene and cell therapy.

[0028] 1. Design of a large-scale AAV6 mutant virus library The amino acid sequence alignment analysis of the VP protein of 13 natural serotypes of AAV and the design of the single-point saturation mutant library of AAV6 are shown in Table 1.

[0029]

[0030] (1) Multiple sequence alignment analysis See appendix Figure 1 The amino acid sequences of the cap gene of 13 natural serotypes were compared using the multiple sequence alignment tool Clustal Omega. The amino acid sequences of the cap gene of the 13 serotypes are shown in SEQ ID NO.1~SEQ ID NO.13. The sequence of cap6 was analyzed to identify conserved and non-conserved regions in the AAV6 (cap6) sequence.

[0031] (2) Design of AAV6 single-point saturation mutant library See appendix Figure 2 In the cap gene of AAV6, a non-conserved region was selected as the target region for mutation. Single-point saturation mutations were performed on the selected non-conserved region, that is, all possible amino acid substitutions were introduced at each amino acid position in the region to generate an AAV6 mutant library containing a large number of different single-point mutations, with a library capacity of 5,000 to 6,000 mutants.

[0032] 2. Construction of AAV6 mutant plasmid library See appendix Figure 3 Combining high-throughput oligonucleotide DNA sequence synthesis and GoldenGate Assembly molecular cloning design strategies: (1) High-throughput oligonucleotide DNA sequence synthesis Based on the cap6 gene sequence of AAV6, oligonucleotide DNA sequences with single-point mutations were designed. An 8bp barcode was added to each synthesized oligonucleotide DNA sequence for subsequent deep sequencing to identify mutants. The synthesis of high-throughput oligonucleotide DNA sequences was commissioned to Twist Bioscience.

[0033] Oligonucleotide DNA fragments were amplified by PCR and recovered using the QIAquick PCR Purification Kit (QIAGEN, 28104). The recovered products were then subjected to high-throughput deep sequencing to ensure that the sequences were correct.

[0034] (2) GoldenGate Assembly molecular cloning design strategy Round 1 GoldenGate Assembly The empty vector and the synthesized oligonucleotide DNA sequence were digested with PaqCI restriction endonuclease. The digested oligonucleotide DNA sequence was ligated with the empty vector using T4 DNA ligase to obtain an intermediate vector with a single-point mutation and corresponding barcode. The ligation product was transformed into E. coli, and the transformed E. coli were screened. Positive clones were selected for sequencing verification.

[0035] Second round GoldenGate Assembly The intermediate vector and downstream fragment lacking the cap6 gene obtained in the first round were digested with SapI restriction endonuclease. The digested downstream fragment was ligated back into the intermediate vector using T4 DNA ligase to form the complete cap6 gene. The first-round ligation product that did not contain the fragments from the second round was digested with HapI restriction endonuclease. The second-round ligation product was recovered by column recovery using the QIAquick PCR Purification Kit (QIAGEN, 28104) to obtain the designed plasmid library.

[0036] (3) Import and amplification of plasmid libraries The recovered plasmid library was introduced into electroporated competent E. coli using electroporation. The transformed E. coli were placed in a shaker at 37°C for 1 hour to recover. After serial dilution, the plasmids were plated on agar plates containing appropriate selectable markers. The colonies on the plates were counted to estimate the coverage of the plasmid library. The remaining portion was expanded and cultured. Plasmid DNA was extracted from the bacteria using the QIAGEN Plasmid Maxi Kit (QIAGEN, 12163) to obtain an AAV6 mutant plasmid library that can be used for viral packaging.

[0037] (4) Identification of plasmid libraries The constructed mutant plasmid library was amplified by PCR, and the recovered products were extracted using the QIAquick PCRPurification Kit (QIAGEN, 28104). High-throughput deep sequencing was performed on the recovered products, and the percentage (fp) of each mutant sequence in the plasmid library was calculated to analyze the coverage and uniformity of the mutant sequences. Primers were designed upstream and downstream of the barcode fragment: PCR-Barcode-F: CAGCAAACGCTGGAATCC (as shown in SEQ ID NO. 14); PCR-Barcode-R: GGCATTAAAGCAGCGTATCC (as shown in SEQ ID NO. 15).

[0038] 3. Construct an AAV6 mutant virus library (1) Plasmid preparation Three types of plasmids were obtained using the QIAprep Spin Miniprep Kit (QIAGEN, 27104), a high-purity endotoxin-free extraction kit: helper plasmid, modified packaging plasmid, and target plasmid. The helper plasmid provides the enzymes and factors required for viral replication, the modified packaging plasmid carries the rep gene required for viral packaging and removes the cap gene, and the target plasmid contains the target gene for introduction into the host cell and the cap gene required for viral packaging, which constitutes the AAV6 mutant plasmid library constructed above.

[0039] (2) Cell preparation 293LX cells were selected as adherent cells; Culture medium used: DMEM medium containing 10% fetal bovine serum and 1% Penicillin-Streptomycin antibiotic; Culture conditions: Cells were cultured at 37°C in a 5% carbon dioxide incubator to ensure normal cell growth and division.

[0040] Cell seeding: One day in advance, seed 5 × 10⁶ cells in a 10 cm cell culture dish. 6 Two 293LX cells were used to achieve a cell confluence of 70%–80% by the second day, providing optimal cell condition for subsequent virus packaging.

[0041] (3) Virus packaging 10 μg each of helper plasmid, packaging plasmid, and target plasmid were transfected into 293LX cells using the calcium phosphate transfection method. After 6–8 hours, the medium was replaced with fresh medium to remove residual transfection reagents and cell debris, providing a better growth environment for the cells. The cells were then cultured in a 37°C incubator until virus particles were formed.

[0042] (4) Virus collection The virus was collected 72 hours after transfection, at which time the yield of virus particles was relatively high. Since AAV virus particles were present in both packaging cells and culture supernatant, both cells and culture supernatant could be collected and processed separately to obtain a higher yield.

[0043] (5) Virus treatment Treatment of the supernatant: Add 40% (w / v) PEG8000 and 3M NaCl to the supernatant to a final concentration of 8% and 0.5M, respectively, and concentrate overnight at 4°C. Centrifuge at 12000 g for 30 min at 4°C; discard the supernatant, resuspend the precipitate in PBS, and obtain concentrated virus particles.

[0044] Cell treatment: Cells were lysed using a repeated freeze-thaw method. After resuspending the cells in cell lysis buffer, they were repeatedly transferred in liquid nitrogen and a 37°C water bath. The freeze-thaw cycle was repeated four times, with each freezing and thawing lasting 10 minutes. After each thawing, the cells were gently shaken. Cell debris was removed by centrifugation at 12000 g for 30 minutes at 4°C to obtain cell lysis buffer containing virus particles.

[0045] (6) Virus purification Combine the supernatant and cell lysis buffer, then add an equal volume of chloroform to remove protein impurities. After centrifugation, aspirate the supernatant, which can be concentrated again using PEG8000 and NaCl. Then, add Benzonase tomolyze the supernatant to remove residual nucleic acids and incubate at 37°C for 30 min. Add an equal volume of chloroform again, centrifuge, and carefully aspirate the supernatant to obtain the preliminarily purified AAV virus.

[0046] (7) Virus titer detection The obtained virus was treated with DNase and proteinase K, and the viral titer was determined by quantitative PCR. Primers were designed in the SFFV promoter region. qPCR-SFFV-F: atcagatgtttccaggctcccc (as shown in SEQ ID NO. 16); qPCR-SFFV-R: actcagtctgtcggaggact (as shown in SEQ ID NO. 17).

[0047] (8) Identification of the virus database See appendix Figure 4 The obtained virus was treated with DNase and proteinase K, followed by PCR amplification. The virus was then recovered using the QIAquick PCR Purification Kit (QIAGEN, 28104). The recovered products were analyzed using high-throughput deep sequencing. The percentage (fv) of each mutant sequence in the viral library was calculated, and the coverage and uniformity of the mutant sequences were analyzed. Primer design was the same as described in the previous section on plasmid library identification.

[0048] A comparative analysis of high-throughput deep sequencing results of the AAV6 mutant plasmid library and viral library was performed; the results are attached. Figure 5 From the appendix Figure 5Data shows that approximately 20 million sequences were sequenced from each of the two samples, with 97% of the sequencing results containing the designed barcode sequences. The plasmid library sequencing contained 4417 barcode sequences, and the virus library sequencing contained 4238 barcode sequences, indicating that the vast majority of mutants could successfully assemble into AAV viral particles. The distribution frequencies of these mutants were statistically analyzed and plotted, with each point representing the distribution of one mutant in the plasmid and virus libraries respectively. The frequency distribution of most mutants was similar in both libraries (diagonal region), while a small number of mutants showed a certain advantage in viral packaging (top left region).

[0049] Example 2 Based on Example 1, this embodiment performs rapid screening of AAV6 mutant libraries for in vitro transduction target cells to obtain viral mutants with enhanced transduction targeting specific target cells.

[0050] 1. Evaluate the transduction efficiency of different AAV6 mutant viral libraries. Jurkat cells in the logarithmic growth phase were transduced in vitro using two MOI gradients (50,000 and 100,000). To reduce the toxicity of the viral solution to the cells, the medium was changed 8–12 hours after transduction. Three days after viral infection, fresh medium containing puromycin was added for selection. After drug addition, the cells were cultured for another 3–7 days, followed by collection of Jurkat cells. Genomic DNA was extracted, amplified by PCR, and the cells were recovered using the QIAquick PCRPurification Kit (QIAGEN, 28104). The recovered products were then analyzed using high-throughput deep sequencing (Illumina sequencing). The percentage (fcell) of each mutant sequence in the cells was calculated to analyze the coverage and uniformity of mutant sequences. Primer design was the same as described in the previous section on plasmid library identification.

[0051] A comparative analysis was performed on the high-throughput deep sequencing results of the AAV6 mutant viral library and the Jurkat cell genome. The results are attached. Figure 6Between 30 and 40 million sequences were detected in the two enriched cell samples, including approximately 17 million barcodes, representing barcode coverage of about 46% and 40%, respectively. This percentage is significantly lower than that of the plasmid and virus libraries, likely due to the higher complexity of the genomic template sequences in the enriched cells. Although the proportion of barcode sequences decreased, their diversity remained similar to that of the virus library. 3786 and 3850 barcode sequences were detected in the two sets of samples, respectively. Similarly, the distribution frequency of each mutant in the cell samples and virus library was statistically analyzed and plotted. Each point represents the distribution of a mutant in both samples and the virus library. The frequency distribution of most mutants was similar in both (diagonal region), with a small number of mutants distributed slightly further away from the diagonal.

[0052] The transduction efficiency of each mutant in a cell sample is evaluated using two scoring parameters: the enrichment score (ES = log10(fcell / fv)) and the percentage ranking (fcellrank). Here, fcell represents the percentage frequency of each mutant in the cell sample compared to all mutants, and fv represents the percentage frequency of each mutant in the viral library compared to all mutants. The enrichment score (ES) represents the distribution level of each mutant in the cell compared to the viral library; a larger ES indicates a more advantageous distribution level of the mutant in the cell compared to the viral library, suggesting stronger transduction efficiency in that cell. Considering that some mutants are present in very small quantities in the sequencing sample, which can easily lead to errors, even when fcell and fv are both small, the ES may still be relatively large, but the advantage of that mutant is not significant. Therefore, the percentage ranking (fcellrank) of each mutant in the cell sample is further introduced to evaluate the efficiency of the mutant, filtering out potential errors. The enrichment indices were sorted from largest to smallest, and the percentages were sorted from smallest to largest. Mutants with high rankings in both categories were selected for subsequent functional validation. Results are attached. Figure 7 .

[0053] From the appendix Figure 7Data shows that in two Jurkat cell samples (J1 and J2), the mutant P482L, designated lib5-P7L, ranked among the top ten in both enrichment index and proportion. The pie chart shows the proportion of mutant P482L among the top ten mutants with the highest enrichment index. The barcode sequence associated with mutant P482L is also provided; this barcode sequence ensures accurate differentiation of different mutants during sequencing, providing a unique identifier for each mutant. These data indicate that a novel mutant, P482L, with high transduction efficiency in Jurkat cells has been identified. Its amino acid sequence is: * (as shown in SEQ ID NO. 18), "*" represents the termination of the protein sequence.

[0054] The barcode sequences of the mutants with enrichment indices in the top ten are shown in the table below:

[0055] 2. Testing and screening for novel AAV6 mutants (1) Construction of novel viral vectors The mutants obtained from the screening described above were used to construct novel viral vectors. The mutant sequences were cloned into conventional AAV6 packaging plasmids containing GFP reporter genes. The target plasmids were co-transfected with helper plasmids into 293LX cells, and the titers of the obtained mutant AAV viruses were detected.

[0056] (2) Verification by transducing Jurkat cells Three AAV viruses carrying the GFP reporter gene were prepared using three packaging plasmids: Cap6-P482L, native Cap6, and the previously reported Cap6 triple mutant 6.2FF (F129L-Y445F-Y731F) (A Novel Triple-Mutant AAV6 Capsid Induces Rapid and Potent Transgene Expression in the Muscle and Respiratory Tract of Mice [J]. Mol Ther Methods Clin Dev, 2018, 9: 323-9). Jurkat cells were transduced at two MOI levels (10000 and 25000), and the proportion of GFP-positive cells and the average fluorescence intensity were counted by flow cytometry. The results are shown in the appendix. Figure 8 .

[0057] From the appendix Figure 8Data shows that, at the same MOI transduction level, AAV6-P482L exhibited significantly higher transduction efficiency for Jurkat than AAV6 (low MOI-10K: 50% versus 11%; high MOI-25K: 80% versus 55%), statistically on par with the AAV6.2FF triple mutant (low MOI-10K: 50% versus 35%; high MOI-25K: 80% versus 74%). Flow cytometry results indicate that increasing the viral MOI both increased the proportion of GFP-positive cells and the average fluorescence intensity of GFP-positive cells, resulting in a noticeable tailing phenomenon in the flow cytometry peaks. In contrast, AAV6-P482L significantly increased the proportion of GFP-positive cells, but the average fluorescence intensity of GFP-positive cells did not change much, and the flow cytometry peaks were more concentrated, suggesting smaller differences in expression levels among transduced positive cells, which is beneficial for preparing a cell population with lower heterogeneity in exogenous gene expression.

[0058] (3) Transduction of human primary T cells test Human peripheral blood mononuclear cells (PBMCs) were resuscitated and activated 24 hours later using Dynabeads™ Human T-Activator CD3 / CD28 immunomagnetic beads (ThermoFisher, 11132D). After 48 hours of activation, three different types of AAV viruses were added. Cells were collected 48 hours after viral transduction, and transduction efficiency was analyzed by flow cytometry. Results are attached. Figure 9 .

[0059] From the appendix Figure 9 The data show that, under the same MOI, P482L is superior to AAV6 and AAV6.2FF. Furthermore, similar to the Jurkat transduction results, the average fluorescence intensity of GFP-positive cells transduced with P482L is similar, indicating lower cellular heterogeneity in GFP expression.

[0060] The above content is only for illustrating the technical concept of the present invention and should not be construed as limiting the scope of protection of the present invention. Any modifications made to the technical solution based on the technical concept proposed in this invention shall fall within the scope of protection of the claims of this invention.

Claims

1. A novel adeno-associated virus capsid protein variant, characterized in that, The capsid protein variant is AAV6-P482L, and its amino acid sequence is shown in SEQ ID NO:

18.

2. The use of the novel adeno-associated virus capsid protein variant of claim 1 in the preparation of adeno-associated virus vectors.

Images