siRNA molecules that modulate the activity of the angptl3 gene

Abstract

Provided are small interfering RNAs (siRNAs) for inhibiting expression of angiopoietin-like 3 (ANGPTL3) protein in a cell, as well as cells comprising the siRNAs and methods of using the siRNAs or cells to treat a disease or condition associated with ANGPTL3 expression in a subject.

Description

Technical Field

[0001] This disclosure relates to the field of RNA interference. Background Technology

[0002] Angiopoietins are a family of secreted growth factors. Together with their corresponding endothelial-specific receptors, angiopoietins play an important role in angiogenesis. Angiopoietin-like 3 (also known as angiopoietin-like 3, ANGPTL3, or angiopoietin 5, ANGPT5) is a member of the angiopoietin family, primarily expressed in the liver, and is thought to play a role in regulating lipid metabolism.

[0003] Angiopoietin-like 3 (ANGPTL3) is a lipid metabolism regulator that modulates VLDL triglycerides (TG) by inhibiting the catalytic activity of lipoprotein lipase (LPL). The APOEKO mouse model with the hypl mutation (apoEKO-hyp1) exhibits reduced Angptl3 expression. This mouse model shows significant reductions in VLDL-TG, VLDL cholesterol, and plasma apoB levels, and plasma LPL and hepatic lipase activity are significantly increased in apoEKO-hypl mice after heparinization, indicating enhanced lipid metabolism (Ando et al., (2003) J. Lipid Res, 44: 1216-1223). In humans, plasma ANGPTL3 concentration is positively correlated with plasma HDL cholesterol and HDL phospholipid levels (Shimamura et al., (2007) Arterioscler. Thromb. Vasc. Biol., 27: 366-372).

[0004] In recent years, inhibitors targeting ANGPTL3 have emerged as novel therapeutic agents for these diseases. siRNA, as a new treatment approach, holds immense potential. Acting on intracellular mRNA, siRNA can directly silence target genes compared to traditional small-molecule drugs, thus fundamentally and more effectively preventing the occurrence and progression of diseases. However, due to its poor stability, siRNA is easily degraded by nucleases in vivo, poorly absorbed by tissues and cells, and prone to off-target effects, its clinical application is limited. Currently, there is an urgent need for an siRNA that can effectively inhibit intracellular ANGPTL3 gene expression. Summary of the Invention

[0005] This disclosure provides novel small interfering RNA (siRNA), kits, and pharmaceutical compositions thereof for inhibiting the expression of angiopoietin-like 3 (ANGPTL3) in cells, as well as methods for inhibiting or reducing ANGPTL3 gene expression or treating diseases or symptoms related to ANGPTL3 expression.

[0006] In a first aspect, this disclosure provides a small interfering RNA (siRNA) for inhibiting the expression of angiopoietin-like 3 (ANGPTL3) in cells, said siRNA comprising a sense strand and an antisense strand forming a double-stranded region, wherein the length of said sense strand and said antisense strand are each independently 15-30 nucleotides, and said antisense strand comprises a nucleotide sequence of at least 15 consecutive nucleotides of the nucleotide sequence shown in any one of SEQ ID NO: 16-29. In some specific embodiments, said sense strand comprises a nucleotide sequence of at least 15 consecutive nucleotides of the nucleotide sequence shown in any one of SEQ ID NO: 1-14.

[0007] In some implementations, the lengths of the sense strand and the antisense strand are each independently 17-27 nucleotides, preferably 19-25 nucleotides, and more preferably 19-23 nucleotides.

[0008] In some embodiments, the length of the double-stranded region is 15-25 nucleotide pairs, preferably 17-23 nucleotide pairs, and more preferably 19-21 nucleotide pairs.

[0009] In some embodiments, one or both of the sense strand and the antisense strand include a 3' overhang and / or a 5' overhang having at least one nucleotide. For example, one or both of the sense strand and the antisense strand include a 3' overhang and / or a 5' overhang having at least one nucleotide. In some preferred embodiments, the antisense strand has a 3' overhang and / or a 5' overhang having at least two nucleotides, preferably the antisense strand includes a 3' overhang and / or a 5' overhang having two nucleotides.

[0010] In some embodiments, the antisense strand comprises a nucleotide sequence of at least 16 consecutive nucleotides, at least 17 consecutive nucleotides, at least 18 consecutive nucleotides, at least 19 consecutive nucleotides, or at least 20 consecutive nucleotides of the nucleotide sequence shown in any one of SEQ ID NO: 16-29. Preferably, the antisense strand comprises a nucleotide sequence shown in any one of SEQ ID NO: 16-29.

[0011] In some embodiments, the sense strand comprises a nucleotide sequence of at least 16 consecutive nucleotides, at least 17 consecutive nucleotides, or at least 18 consecutive nucleotides of any of the nucleotide sequences shown in SEQ ID NO: 1-14, and preferably the antisense strand comprises a nucleotide sequence shown in any of SEQ ID NO: 1-14.

[0012] In some implementations, the siRNA comprises paired sense and antisense sequences as shown in Table 3.

[0013] In some embodiments, substantially all nucleotides of the sense strand and substantially all nucleotides of the antisense strand are modified nucleotides, or all nucleotides of the sense strand and all nucleotides of the antisense strand are modified nucleotides.

[0014] In some specific embodiments, the sense strand and the antisense strand each independently comprise one or more nucleotide modifications selected from the group consisting of: 2′-O-methyl modified nucleotides, 2′-fluoro modified nucleotides, 2′-deoxy-modified nucleotides, inosine ribonucleotides, baseless nucleotides, reverse baseless deoxyribonucleotides, thiophosphate nucleotide-linked modifications, vinylphosphonate modified nucleotides, locked nucleotides, 2′-amino-modified nucleotides, 2′-alkyl-modified nucleotides, morpholinonucleotides, aminophosphates, non-natural bases containing nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid didecanoic acid didecylamide groups, deoxyribonucleotides, and STM1.

[0015] In some preferred embodiments, the sense strand and the antisense strand each independently comprise one or more nucleotide modifications selected from the group consisting of: 2′-O-methyl modified nucleotides, 2′-fluoro modified nucleotides, reverse abase-free deoxyribonucleotides, phosphate thioester nucleotide interlinking modifications, and STM1. In some preferred embodiments, the sense strand and / or the antisense strand comprises at least two 2′-fluoro modified nucleotides. In some preferred embodiments, the sense strand and / or the antisense strand comprises at least eight 2′-O-methyl modified nucleotides. In some preferred embodiments, the 3′ and / or 5′ ends of the sense strand and / or the antisense strand comprise 1-5 phosphate thioester groups, preferably 2-3 phosphate thioester groups.

[0016] In some implementations, in the siRNA disclosed herein,

[0017] (a) The chain of justice includes

[0018] CmsAmsCmGmUmUmGfCfUfUmGmAmAmAmUmUmGmAmAm (SEQ ID NO: 31),

[0019] The antiskewing chain includes

[0020] UmsUfsCmAfAmUfUmUfCmAfAmGfCmAfAmCfGmUfGmsGfsAm (SEQ ID NO: 61);

[0021] (b) The chain of justice includes

[0022] CmsAmsAmUmUmAmAfGfCfUmCmCmUmUmCmUmUmUmUm (SEQ ID NO: 32),

[0023] The antiskewing chain includes

[0024] AmsAfsAmAfGmAfAmGfGmAfGmCfUmUfAmAfUmUfGmsUfsGm (SEQ ID NO: 62);

[0025] (c) The chain of justice includes

[0026] UmsAmsUmUmGmUmUfCfCfUmCmUmAmGmUmUmAmUmUm (SEQ ID NO: 33),

[0027] The antiskewing chain includes

[0028] AmsAfsUmAfAmCfUmAfGmAfGmGfAmAfCmAfAmUfAmsAfsAm (SEQ ID NO: 63);

[0029] (d) The chain of justice includes

[0030] GmsUmsUmAmUmUmUfCfCfUmCmCmAmGmAmAmUmUmAm (SEQ ID NO: 34),

[0031] The antiskewing chain includes

[0032] UmsAfsAmUfUmCfUmGfGmAfGmGfAmAfAmUfAmAfCmsUfsAm (SEQ ID NO: 64);

[0033] (e) The chain of justice includes

[0034] AmsGmsAmAmUmUmGfAfUfCmAmAmGmAmCmAmAmUmUm (SEQ ID NO: 35),

[0035] The antiskewing chain includes

[0036] AmsAfsUmUfGmUfCmUfUmGfAmUfCmAfAmUfUmCfUmsGfsGm (SEQ ID NO: 65);

[0037] (f) The chain of justice includes

[0038] AmsUmsCmAmAmGmAfCfAfAmUmUmCmAmUmCmAmUmUm (SEQ ID NO: 36),

[0039] The antiskewing chain includes

[0040] AmsAfsUmGfAmUfGmAfAmUfUmGfUmCfUmUfGmAfUmsCfsAm (SEQ ID NO: 66);

[0041] (g) The justice chain includes

[0042] GmsAmsGmCmCmAmAfAfAfUmCmAmAmGmAmUmUmUmAm (SEQ ID NO: 37),

[0043] The antiskewing chain includes

[0044] UmsAfsAmAfUmCfUmUfGmAfUmUfUmUfGmGfCmUfCmsUfsGm (SEQ ID NO: 67);

[0045] (h) The chain of justice includes

[0046] UmsGmsAmAmCmUmCfAfAfCmUmCmAmAmAmAmCmUmUm (SEQ ID NO: 38),

[0047] The antiskewing chain includes

[0048] AmsAfsGmUfUmUfUmGfAmGfUmUfGmAfGmUfUmCfAmsAfsGm (SEQ ID NO: 68);

[0049] (i) The chain of justice includes

[0050] AmsGmsAmGmCmAmAfCfUfAmAmCmUmAmAmCmUmUmAm (SEQ ID NO: 39),

[0051] The antiskewing chain includes

[0052] UmsAfsAmGfUmUfAmGfUmUfAmGfUmUfGmCfUmCfUmsUfsCm (SEQ ID NO: 69);

[0053] (j) The chain of justice includes

[0054] GmsCmsAmAmCmUmAfAfCfUmAmAmCmUmUmAmAmUmUm (SEQ ID NO: 40),

[0055] The antiskewing chain includes

[0056] AmsAfsUmUfAmAfGmUfUmAfGmUfUmAfGmUfUmGfCmsUfsCm (SEQ ID NO: 70);

[0057] (k) The chain of justice includes

[0058] CmsUmsAmAmCmUmAfAfCfUmUmAmAmUmUmCmAmAmAm (SEQ ID NO: 41),

[0059] The antiskewing chain includes

[0060] UmsUfsUmGfAmAfUmUfAmAfGmUfUmAfGmUfUmAfGmsUfsUm (SEQ ID NO: 71);

[0061] (1) The chain of justice includes

[0062] CmsUmsAmAmCmUmUfAfAfUmUmCmAmAmAmAmUmCmAm (SEQ ID NO: 42),

[0063] The antiskewing chain includes

[0064] UmsGfsAmUfUmUfUmGfAmAfUmUfAmAfGmUfUmAfGmsUfsUm (SEQ ID NO: 72);

[0065] (m) The justice chain includes

[0066] UmsAmsAmCmUmUmAfAfUfUmCmAmAmAmAmUmCmAmAm (SEQ ID NO: 43),

[0067] The antiskewing chain includes

[0068] AmsAfsUmAfAmCfUmAfGmAfGmGfAmAfCmAfAmUfAmsAfsAm (SEQ ID NO: 73); or

[0069] (n) The justice chain includes

[0070] GmsGmsAmUmCmAmCfA￡AfAmAmCmUmUmCmAmAmUmAm (SEQ ID NO: 44),

[0071] The antiskewing chain includes

[0072] UmsAfsUmUfGmAfAmGfUmUfUmUfGmUfGmAfUmCfCmsAfsUm (SEQ ID NO: 74).

[0073] In some implementations, in the siRNA disclosed herein,

[0074] (a) The chain of justice includes

[0075] UmsGmsAmAmCmUmCfAfAfCmUmCmAmAmAmAmCmUmsUm (SEQ ID NO: 131),

[0076] And the antisense chain contains

[0077] AmsAfsGmUfUmUfUmGfAmGfUmUfGmAfGmUfUmCfAmsAfsGm (SEQ ID NO: 132);

[0078] (b) The chain of justice includes

[0079] GmsGmsAmUmCmAmCfAfAfAmAmCmUmUmCmAmAmUmsAm (SEQ ID NO: 133),

[0080] And the antisense chain contains

[0081] UmsAfsUmUfGmAfAmGfUmUfUmUfGmUfGmAfUmCfCmsAfsUm (SEQ ID NO: 134);

[0082] (c) The chain of justice includes

[0083] CmsAmsCmGmUmUmGfCfUfUmGmAmAmAmUmUmGmAmsAm (SEQ ID NO: 135),

[0084] And the antisense chain contains

[0085] UmsUfsCmAfAmUfUmUfCmAfAmGfCmAfAmCfGmUfGmsGfsAm (SEQ ID NO: 136);

[0086] (d) The chain of justice includes

[0087] STM1s-CmsUmUmGmAmAmCmUmCfAfAfCmUmCmAmAmAmAmCmUmUms-STM1 (SEQ ID NO: 137),

[0088] And the antisense chain contains

[0089] AmsAfsGmUfUmUfUmGfAmGfUmUfGmAfGmUfUmCfAmsAfsGm (SEQ ID NO: 138);

[0090] (e) The chain of justice includes

[0091] STM1s-AmsUmGmGmAmUmCmAmCfAfAfAmAmCmUmUmCmAmAmUmAms-STM1 (SEQ ID NO: 139),

[0092] And the antisense chain contains

[0093] UmsAfsUmUfGmAfAmGfUmUfUmUfGmUfGmAfUmCfCmsAfsUm (SEQ ID NO: 140);

[0094] (f) The chain of justice includes

[0095] STM1s-UmsCmCmAmCmGmUmUmGfCfUfUmGmAmAmAmUmUmGmAmAms-STM1 (SEQ ID NO: 141),

[0096] And the antisense chain contains

[0097] UmsUfsCmAfAmUfUmUfCmAfAmGfCmAfAmCfGmUfGmsGfsAm (SEQ ID NO: 142);

[0098] (g) The justice chain includes

[0099] STM1-STM1-

[0100] UmsCmCmAmCmGmUmUmGfCfUfUmGmAmAmAmUmUmGmAmAm-STM1-STM1 (SEQ ID NO: 143),

[0101] And the antisense chain contains

[0102] UmsUfsCmAfAmUfUmUfCmAfAmGfCmAfAmCfGmUfGmsGfsAm (SEQ ID NO: 144); or

[0103] (h) The chain of justice includes

[0104] IBs-UmsCmCmAmCmGmUmUmGfCfUfUmGmAmAmAmUmUmGmAmAms-IB (SEQ ID NO: 145),

[0105] And the antisense chain contains

[0106] UmsUfsCmAfAmUfUmUfCmAfAmGfCmAfAmCfGmUfGmsGfsAm (SEQ ID NO: 146).

[0107] In some implementations, in the siRNA disclosed herein,

[0108] (a) The chain of justice includes

[0109] STM1-STM1-

[0110] UmsCmCmAmCmGmUmUmGfCfUfUmGmAmAmAmUmUmGmAmsAm-STM1-STM1 (SEQ ID NO: 147),

[0111] And the antisense chain contains

[0112] UmsUfsCmAfAmUfUmUfCmAfAmGfCmAfAmCfGmUfGmsGfsAm (SEQ ID NO: 148);

[0113] (b) The chain of justice includes

[0114] STM1s-UmsCmCmAmCmGmUmUmGfCfUfUmGmAmAmAmUmUmGmAmAm-STM1-STM1 (SEQ IDNO: 149),

[0115] And the antisense chain contains

[0116] UmsUfsCmAfAmUfUmUfCmAfAmGfCmAfAmCfGmUfGmsGfsAm (SEQ ID NO: 150);

[0117] (c) The chain of justice includes

[0118] STM1s-CmsAmAmGmAmCmAmAmUfUfCfAmUmCmAmUmUmUmGmAmUms-STM1 (SEQ ID NO: 151),

[0119] And the antisense chain contains

[0120] AmsUfsCmAfAmAfUmGfAmUfGmAfAmUfUmGfUmCfUmsUfsGm (SEQ ID NO: 152);

[0121] (d) The chain of justice includes

[0122] STM1-STM1-

[0123] CmsAmAmGmAmCmAmAmUfUfCfAmUmCmAmUmUmUmGmAmsUm-STM1-STM1 (SEQ ID NO: 153),

[0124] And the antisense chain contains

[0125] AmsUfsCmAfAmAfUmGfAmUfGmAfAmUfUmGfUmCfUmsUfsGm (SEQ ID NO: 154);

[0126] (e) The chain of justice includes

[0127] STM1s-CmsAmAmGmAmCmAmAmUfUfCfAmUmCmAmUmUmUmGmAmUm-STM1-STM1 (SEQ IDNO: 155),

[0128] And the antisense chain contains

[0129] AmsUfsCmAfAmAfUmGfAmUfGmAfAmUfUmGfUmCfUmsUfsGm (SEQ ID NO: 156);

[0130] (f) The chain of justice includes

[0131] STM1s-UmsGmGmUmAmUmUmAmAfAfUfCmCmUmUmAmAmGmAmGmAms-STM1 (SEQ ID NO: 157),

[0132] And the antisense chain contains

[0133] UmsCfsUmCfUmUfAmAfGmGfAmUfUmUfAmAfUmAfCmsCfsAm (SEQ ID NO: 158);

[0134] (g) The justice chain includes

[0135] STM1s-CmsCmAmGmAmAmUmUmGfAfUfCmAmAmGmAmCmAmAmUmUms-STM1 (SEQ ID NO: 159),

[0136] And the antisense chain contains

[0137] AmsAfsUmUfGmUfCmUfUmGfAmUfCmAfAmUfUmCfUmsGfsGm (SEQ ID NO: 160); or

[0138] (h) The chain of justice includes

[0139] STM1s-UmsGmAmUmCmAmAmGmAfCfAfAmUmUmCmAmUmCmAmUmUms-STM1 (SEQ ID NO: 161),

[0140] And the antisense chain contains

[0141] AmsAfsUmGfAmUfGmAfAmUfUmGfUmCfUmUfGmAfUmsCfsAm (SEQ ID NO: 162).

[0142] In some embodiments, the siRNA is further conjugated to a ligand moiety comprising N-acetylgalactosamine, preferably with the positive strand of the siRNA conjugated to the ligand moiety. In some preferred embodiments, the 3' end of the positive strand is conjugated to the ligand moiety. In other preferred embodiments, the 5' end of the positive strand is conjugated to the ligand moiety.

[0143] In some embodiments, the ligand moiety comprises a conjugating group represented by formula (X'):

[0144]

[0145] in,

[0146] Indicates the location where it connects to a biomolecule;

[0147] Q is independent of H,

[0148] Where L1 is a chemical bond, -CH2-, -CH2CH2-, -C(O)-, -CH2O-, -CH2O-CH2CH2O-, or -NHC(O)-(CH2NHC(O)). a -;

[0149] L2 is a chemical bond or -CH2CH2C(O)-;

[0150] L3 is a chemical bond, -(NHCH2CH2) b -、-(NHCH2CH2CH2) b -or-C(O)CH2-;

[0151] L4 is -(OCH2CH2) c -、-(OCH2CH2CH2) c -、-(OCH2CH2CH2CH2) c -、-(OCH2CH2CH2CH2CH2) c -or -NHC(O)-(CH2) d -;

[0152] Where a = 0, 1, 2 or 3;

[0153] b = 1, 2, 3, 4 or 5;

[0154] c = 1, 2, 3, 4 or 5;

[0155] d = 1, 2, 3, 4, 5, 6, 7 or 8;

[0156] L represents a chemical bond, -CH2O- or -NHC(O)-;

[0157] L' represents a chemical bond, -C(O)NH-, -NHC(O)-, or -O(CH2CH2O). e -;

[0158] Where e is 1, 2, 3, 4 or 5;

[0159] T represents a chemical bond, -CH2-, -C(O)-, -M-, -CH2-M-, or -C(O)-M-;

[0160] Where M is

[0161] R1 and R2 together form -CH2CH2O- or -CH2CH(R)-O-, and R3 is H;

[0162] Or R1 and R3 together form -C 1-2 Alkylene-, and R2 is H;

[0163] Wherein R is -OR', -CH2OR' or -CH2CH2OR', where R' is H, a hydroxyl protecting group or a solid support, and the hydroxyl protecting group is preferably -C(O)CH2CH2C(O)OH or 4,4′-dimethoxytriphenylmethyl;

[0164] m = 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10;

[0165] n = 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

[0166] In some embodiments, the conjugated ligand targets the desialyl glycoprotein receptor (ASGPR).

[0167] In some preferred embodiments, the conjugating groups are selected from Table 1:

[0168] Table 1. Structure of the conjugated groups

[0169]

[0170]

[0171]

[0172]

[0173] In some preferred embodiments, the conjugating groups are selected from Table 2:

[0174] Table 2 Structure of the conjugated groups

[0175]

[0176]

[0177]

[0178]

[0179]

[0180] In some embodiments, the ligand contained in the siRNA has the following structure:

[0181]

[0182] in This indicates the position where the siRNA is attached to the positive strand of the siRNA via a phosphate ester group or a thiophosphate ester group.

[0183] In some embodiments, the ligand contained in the siRNA has the following structure:

[0184]

[0185] in This indicates the position where the siRNA is attached to the positive strand of the siRNA via a phosphate ester group or a thiophosphate ester group.

[0186] In some embodiments, the ligands contained in the siRNA of this disclosure have the following structures:

[0187]

[0188] in This indicates the location where the siRNA is linked via a phosphate ester group or a thiophosphate ester group.

[0189] In some embodiments, the ligands contained in the siRNA of this disclosure have the following structures:

[0190]

[0191] in This indicates the position where the siRNA is attached to the positive strand via a phosphate group or a thiophosphate group.

[0192] In a second aspect, this disclosure provides a cell containing the siRNA described herein.

[0193] In a third aspect, this disclosure provides a pharmaceutical composition comprising the siRNA or cells described herein, and optionally a pharmaceutically acceptable carrier or excipient.

[0194] In a fourth aspect, this disclosure provides a kit comprising the siRNA, cell, or pharmaceutical composition described herein.

[0195] In a fifth aspect, this disclosure provides a method for reducing ANGPTL3 levels, LDL levels, apoC-III levels, triglyceride levels, cholesterol levels, glucose levels, and fat pad weight in a subject, the method comprising the step of administering the siRNA, cells, or pharmaceutical composition described in this disclosure to the subject.

[0196] This disclosure also provides a method for treating a disease or symptom associated with ANGPTL3 expression in a subject, the method comprising administering to the subject the siRNA, cells, or pharmaceutical composition described in this disclosure.

[0197] In some embodiments, the disease associated with ANGPTL3 expression is the metabolic disease or cardiovascular disease. In some preferred embodiments, the metabolic disease or cardiovascular disease is selected from obesity, diabetes, atherosclerosis, dyslipidemia, coronary heart disease, non-alcoholic fatty liver disease (NAFLD), hyperfatty acidemia, or metabolic syndrome, or a combination thereof.

[0198] In some embodiments, the ANGPTL3 expression-related disease is a lipid disorder, specifically hyperlipidemia. In some embodiments, hyperlipidemia is hypercholesterolemia, hypertriglyceridemia, or a combination thereof.

[0199] In some implementations, the disease associated with ANGPTL3 expression is NAFLD, which is hepatic steatosis or steatohepatitis.

[0200] In some implementations, the disease associated with ANGPTL3 expression is diabetes, specifically type 2 diabetes or type 2 diabetes with dyslipidemia.

[0201] In some embodiments, the methods of treating a subject for diseases or symptoms associated with ANGPTL3 expression according to this disclosure include administering the siRNA, cell, or pharmaceutical composition to the subject via subcutaneous, topical, or intravenous administration. In some embodiments, the subject is a human subject. Invention Details

[0203] The following specific examples illustrate the implementation of this disclosure. Those skilled in the art can easily understand other advantages and effects of this disclosure from the content disclosed in this specification. This disclosure can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of this disclosure.

[0204] It should be understood that the scope of protection of this disclosure is not limited to the specific implementation schemes described below; it should also be understood that the terminology used in the implementation schemes of this disclosure is for describing specific implementation schemes and not for limiting the scope of protection of this disclosure.

[0205] In this disclosure and claims, unless otherwise expressly stated herein, the singular forms “an,” “a,” and “this” include the plural forms.

[0206] When numerical ranges are given in the implementation scheme, it should be understood that, unless otherwise stated in this disclosure, both endpoints of each numerical range and any value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in this disclosure have the same meaning as commonly understood by one of ordinary skill in the art. In addition to the specific methods, apparatus, and materials used in the embodiments, based on the prior art mastery of one of ordinary skill in the art and the description in this disclosure, any prior art methods, apparatus, and materials similar to or equivalent to those described in the implementation schemes of this disclosure may be used to implement this disclosure, and all such methods, apparatus, and materials fall within the protection scope of this disclosure. The implementation methods of this disclosure are described in more detail below.

[0207] definition

[0208] The term "siRNA" in this article refers to a class of double-stranded RNA molecules that can mediate the silencing of a complementary target RNA (e.g., mRNA, such as transcripts of genes encoding proteins). siRNA is typically double-stranded, consisting of an antisense strand complementary to the target RNA and a sense strand complementary to that antisense strand. For convenience, such mRNA is also referred to herein as the mRNA to be silenced. Such genes are also referred to as target genes. Typically, the RNA to be silenced is an endogenous gene or a pathogen gene. Additionally, RNAs other than mRNA (e.g., tRNA) and viral RNA can also be targeted.

[0209] As used herein, the term "antisense strand" refers to a strand of siRNA that contains regions that are fully or substantially complementary to the target sequence.

[0210] As used herein, the term "complementary region" refers to a region on the antisense strand that is perfectly or substantially complementary to the target mRNA sequence. In cases where the complementary region is not perfectly complementary to the target sequence, mismatches can occur within the molecule or at the ends. Typically, the most tolerant mismatches are located in the end regions, for example, within 5, 4, 3, 2, or 1 nucleotides at the 5' and / or 3' ends. The portion of the antisense strand most sensitive to mismatches is called the "seed region." For example, in a siRNA containing a 19-nt strand, the 19th position (from 5' to 3') can tolerate some mismatches.

[0211] When used in this context, the term "complementarity" refers to the ability of a first polynucleotide to hybridize with a second polynucleotide under certain conditions, such as stringent conditions. For example, stringent conditions may include 400 mM NaCl, 40 mM PIPES at pH 6.4, and 1 mM EDTA at 50 or 70°C for 12–16 hours.

[0212] When used in this context, the "complementary" sequence may also include, in order to satisfy the above requirements regarding their hybridization ability, base pairs formed entirely from non-Watson-Crick base pairs and / or from non-natural and modified nucleotides. Such non-Watson-Crick base pairs include, but are not limited to, G:U swing base pairs or Hoogstein base pairs.

[0213] As used herein, a polynucleotide that is “at least partially complementary” or “substantially complementary” to messenger RNA (mRNA) means a polynucleotide that is substantially complementary to a continuous portion of the mRNA of interest (e.g., the mRNA encoding ANGPTL3). For example, a polynucleotide is at least partially complementary to the ANGPTL3 mRNA if the sequence is substantially complementary to an uninterrupted portion of the mRNA encoding ANGPTL3.

[0214] The terms “complementary,” “fully complementary,” and “substantially complementary” used here can be used in relation to the base pairing between the sense and antisense strands of the siRNA, or between the antisense strand of the siRNA reagent and the target sequence.

[0215] As used herein, the term "sense chain" refers to a chain of siRNA that includes regions substantially complementary to the region defined herein as the term "antisense chain".

[0216] "Nucleoside" is a compound composed of two substances: a purine or pyrimidine base and ribose or deoxyribose. "Nucleotide" is a compound composed of three substances: a purine or pyrimidine base, ribose or deoxyribose, and phosphate. "Oligonucleotide" refers to nucleic acid molecules (RNA or DNA) with a length of less than 100, 200, 300, or 400 nucleotides.

[0217] A "base" is the basic building block for the synthesis of nucleosides, nucleotides, and nucleic acids. Its constituent elements include nitrogen, hence it is also called a "nitrogenous base." In this article, unless otherwise specified, the capital letters A, U, T, G, and C represent the base composition of nucleotides, namely adenine, uracil, thymine, guanine, and cytosine, respectively.

[0218] As used herein, the term "nucleotide overhang" refers to at least one unpaired nucleotide that protrudes from the double-stranded structure of siRNA (e.g., siRNA). A nucleotide overhang exists, for example, when the 3′ end of one strand of siRNA extends beyond the 5′ end of the other strand, or vice versa. siRNA may contain an overhang having at least one nucleotide; alternatively, the overhang may contain at least two, three, four, five, or more nucleotides. The nucleotide overhang may contain or consist of nucleotide / nucleoside analogs (including deoxynucleotides / nucleosides). One or more overhangs may be located on the sense strand, antisense strand, or any combination thereof. Additionally, one or more nucleotides of the overhang may be present at the 5′ end, 3′ end, or both ends of the antisense or sense strand of the siRNA.

[0219] "Flat-ended," "blunt-ended," or "acute-end" means that there are no unpaired nucleotides at that end of the double-stranded siRNA, i.e., no nucleotide overhang. A "flat-ended" siRNA is a double-stranded siRNA along its entire length, meaning there are no nucleotide overhangs at either end of the molecule. The siRNAs disclosed herein include siRNAs having a nucleotide overhang at one end (i.e., a reagent having one overhang and one blunt end) or siRNAs having nucleotide overhangs at both ends.

[0220] The iRNA of this disclosure has substantially all modified nucleotides. For example, substantially all nucleotides of the sense strand are modified nucleotides, and / or substantially all nucleotides of the antisense strand are modified nucleotides, and / or substantially all nucleotides of both the sense and antisense strands are modified nucleotides. In other embodiments of this disclosure, all nucleotides of the iRNA of this disclosure are modified nucleotides. For example, all nucleotides of the sense strand are modified nucleotides, and / or all nucleotides of the antisense strand are modified nucleotides, and / or substantially all nucleotides of both the sense and antisense strands are modified nucleotides. "Substantially all nucleotides are modified" means that the siRNA of this disclosure is mostly, but not all, modified, and may include no more than 5, 4, 3, 2, or 1 unmodified nucleotide.

[0221] In this document, "modified nucleotides" include, but are not limited to, 2′-O-alkyl-modified nucleotides (e.g., 2′-O-methyl-modified nucleotides, 2′-methoxyethyl-modified nucleotides), 2′-fluoro-modified nucleotides, 2′-deoxy-modified nucleotides, inosine ribonucleotides, abasic nucleotides, reverse abasic deoxyribonucleotides, nucleotides containing thiophosphate groups, thiophosphate nucleotide-linked modifications, vinylphosphonate-modified nucleotides, locked nucleotides, 2′-amino-modified nucleotides, 2′-alkyl-modified nucleotides, and morpholinonucleotides. Aminophosphates, non-natural bases containing nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid di ...

[0222] For example, the 2′-fluorinated modified nucleotide refers to a nucleotide formed by replacing the 2′ hydroxyl group of the ribosome with fluorine. The 2′-deoxy-modified nucleotide refers to a nucleotide formed by replacing the 2′ hydroxyl group of the ribosome with a methoxy group.

[0223] "A nucleotide containing a thiophosphate group" refers to a nucleotide in which one or more oxygen atoms on the phosphate group are replaced by sulfur atoms. "Modification of internucleotide thiophosphate bonding" refers to a modification in which two adjacent nucleotides are linked by a thiophosphate group.

[0224] As used herein, a "ligand moiety" refers to a chemical portion conjugated to siRNA that can alter the distribution, targeting, or lifetime of the siRNA. In a preferred embodiment, such a ligand provides enhanced affinity for selected targets (e.g., molecules, cells or cell types), compartments (e.g., cell or organ compartments, tissues, organs, or regions of the body) compared to siRNAs, for example, those without such a ligand.

[0225] In some implementations, the ligand moiety targets the desialyl glycoprotein receptor (ASGPR) on hepatocytes. Binding of the ligand moiety to ASGPR mediates internalization via clathrin-coated vesicles. Maturation of the endosome leads to a decrease in lysosomal pH, which promotes the dissociation of the ligand-receptor complex, thereby releasing the siRNA. The conjugation of the ligand moiety targeting the desialyl glycoprotein receptor (ASGPR) on hepatocytes results in the efficacy and stability of the siRNA in vivo or within cells. This facilitates subcutaneous administration of the siRNA.

[0226] As used herein, the term “inhibition” is used interchangeably with “reduction,” “silence,” “downregulation,” and other similar terms, and includes any level of inhibition.

[0227] The phrase "inhibit ANGPTL3 expression" refers to the suppression of the expression of any ANGPTL3 gene, as well as variants or mutants of the ANGPTL3 gene. Therefore, the ANGPTL3 gene can be the wild-type ANGPTL3 gene, the mutant ANGPTL3 gene, or, in the case of genetically manipulated cells, cell groups, or organisms, a transgenic ANGPTL3 gene.

[0228] "Inhibition of ANGPTL3 gene expression" includes inhibition of any level of the ANGPTL3 gene, such as at least partial repression of ANGPTL3 gene expression. ANGPTL3 gene expression can be assessed based on the level or changes in the level of any variable associated with ANGPTL3 gene expression, such as ANGPTL3 mRNA level, ANGPTL3 protein level, or lipid level. This level can be assessed in individual cells or in a group of cells, including, for example, samples derived from a subject.

[0229] Inhibition can be assessed by a decrease in the absolute or relative level of one or more variables associated with ANGPTL3 expression compared to a control level. A control level can be any type of control level utilized in the art, such as baseline levels before administration or levels determined from similar untreated or controlled (e.g., buffer-only or inert control) subjects, cells, or samples.

[0230] A "hydroxyl protecting group" is a group that can prevent the hydroxyl group from undergoing chemical reactions and can be removed under specific conditions to restore the hydroxyl group. It mainly includes silane-type protecting groups, acyl-type protecting groups, or ether-type protecting groups, preferably the following: trimethylsilyl (TMS), triethylsilyl (TES), dimethylisopropylsilyl (DMIPS), diethylisopropylsilyl (DEIPS), tert-butyldimethylsilyl (TBDMS), tert-butyldiphenylsilyl (TBDPS), triisopropylsilyl (TIPS), acetyl (Ac), chloroacetyl, dichloroacetyl, trichloroacetyl, trifluoroacetyl (TFA), benzoyl, p-methoxybenzoyl, 9-fluorenylmethoxycarbonyl (...). Fmoc), allyloxycarbonyl (Alloc), 2,2,2-trichloroethoxycarbonyl (Troc), benzyloxycarbonyl (Cbz), tert-butoxycarbonyl (Boc), benzyl (Bn), p-methoxybenzyl (PMB), allyl, triphenylmethyl (Tr), bis-p-methoxytriphenylmethyl (DMTr), methoxymethyl (MOM), phenoxymethyl (BOM), 2,2,2-trichloroethoxymethyl, 2-methoxyethoxymethyl (MEM), methylthiomethyl (MTM), p-methoxybenzyloxymethyl (PMBM).

[0231] "Halogen" or "halogen" refers to fluorine (F), chlorine (Cl), bromine (Br), and iodine (I).

[0232] “C 1-6 "Halogenated alkyl" refers to the above "C 1-6 "alkyl" is substituted with one or more halogen groups. In some embodiments, C 1-4 Halogenated alkyl groups are particularly preferred, and C4 groups are more preferred. 1-2 Halogenated alkyl groups. Exemplary alkyl halogenated groups include, but are not limited to: -CF3, -CH2F, -CHF2, -CHFCH2F, -CH2CHF2, -CF2CF3, -CCl3, -CH2Cl, -CHCl2, 2,2,2-trifluoro-1,1-dimethyl-ethyl, etc. The alkyl halogenated group can be substituted at any available connection point, for example, 1 to 5 substituents, 1 to 3 substituents, or 1 substituent.

[0233] “C 1-6 "Alkylene" refers to the removal of C 1-6 The alkyl group is a divalent group formed by another hydrogen atom, and can be substituted or unsubstituted. In some embodiments, C 1-4 Alkylene, C 2-4 Alkylene and C 1-2Alkylenes are preferred. Unsubstituted alkylenes include, but are not limited to: methylene (-CH2-), ethylene (-CH2CH2-), propylene (-CH2CH2CH2-), butylene (-CH2CH2CH2CH2-), pentylene (-CH2CH2CH2CH2CH2-), hexylene (-CH2CH2CH2CH2CH2-), and so on. Exemplary substituted alkylene groups, for example, alkylene groups substituted with one or more alkyl (methyl) groups, include, but are not limited to: substituted methylene (-CH(CH3)-, -C(CH3)2-), substituted ethylene (-CH(CH3)CH2-, -CH2CH(CH3)-, -C(CH3)2CH2-, -CH2C(CH3)2-), substituted propylene (-CH(CH3)CH2CH2-, -CH2CH(CH3)CH2-, -CH2CH2CH(CH3)-, -C(CH3)2CH2CH2-, -CH2C(CH3)2CH2-, -CH2CH2C(CH3)2-), etc.

[0234] As used in this disclosure, the terms “treatment,” “management,” etc., refer to the administration of a drug or the performance of a procedure to achieve an effect. These effects may be preventative in terms of the complete or partial prevention of a disease or its symptoms, and / or therapeutic in terms of the partial or complete cure of a disease and / or its symptoms. As used in this disclosure, “treatment” may include treating a disease or condition (e.g., cancer) in mammals, particularly humans, and includes: (a) preventing the occurrence of the disease or its symptoms in subjects susceptible to the disease but not yet diagnosed with it (e.g., including diseases that may be related to or caused by the primary disease); (b) suppressing the disease, i.e., halting its development; and (c) alleviating the disease, i.e., causing its regression. Treatment may refer to any indication of success in treating or improving or preventing cancer, including any objective or subjective parameter, such as elimination; relief; reduction of symptoms or making the disease condition more tolerable for the patient; slowing the rate of deterioration or decline; or weakening the endpoint of deterioration. Treatment or improvement of symptoms is based on one or more objective or subjective parameters; including the results of a physician’s examination. Therefore, the term "treatment" includes the administration of the siRNA or pharmaceutical composition disclosed in this disclosure to prevent or delay, alleviate or stop or inhibit the development of symptoms or conditions associated with a disease (e.g., cancer). The term "therapeutic effect" refers to the reduction, elimination or prevention of disease, disease symptoms or disease side effects in a subject.

[0235] As used in this disclosure, the term "therapeutic effective amount" means an amount sufficient to treat a disease when administered to a subject for the purpose of treating that disease.

[0236] As used herein, the term “subject” refers to any mammalian subject for diagnosis, treatment, or therapy. For therapeutic purposes, “mammal” means any animal classified as a mammal, including humans, livestock, and laboratory animals, zoo animals, sporting animals, or pet animals, such as dogs, horses, cats, cattle, sheep, goats, pigs, mice, rats, rabbits, guinea pigs, monkeys, etc.

[0237] I.siRNA

[0238] This disclosure provides a small interfering RNA (siRNA) for inhibiting the expression of angiopoietin-like 3 (ANGPTL3) in cells, the siRNA comprising a sense strand and an antisense strand forming a double-stranded region, wherein the length of the sense strand and the antisense strand is each independently 15-30 nucleotides, and the antisense strand comprises a nucleotide sequence of at least 15 consecutive nucleotides of the nucleotide sequence shown in any one of SEQ ID NO: 16-29.

[0239] In some implementations, the bistranded regions formed by the sense and antisense strands are completely complementary. In other implementations, the bistranded regions formed by the sense and antisense strands are substantially complementary, and may contain one, two, three, four, or five non-complementary sites.

[0240] In some specific embodiments, the positive chain comprises a nucleotide sequence of at least 15 consecutive nucleotides of the nucleotide sequence shown in any one of SEQ ID NO: 1-14.

[0241] In some implementations, the lengths of the sense strand and the antisense strand are each independently 17-27 nucleotides, preferably 19-25 nucleotides, and more preferably 19-23 nucleotides.

[0242] In some embodiments, the length of the double-stranded region is 15-25 nucleotide pairs, preferably 17-23 nucleotide pairs, and more preferably 19-21 nucleotide pairs.

[0243] One or both of the positive and negative strands comprise a 3' overhang and / or a 5' overhang of at least one nucleotide, for example, one or both of the positive and negative strands comprise a 3' overhang and / or a 5' overhang of at least one nucleotide. In some preferred embodiments, the negative strand has a 3' overhang and / or a 5' overhang of at least two nucleotides, preferably the negative strand comprises a 3' overhang and / or a 5' overhang of two nucleotides. In some embodiments, the positive and negative strands are of the same length. In some embodiments, the full length of the positive strand is complementary to the full length of the negative strand, forming a double strand, i.e., having blunt ends. In other embodiments, the positive and negative strands are of the same length, with a portion of the positive strand complementary to a portion of the negative strand, i.e., both the positive and negative strands have a 5' overhang. In some embodiments, the positive and negative strands are of different lengths. In a preferred embodiment, the 5' end of the negative strand has an overhang of at least one nucleotide, more preferably an overhang of two or three nucleotides.

[0244] In some embodiments, the antisense strand comprises a nucleotide sequence of at least 16 consecutive nucleotides, at least 17 consecutive nucleotides, at least 18 consecutive nucleotides, at least 19 consecutive nucleotides, or at least 20 consecutive nucleotides of the nucleotide sequence shown in any one of SEQ ID NO: 16-29. Preferably, the antisense strand comprises a nucleotide sequence shown in any one of SEQ ID NO: 16-29.

[0245] In some embodiments, the sense strand comprises a nucleotide sequence of at least 16 consecutive nucleotides, at least 17 consecutive nucleotides, at least 18 consecutive nucleotides, at least 19 consecutive nucleotides, or at least 20 consecutive nucleotides of any of the nucleotide sequences shown in SEQ ID NO: 1-14. Preferably, the antisense strand comprises a nucleotide sequence shown in any of SEQ ID NO: 1-1093.

[0246] In some implementations, the siRNA comprises paired sense and antisense sequences as shown in Table 3.

[0247] II. Nucleotide Modification

[0248] In some embodiments, substantially all nucleotides of the sense strand and substantially all nucleotides of the antisense strand are modified nucleotides. In some embodiments, at least 80% of the nucleotides of the sense strand are modified nucleotides, and / or at least 80% of the nucleotides of the antisense strand are modified nucleotides.

[0249] In some implementations, all nucleotides of the sense strand and / or all nucleotides of the antisense strand are modified nucleotides.

[0250] The modification of nucleotides described in this disclosure can be a modification of the phosphate group, ribose group and / or base group of the nucleotide.

[0251] In some specific embodiments, the sense strand and the antisense strand each independently comprise one or more nucleotide modifications selected from the group consisting of: 2′-O-methyl modified nucleotides, 2′-fluoro modified nucleotides, 2′-deoxy-modified nucleotides, inosine ribonucleotides, baseless nucleotides, reverse baseless deoxyribonucleotides, thiophosphate nucleotide-linked modifications, vinylphosphonate modified nucleotides, locked nucleotides, 2′-amino-modified nucleotides, 2′-alkyl-modified nucleotides, morpholinonucleotides, aminophosphates, non-natural bases containing nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid didecanoic acid didecylamide groups, deoxyribonucleotides, and STM1.

[0252] In some preferred embodiments, the sense strand and the antisense strand each independently comprise one or more nucleotide modifications selected from the group consisting of: 2′-O-methyl modified nucleotides, 2′-fluoro modified nucleotides, reverse abase-free deoxyribonucleotides, and phosphate thioester nucleotide inter-linking modifications. In some preferred embodiments, the sense strand and / or the antisense strand comprises at least two 2′-fluoro modified nucleotides. In some preferred embodiments, the sense strand and / or the antisense strand comprises at least eight 2′-O-methyl modified nucleotides. In some preferred embodiments, the 3′ and / or 5′ ends of the sense strand and / or the antisense strand comprise 1-5 phosphate thioester groups, preferably 2-3 phosphate thioester groups. In some preferred embodiments, the sense strand and / or the antisense strand comprises adenine deoxyribonucleotide, thymine deoxyribonucleotide, guanine deoxyribonucleotide, and / or cytosine deoxyribonucleotide. In a more preferred embodiment, the sense strand and / or antisense strand comprises thymine deoxyribonucleotide. In the most preferred embodiment, the sense strand comprises thymine deoxyribonucleotide.

[0253] In some preferred embodiments, the antisense strand comprises a modified nucleotide sequence shown in any of Table 5 of the specification, and / or the sense strand comprises a modified nucleotide sequence shown in any of Table 4 of the specification. In some preferred embodiments, the siRNA comprises a paired modified sense strand sequence and a modified antisense strand sequence shown in any of Table 6 of the specification.

[0254] III. Ligands

[0255] The siRNA described in this disclosure is further conjugated to a ligand portion comprising N-acetylgalactosamine. In a preferred embodiment, the positive strand of the siRNA is conjugated to the ligand portion. In some preferred embodiments, the 3' end of the positive strand is conjugated to the ligand portion. In other preferred embodiments, the 5' end of the positive strand is conjugated to the ligand portion.

[0256] In some embodiments, the ligand moiety comprises a conjugating group represented by formula (X'):

[0257]

[0258] in,

[0259] Indicates the location where it connects to a biomolecule;

[0260] Q is independent of H,

[0261] Where L1 is a chemical bond, -CH2-, -CH2CH2-, -C(O)-, -CH2O-, -CH2O-CH2CH2O-, or -NHC(O)-(CH2NHC(O)). a -;

[0262] L2 is a chemical bond or -CH2CH2C(O)-;

[0263] L3 is a chemical bond, -(NHCH2CH2) b -、-(NHCH2CH2CH2) b -or-C(O)CH2-;

[0264] L4 is -(OCH2CH2) c -、-(OCH2CH2CH2) c -、-(OCH2CH2CH2CH2) c -、-(OCH2CH2CH2CH2CH2) c -or -NHC(O)-(CH2) d -;

[0265] Where a = 0, 1, 2 or 3;

[0266] b = 1, 2, 3, 4 or 5;

[0267] c = 1, 2, 3, 4 or 5;

[0268] d = 1, 2, 3, 4, 5, 6, 7 or 8;

[0269] L represents a chemical bond, -CH2O- or -NHC(O)-;

[0270] L' represents a chemical bond, -C(O)NH-, -NHC(O)-, or -O(CH2CH2O). e -;

[0271] Where e is 1, 2, 3, 4 or 5;

[0272] T represents a chemical bond, -CH2-, -C(O)-, -M-, -CH2-M-, or -C(O)-M-;

[0273] Where M is

[0274] R1 and R2 together form -CH2CH2O- or -CH2CH(R)-O-, and R3 is H;

[0275] Or R1 and R3 together form -C 1-2 Alkylene-, and R2 is H;

[0276] Wherein R is -OR', -CH2OR' or -CH2CH2OR', where R' is H, a hydroxyl protecting group or a solid support, and the hydroxyl protecting group is preferably -C(O)CH2CH2C(O)OH or 4,4′-dimethoxytriphenylmethyl;

[0277] m = 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10;

[0278] n = 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

[0279] In some embodiments, the conjugating group is as shown in formula (I'):

[0280]

[0281] in,

[0282] Indicates the location where it connects to a biomolecule;

[0283] Q is independent of H,

[0284] Where L1 is a chemical bond, -CH2-, -CH2CH2-, -C(O)-, -CH2O-, -CH2O-CH2CH2O-, or -NHC(O)-(CH2NHC(O)). a -;

[0285] L2 is a chemical bond or -CH2CH2C(O)-;

[0286] L3 is a chemical bond, -(NHCH2CH2) b -、-(NHCH2CH2CH2) b -or-C(O)CH2-;

[0287] L4 is -(OCH2CH2) c -、-(OCH2CH2CH2) c -、-(OCH2CH2CH2CH2) c -、-(OCH2CH2CH2CH2CH2) c -or -NHC(O)-(CH2) d -;

[0288] Where a = 0, 1, 2 or 3;

[0289] b = 1, 2, 3, 4 or 5;

[0290] c = 1, 2, 3, 4 or 5;

[0291] d = 1, 2, 3, 4, 5, 6, 7 or 8;

[0292] L is either -CH2O- or -NHC(O)-;

[0293] L' is a chemical bond, -C(O)NH- or -NHC(O)-;

[0294] R1 and R2 together form -CH2CH2O- or -CH2CH(R)-O-, and R3 is H;

[0295] Or R1 and R3 together form -C 1-2 Alkylene-, and R2 is H;

[0296] Wherein R is -OR', -CH2OR' or -CH2CH2OR', where R' is H, a hydroxyl protecting group or a solid support, and the hydroxyl protecting group is preferably -C(O)CH2CH2C(O)OH or 4,4′-dimethoxytriphenylmethyl;

[0297] m = 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10;

[0298] n = 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

[0299] In some specific implementation plans, where,

[0300] Q is independently of H or

[0301] Where L1 is either -CH2O- or -NHC(O)-(CH2NHC(O))a -;

[0302] L2 is -CH2CH2C(O)-;

[0303] L3 is -(NHCH2CH2) b -or-(NHCH2CH2CH2) b -;

[0304] L4 is -(OCH2CH2) c -or -NHC(O)-(CH2) d -;

[0305] Where a = 0, 1, 2 or 3;

[0306] b = 1, 2, 3, 4 or 5;

[0307] c = 1, 2, 3, 4 or 5;

[0308] d = 1, 2, 3, 4, 5, 6, 7 or 8;

[0309] L stands for -CH2O-;

[0310] L' is a chemical bond;

[0311] R1 and R2 together form -CH2CH2O- or -CH2CH(R)-O-, and R3 is H;

[0312] Or R1 and R3 together form -C 1-2 Alkylene-, and R2 is H;

[0313] Wherein R is -OR', -CH2OR' or -CH2CH2OR', where R' is H, a hydroxyl protecting group or a solid support, and the hydroxyl protecting group is preferably -C(O)CH2CH2C(O)OH or 4,4′-dimethoxytriphenylmethyl;

[0314] m = 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10;

[0315] n = 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

[0316] In some embodiments, the conjugating group is as shown in formula (I'-1), formula (I'-2), or formula (I'-3):

[0317]

[0318] in,

[0319] Indicates the location where it connects to a biomolecule;

[0320] Q is

[0321] Where L1 is -CH2O- or -NHC(O)-;

[0322] L2 is -CH2CH2C(O)-;

[0323] L3 is -(NHCH2CH2) b -or-(NHCH2CH2CH2) b -;

[0324] L4 is -(OCH2CH2) c -or -NHC(O)-(CH2) d -;

[0325] Where b = 1, 2, 3, 4 or 5;

[0326] c = 1, 2, 3, 4 or 5;

[0327] d = 1, 2, 3, 4, 5, 6, 7 or 8;

[0328] L stands for -CH2O-;

[0329] R' is H, a hydroxyl protecting group, or a solid support, wherein the hydroxyl protecting group is preferably -C(O)CH2CH2C(O)OH or 4,4′-dimethoxytriphenylmethyl;

[0330] n = 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

[0331] In some specific implementation plans, where,

[0332] Q is independent of H,

[0333] Where L1 is -CH2O-, -CH2O-CH2CH2O-, or -NHC(O)-(CH2NHC(O)) a -;

[0334] L2 is -CH2CH2C(O)-;

[0335] L3 is -(NHCH2CH2) b -、-(NHCH2CH2CH2) b -or-C(O)CH2-;

[0336] L4 is -(OCH2CH2) c -or -NHC(O)-(CH2) d-;

[0337] Where a = 0, 1, 2 or 3;

[0338] b = 1, 2, 3, 4 or 5;

[0339] c = 1, 2, 3, 4 or 5;

[0340] d = 1, 2, 3, 4, 5, 6, 7 or 8;

[0341] L is either -CH2O- or -NHC(O)-;

[0342] L' represents a chemical bond or -C(O)NH-;

[0343] R1 and R2 together form -CH2CH2O- or -CH2CH(R)-O-, and R3 is H;

[0344] Or R1 and R3 together form -C 1-2 Alkylene-, and R2 is H;

[0345] Wherein R is -OR', -CH2OR' or -CH2CH2OR', where R' is H, a hydroxyl protecting group or a solid support, and the hydroxyl protecting group is preferably -C(O)CH2CH2C(O)OH or 4,4′-dimethoxytriphenylmethyl;

[0346] m = 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10;

[0347] n = 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

[0348] In some embodiments, the conjugating group is as shown in formula (II'-1) or formula (II'-2):

[0349]

[0350] in,

[0351] Indicates the location where it connects to a biomolecule;

[0352] Q independently for

[0353] Where L1 is -CH2O- or -CH2O-CH2CH2O-;

[0354] L3 is -(NHCH2CH2) b -、-(NHCH2CH2CH2) b -or-C(O)CH2-;

[0355] L4 is -(OCH2CH2) c -or -NHC(O)-(CH2) d -;

[0356] Where b = 1, 2, 3, 4 or 5;

[0357] c = 1, 2, 3, 4 or 5;

[0358] d = 1, 2, 3, 4, 5, 6, 7 or 8;

[0359] L is -NHC(O)-;

[0360] L represents a chemical bond or -C(O)NH-;

[0361] R' is H, a hydroxyl protecting group, or a solid support, wherein the hydroxyl protecting group is preferably -C(O)CH2CH2C(O)OH or 4,4′-dimethoxytriphenylmethyl;

[0362] m = 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10;

[0363] n = 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

[0364] In some specific implementation plans, where,

[0365] Q is independent of H,

[0366] Where L1 is -CH2-, -C(O)-, -CH2O-, -CH2O-CH2CH2O-, or -NHC(O)-(CH2NHC(O)) a -;

[0367] L2 is a chemical bond;

[0368] L3 is -(NHCH2CH2) b -、-(NHCH2CH2CH2) b -or-C(O)CH2-;

[0369] L4 is -(OCH2CH2) c -or -NHC(O)-(CH2) d -;

[0370] Where a = 0, 1, 2 or 3;

[0371] b = 1, 2, 3, 4 or 5;

[0372] c = 1, 2, 3, 4 or 5;

[0373] d = 1, 2, 3, 4, 5, 6, 7 or 8;

[0374] L is either -CH2O- or -NHC(O)-;

[0375] L' represents a chemical bond or -C(O)NH-;

[0376] R1 and R2 together form -CH2CH2O- or -CH2CH(R)-O-, and R3 is H;

[0377] Or R1 and R3 together form -C 1-2 Alkylene-, and R2 is H;

[0378] Wherein R is -OR', -CH2OR' or -CH2CH2OR', where R' is H, a hydroxyl protecting group or a solid support, and the hydroxyl protecting group is preferably -C(O)CH2CH2C(O)OH or 4,4′-dimethoxytriphenylmethyl;

[0379] m = 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10;

[0380] n = 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

[0381] In some embodiments, the conjugated group is as shown in formula (II'-2):

[0382]

[0383] in,

[0384] Indicates the location where it connects to a biomolecule;

[0385] Q independently for

[0386] Where L1 is -CH2- or -C(O)-;

[0387] L3 is -(NHCH2CH2) b -;

[0388] L4 is -(OCH2CH2) c -;

[0389] Where b = 1, 2, 3, 4 or 5;

[0390] c = 1, 2, 3, 4 or 5;

[0391] L is either -CH2O- or -NHC(O)-;

[0392] R' is H, a hydroxyl protecting group, or a solid support, wherein the hydroxyl protecting group is preferably -C(O)CH2CH2C(O)OH or 4,4′-dimethoxytriphenylmethyl;

[0393] n = 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

[0394] In some specific implementation schemes, where:

[0395] Q is independent of H,

[0396] Where L1 is a chemical bond, -CH2-, -CH2CH2-, -C(O)-, -CH2O-, -CH2O-CH2CH2O-, or -NHC(O)-(CH2NHC(O)). a -;

[0397] L2 is a chemical bond or -CH2CH2C(O)-;

[0398] L3 is a chemical bond, -(NHCH2CH2) b -、-(NHCH2CH2CH2) b -or-C(O)CH2-;

[0399] L4 is -(OCH2CH2) c -、-(OCH2CH2CH2) c -、-(OCH2CH2CH2CH2) c -、-(OCH2CH2CH2CH2CH2) c -or -NHC(O)-(CH2) d -;

[0400] Where a = 0, 1, 2 or 3;

[0401] b = 1, 2, 3, 4 or 5;

[0402] c = 1, 2, 3, 4 or 5;

[0403] d = 1, 2, 3, 4, 5, 6, 7 or 8;

[0404] L represents a chemical bond, -CH2O- or -NHC(O)-;

[0405] L' represents a chemical bond, -C(O)NH-, -NHC(O)-, or -O(CH2CH2O). e -;

[0406] Where e is 1, 2, 3, 4 or 5;

[0407] T represents a chemical bond, -CH2-, -M-, -CH2-M-, or -C(O)-M-;

[0408] Where M is

[0409] R1 and R2 together form -CH2CH2O- or -CH2CH(R)-O-, and R3 is H;

[0410] Or R1 and R3 together form -C 1-2 Alkylene-, and R2 is H;

[0411] Wherein R is -OR', -CH2OR' or -CH2CH2OR', where R' is H, a hydroxyl protecting group or a solid support, and the hydroxyl protecting group is preferably -C(O)CH2CH2C(O)OH or 4,4′-dimethoxytriphenylmethyl;

[0412] m = 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10;

[0413] n = 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

[0414] In some specific implementation plans, where,

[0415] T is -M-, -CH2-M-, or -C(O)-M-, where M is

[0416] In some specific implementation plans, where,

[0417] Q is independently of H or

[0418] Where L1 is either -CH2O- or -NHC(O)-(CH2NHC(O)) a -;

[0419] L2 is -CH2CH2C(O)-;

[0420] L3 is -(NHCH2CH2) b -or-(NHCH2CH2CH2) b -;

[0421] L4 is -(OCH2CH2) c -or -NHC(O)-(CH2) d -;

[0422] Where a = 0, 1, 2 or 3;

[0423] b = 1, 2, 3, 4 or 5;

[0424] c = 1, 2, 3, 4 or 5;

[0425] d = 1, 2, 3, 4, 5, 6, 7 or 8;

[0426] L represents a chemical bond or -CH2O-;

[0427] L' represents a chemical bond or -O (CH2CH2O). e -;

[0428] Where e is 1, 2, 3, 4 or 5;

[0429] R1 and R2 together form -CH2CH2O- or -CH2CH(R)-O-, and R3 is H;

[0430] Or R1 and R3 together form -C 1-2 Alkylene-, and R2 is H;

[0431] Wherein R is -OR', -CH2OR' or -CH2CH2OR', where R' is H, a hydroxyl protecting group or a solid support, and the hydroxyl protecting group is preferably -C(O)CH2CH2C(O)OH or 4,4′-dimethoxytriphenylmethyl;

[0432] m = 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10;

[0433] n = 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10;

[0434] Where T is as defined in the above implementation scheme.

[0435] In some embodiments, the conjugated group is as shown in formula (III'-1), formula (III'-2), or formula (III'-3):

[0436]

[0437] in,

[0438] Q is

[0439] Where L1 is -CH2O- or -NHC(O)-;

[0440] L2 is -CH2CH2C(O)-;

[0441] L3 is -(NHCH2CH2) b -or-(NHCH2CH2CH2) b -;

[0442] L4 is -(OCH2CH2) c-or -NHC(O)-(CH2) d -;

[0443] Where b = 1, 2, 3, 4 or 5;

[0444] c = 1, 2, 3, 4 or 5;

[0445] d = 1, 2, 3, 4, 5, 6, 7 or 8;

[0446] L represents a chemical bond or -CH2O-;

[0447] Wherein R' is H, a hydroxyl protecting group, or a solid support, and the hydroxyl protecting group is preferably -C(O)CH2CH2C(O)OH or 4,4′-dimethoxytriphenylmethyl;

[0448] n = 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10;

[0449] Where T is as defined in the above implementation scheme.

[0450] In some specific implementation plans, where,

[0451] Q is independent of H,

[0452] Where L1 is -CH2-, -CH2O-, or -C(O)-;

[0453] L2 is a chemical bond;

[0454] L3 is -(NHCH2CH2) b -、-(NHCH2CH2CH2) b -or-C(O)CH2-;

[0455] L4 is -(OCH2CH2) c -or -NHC(O)-(CH2) d -;

[0456] Where b = 1, 2, 3, 4 or 5;

[0457] c = 1, 2, 3, 4 or 5;

[0458] d = 1, 2, 3, 4, 5, 6, 7 or 8;

[0459] L represents a chemical bond or -NHC(O)-;

[0460] L' is a chemical bond;

[0461] R1 and R2 together form -CH2CH2O- or -CH2CH(R)-O-, and R3 is H;

[0462] Or R1 and R3 together form -C 1-2 Alkylene-, and R2 is H;

[0463] Wherein R is -OR', -CH2OR' or -CH2CH2OR', where R' is H, a hydroxyl protecting group or a solid support, and the hydroxyl protecting group is preferably -C(O)CH2CH2C(O)OH or 4,4′-dimethoxytriphenylmethyl;

[0464] m = 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10;

[0465] n = 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10;

[0466] Where T is as defined in the above implementation scheme.

[0467] In some embodiments, the conjugating group is as shown in formula (IV-1) or formula (IV-2):

[0468]

[0469] in,

[0470] Q independently for

[0471] Where L1 is -CH2-, -CH2O-, or -C(O)-;

[0472] L3 is -(NHCH2CH2) b -、-(NHCH2CH2CH2) b -or-C(O)CH2-;

[0473] L4 is -(OCH2CH2) c -or -NHC(O)-(CH2) d -;

[0474] Where b = 1, 2, 3, 4 or 5;

[0475] c = 1, 2, 3, 4 or 5;

[0476] d = 1, 2, 3, 4, 5, 6, 7 or 8;

[0477] L represents a chemical bond or -NHC(O)-;

[0478] L' is a chemical bond;

[0479] Wherein R' is H, a hydroxyl protecting group, or a solid support, and the hydroxyl protecting group is preferably -C(O)CH2CH2C(O)OH or 4,4′-dimethoxytriphenylmethyl;

[0480] m = 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10;

[0481] n = 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10;

[0482] Where T is as defined in the above implementation scheme.

[0483] In some specific implementation schemes, where:

[0484] Q is independent of H,

[0485] Where L1 is a chemical bond, -CH2-, -CH2CH2-, -C(O)-, -CH2O-, -CH2O-CH2CH2O-, or -NHC(O)-(CH2NHC(O)). a -;

[0486] L2 is a chemical bond or -CH2CH2C(O)-;

[0487] L3 is a chemical bond, -(NHCH2CH2) b -、-(NHCH2CH2CH2) b -or-C(O)CH2-;

[0488] L4 is -(OCH2CH2) c -、-(OCH2CH2CH2) c -、-(OCH2CH2CH2CH2) c -、-(OCH2CH2CH2CH2CH2) c -or -NHC(O)-(CH2) d -;

[0489] Where a = 0, 1, 2 or 3;

[0490] b = 1, 2, 3, 4 or 5;

[0491] c = 1, 2, 3, 4 or 5;

[0492] d = 1, 2, 3, 4, 5, 6, 7 or 8;

[0493] L represents a chemical bond, -CH2O- or -NHC(O)-;

[0494] L' is -O(CH2CH2O) e -;

[0495] Where e is 1, 2, 3, 4 or 5;

[0496] T represents a chemical bond, -CH2-, -C(O)-, -M-, -CH2-M-, or -C(O)-M-;

[0497] Where M is

[0498] R1 and R2 together form -CH2CH2O- or -CH2CH(R)-O-, and R3 is H;

[0499] Or R1 and R3 together form -C 1-2 Alkylene-, and R2 is H;

[0500] Wherein R is -OR', -CH2OR' or -CH2CH2OR', where R' is H, a hydroxyl protecting group or a solid support, and the hydroxyl protecting group is preferably -C(O)CH2CH2C(O)OH or 4,4′-dimethoxytriphenylmethyl;

[0501] m = 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10;

[0502] n = 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

[0503] In some preferred embodiments, the conjugating group is selected from the following:

[0504]

[0505]

[0506]

[0507]

[0508] In some preferred embodiments, the conjugating group is selected from the following:

[0509]

[0510]

[0511]

[0512]

[0513]

[0514] In some implementations, the ligand targets the desialyl glycoprotein receptor (ASGPR).

[0515] In a preferred embodiment, the ligand has the following structure:

[0516]

[0517] in This indicates the position where the siRNA is attached to the positive strand via a phosphate group or a thiophosphate group.

[0518] In a preferred embodiment, the ligand has the following structure:

[0519]

[0520] in This indicates the position where the siRNA is attached to the positive strand via a phosphate group or a thiophosphate group.

[0521] In a preferred embodiment, the ligand has the following structure:

[0522]

[0523] in This indicates the position where the siRNA is attached to the positive strand of the siRNA via a phosphate ester group or a thiophosphate ester group.

[0524] In a preferred embodiment, the ligand has the following structure:

[0525]

[0526] in This indicates the position where the siRNA is attached to the positive strand of the siRNA via a phosphate ester group or a thiophosphate ester group.

[0527] IV. ANGPTL3 gene expression inhibition

[0528] The disclosed siRNA is capable of inhibiting ANGPTL3 gene expression by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.

[0529] Inhibition of ANGPTL3 gene expression can be manifested by a reduction in the amount of mRNA expressed by a first cell or cell group (such cells may be present, for example, in a sample derived from a subject), wherein the ANGPTL3 gene is transcribed and the cell or these cells have been treated (e.g., by contacting the cell or these cells with the siRNA disclosed herein, or by administering the siRNA disclosed herein to a subject in which such cells are present or previously present, such that ANGPTL3 gene expression is inhibited compared to a second cell or cell group (one or more control cells) that is substantially the same as the first cell or cell group but has not been treated in this way).

[0530] In a preferred embodiment, the inhibition is assessed by expressing the level of mRNA in the treated cells as a percentage of the level of mRNA in the control cells using the following formula. In some specific embodiments, 2 is calculated. -ΔΔCt The value is used to compare the difference between the experimental group and the control group, where ΔCt = [(Ct target gene in experimental group - Ct internal reference in experimental group) - (Ct target gene in control group - Ct internal reference in control group)].

[0531] Alternatively, inhibition of ANGPTL3 gene expression can be assessed in terms of a decrease in functionally related parameters such as lipid levels, cholesterol levels, or LDLc levels, to assess ANGPTL3 protein expression. ANGPTL3 gene silencing can be determined in any cell that expresses ANGPTL3 constitutively or through genome engineering and by any assay known in the art. The liver is a major site of ANGPTL3 expression. Other important expression sites include the pancreas, kidneys, and intestines.

[0532] Inhibition of ANGPTL3 protein expression can be manifested by a decrease in the level of ANGPTL3 protein expressed in cells or cell populations (e.g., the level of protein expressed in samples derived from the subject). As explained above regarding the assessment of mRNA repression, inhibition of protein expression levels in treated cells or cell populations can be similarly expressed as a percentage of the protein level in control cells or cell populations.

[0533] Control cells or cell populations that can be used to assess the inhibition of ANGPTL3 gene expression include cells or cell populations that have not yet been exposed to the siRNA disclosed herein. For example, such control cells or cell populations may be derived from individual subjects (e.g., human or animal subjects) prior to treatment with the siRNA.

[0534] V. Cells

[0535] This disclosure provides a cell containing the siRNA described herein, wherein the siRNA described herein is capable of being transcribed in the cell.

[0536] VI. Pharmaceutical Composition

[0537] This disclosure provides pharmaceutical compositions comprising the siRNA or cells described herein, and optionally pharmaceutically acceptable carriers or excipients.

[0538] As used in this article, "pharmaceutically acceptable" means compounds, materials, compositions, and / or dosage forms that, to the extent of proper medical judgment, are suitable for contact with the tissues of human and animal subjects without excessive toxicity, irritation, allergic reactions, or other problems or complications, and are commensurate with a reasonable benefit / risk ratio.

[0539] In this article, pharmaceutically acceptable carriers refer to drug carriers that facilitate the administration of siRNA or cells containing said siRNA to the human body and / or promote its absorption or efficacy. Examples include: diluents, excipients such as water, fillers such as starch and sucrose; binders such as cellulose derivatives, alginate, gelatin, and polyvinylpyrrolidone; humectants such as glycerin; disintegrants such as agar, calcium carbonate, and sodium bicarbonate; absorption enhancers such as quaternary ammonium compounds; surfactants such as hexadecyl alcohol; adsorbents such as kaolin and soap clay; and lubricants such as talc, calcium / magnesium stearate, and polyethylene glycol. Other excipients such as flavoring agents and sweeteners may also be added to the composition.

[0540] For example, a pharmaceutical composition containing the siRNA or cells described in this disclosure may contain a pharmaceutically acceptable diluent or a sustained-release matrix in which the siRNA described in this disclosure is embedded.

[0541] VIII. Reagent Kit

[0542] This disclosure provides a kit containing the siRNA or cells described herein.

[0543] This disclosure also provides kits for using the siRNAs described herein and / or performing the methods of this disclosure. Such kits comprise one or more siRNAs or cells described herein, and may further include instructions for use. These instructions may describe methods for inhibiting ANGPTL3 expression in cells by contacting the cells with the siRNAs described herein to effectively inhibit ANGPTL3 expression.

[0544] In the case of in vitro contact between the siRNA described in this disclosure and cells, the kit of this disclosure may optionally include a tool (e.g., an injection device) for contacting cells with the siRNA described in this disclosure or a tool for measuring the inhibitory effect of ANGPTL3 (e.g., a device for measuring the inhibition of ANGPTL3 mRNA or protein). Such a device for measuring the inhibition of ANGPTL3 may include a means for obtaining a sample (e.g., a plasma sample) from a subject.

[0545] When administering the siRNA described in this disclosure or cells that have already been introduced into the body in vitro, the kit of this disclosure may optionally include a means for administering the siRNA or cells described in this disclosure to a subject or a means for determining a therapeutically effective amount or a preventatively effective amount.

[0546] IX. Treatment methods and pharmaceutical uses

[0547] This disclosure provides a method for reducing ANGPTL3 levels, LDL levels, apoC-III levels, triglyceride levels, cholesterol levels, glucose levels, and fat pad weight in a subject, the method comprising administering the siRNA, cells, or pharmaceutical composition described in this disclosure to the subject.

[0548] This disclosure provides a method for treating a disease or symptom associated with ANGPTL3 expression in a subject, the method comprising administering to the subject the siRNA, cells, or pharmaceutical composition described in this disclosure.

[0549] In some embodiments, the disease associated with ANGPTL3 expression is a cardiovascular disease. In some preferred embodiments, the cardiovascular disease is selected from obesity, diabetes, atherosclerosis, dyslipidemia, coronary heart disease, non-alcoholic fatty liver disease (NAFLD), hyperfatty acidemia, or metabolic syndrome, or a combination thereof.

[0550] In some embodiments, the ANGPTL3 expression-related disease is a lipid disorder, specifically hyperlipidemia. In some embodiments, hyperlipidemia is hypercholesterolemia, hypertriglyceridemia, or a combination thereof.

[0551] In some implementations, the disease associated with ANGPTL3 expression is NAFLD, which is hepatic steatosis or steatohepatitis.

[0552] In some implementations, the disease associated with ANGPTL3 expression is diabetes, specifically type 2 diabetes or type 2 diabetes with dyslipidemia.

[0553] In some embodiments, the method of treating a subject with a disease or symptom associated with ANGPTL3 expression according to this disclosure includes administering the siRNA or pharmaceutical composition to the subject, including subcutaneous or intravenous administration. In some embodiments, the subject is a human patient.

[0554] This disclosure also relates to the siRNA, cell, or pharmaceutical composition described herein for the treatment of diseases or symptoms associated with ANGPTL3 expression in subjects.

[0555] This disclosure also relates to the use of the siRNA, cells, or pharmaceutical compositions described herein in the preparation of a medicament for treating diseases or symptoms associated with ANGPTL3 expression in a subject. The medicaments of this disclosure can be formulated as emulsions, microemulsions, or microparticles.

[0556] sequence

[0557] The RNA sequence disclosed herein targets the human ANGPTL3 gene (or target gene, target mRNA sequence, target sequence).

[0558] Table 3. Nucleotide sequences of the sense and antisense strands targeting the ANGPTL3 gene.

[0559]

[0560] Tables 4 to 6 show the modified RNA sequences used in this disclosure.

[0561] The meanings of the abbreviations in this article are as follows:

[0562] The distributions A, U, G, and C represent naturally occurring adenine ribonucleotides, uracil ribonucleotides, guanine ribonucleotides, and cytosine ribonucleotides.

[0563] The 'd' indicates that the nucleotide adjacent to its right is a deoxyribonucleotide. For example, dA, dT, dG, and dC represent adenine deoxyribonucleotide, thymine deoxyribonucleotide, guanine deoxyribonucleotide, and cytosine deoxyribonucleotide, respectively.

[0564] i represents inosine ribonucleotide.

[0565] The 'm' indicates that the nucleotide adjacent to it on the left is a nucleotide modified with 2'-OCH3. For example, Am, Um, Gm, and Cm represent A, U, G, and C modified with 2'-OCH3.

[0566] The 'f' indicates that the nucleotide adjacent to it on the left is a 2'-F modified nucleotide. For example, Af, Uf, Gf, and Cf represent 2'-F modified A, U, G, and C, respectively.

[0567] “s” or “s-” indicates that the two adjacent nucleotides and / or delivery carriers are linked by a phosphate thioester.

[0568] VP indicates that the nucleotide adjacent to its right is a vinylphosphonate-modified nucleotide, which is well known in the art, and can be found in, for example, PCT publications WO2011139702, WO2013033230 and WO2019105419.

[0569] IB stands for inverted abase-free deoxyribonucleotide, which can include the following three structures depending on its position / linking method in siRNA (used for the 5' end, middle, and 3' end of the nucleic acid chain, respectively):

[0570]

[0571] IB is well known in the art, see, for example, F. Czaudema, Nucleic Acids Res., 2003, 31(11), 2705-16 and PCT Publications WO2016011123 and WO2019051402.

[0572] L96 represents a GalNAc delivery vector with the following structure well known in the art, wherein... The location indicated by the phosphate ester group or thiophosphate ester group linked to siRNA can be found, for example, in PCT publications WO2009073809 and WO2009082607.

[0573]

[0574] NAG37 represents a GalNAc delivery vector with the following structure, well known in the art, wherein... For the location indicated by the phosphate ester group or thiophosphate ester group attached to the siRNA, see, for example, PCT Publication No. WO2018044350.

[0575]

[0576] GL6 represents the GalNAc delivery vector with the following structure, where Indicates the position where the phosphate ester group or thiophosphate ester group is attached to the siRNA.

[0577]

[0578] GL12 represents the GalNAc delivery vector with the following structure, where Indicates the position where the phosphate ester group or thiophosphate ester group is attached to the siRNA.

[0579]

[0580] STM1 represents a nucleotide substitution for the following structure. Depending on the position of STM1 in the nucleic acid chain, It can be linked to adjacent nucleotides, 3' end structures, or 5' end structures.

[0581]

[0582] Table 4. Sensitive strand sequences of modified siRNAs targeting the ANGPTL3 gene.

[0583]

[0584]

[0585] Table 5. Modified siRNA antisense strand sequences targeting the ANGPTL3 gene.

[0586]

[0587]

[0588] Table 6. Paired siRNAs targeting the ANGPTL3 gene: sense and antisense strands.

[0589]

[0590] Example

[0591] Unless otherwise specified, the materials used in the embodiments are from the following sources:

[0592] Huh7 cell line was purchased from Nanjing Kebai, catalog number CBP60202;

[0593] Hep3B cell line was purchased from Nanjing Kebai, catalog number CBP60197;

[0594] PHH cells were purchased from Shanghai Xuanyi, catalog number QYLF-HPMC;

[0595] HEK293A cell line was purchased from Nanjing Kebai, catalog number CBP60436;

[0596] Balb / c mice were obtained from Zhejiang Vital River Pharmaceutical Co., Ltd., catalog number Balb / c.

[0597] Example 1: Preparation of compound E7

[0598] 1. Preparation of intermediate 3-4

[0599] 1.1 Preparation of compound 2

[0600]

[0601] At 15 °C, benzyl (2,5-dioxopyrrolidone-1-yl) carbonate (600 g, 2.40 mol) was slowly added to 1.80 L of DCM containing compound 1 (300 g, 2.01 mol), followed by dropwise addition of TEA (203 g, 2.01 mol, 280 mL). After addition, the mixture was stirred at 25 °C for 16 hours. TLC (dichloromethane:methanol = 10:1) showed that reactant 1 (R... f =0.32) was retained and an important new point (R) was detected. f =0.52). The reaction mixture (1.00 L x 2) was washed with saturated sodium bicarbonate solution, the organic phase was washed with brine (1.00 L), dried over anhydrous Na2SO4, and concentrated under vacuum. Without purification, compound 2 (about 385 g) was a yellow oil.

[0602] 1.2 Preparation of compound 2A

[0603]

[0604] At 0–15 °C, DMAP (19.8 g, 162 mmol) was added in a single addition to a solution of compound 4 (350 g, 1.62 mol, HCl) and Ac₂O (994 g, 9.74 mol, 912 mL) in pyridine (1.75 L), followed by dropwise addition of TEA (164 g, 1.62 mol, 226 mL). The mixture was stirred at 25 °C for 16 h. LCMS (product: RT = 0.687 min) showed complete consumption of the initial reactants. EtOAc (1.40 L) was added to the mixture at 25 °C and stirred for 30 min, followed by filtration and washing of the filter cake with EtOAc (300 mL). The filter cake was then ground with water (1.45 L) at 25 °C for 30 min. The mixture was filtered and the filter cake was washed with water (175 mL x 3), and the filter cake was collected to obtain compound 2A (approximately 580 g) as a white solid.

[0605] 1.3 Preparation of Compound 2B

[0606]

[0607] The three reactions proceeded in parallel.

[0608] TMSOTf (137 g, 616 mmol, 111 mL) was added dropwise to a DCM (800 mL) solution of compound 2A (200 g, 514 mmol) at 10–15 °C over 0.5 hours. The mixture was then stirred at 25 °C for 3 hours. TLC (dichloromethane:methanol = 20:1) showed that compound 2A (R...f =0.54) completely consumed and new point (R) f =0.24) was formed. The three reactions were combined. The mixture was cooled to 0-15°C and slowly poured into a solution of NaHCO3 (300 g dissolved in 3.00 L of water) at 0-5°C. The organic phase was separated and the aqueous phase was extracted with DCM (1.00 L x 3). The organic layers were combined, dried with Na2SO4, filtered, and concentrated under vacuum. Without purification, a yellow oily compound 2B (approximately 507 g) was obtained for the next step.

[0609] 1.4 Preparation of compound 3

[0610]

[0611] TMSOTf (84.4 g, 380 mmol, 69.0 mL) was added dropwise to a mixture of compound 2B (250 g, 759 mmol) and compound 2 (151 g, 531 mmol) in DCM (1.00 L) at 0–10 °C, and the mixture was stirred at 20 °C for 12 hours. TLC (dichloromethane:methanol = 20:1) showed that compound 2 (R) f =0.33) completely consumed and formed a new point (R) f =0.03). The combined reactants were cooled to 0-5°C, then poured into NaHCO3 (aqueous solution, 100g dissolved in 1L water) and stirred at 5-10°C for 10 minutes to separate the phases. The aqueous phase was extracted using DCM (500mL x 2), the combined organic phases were dried over Na2SO4, filtered, and the filtrate was concentrated under vacuum. Without purification, compound 3 (approximately 360g) was a yellow oil.

[0612] 1 H NMR: (400MHz, DMSO).

[0613] δ=7.79-7.37 (m, 1H), 7.35-7.26 (m, 5H), 5.21-5.20 (m, 1H), 5.00-4.95 (m, 3H), 4.55-4.53 (m, 1H), 4.03-3.86 (m, 3H), 3.61-3.59 (m, 1H) , 3.59-3.57(m, 1H), 3.48-3.40(m, 6H), 3.39-3.31(m, 2H), 3.14-3.13(m, 2H), 2.09(s, 3H), 1.99(s, 3H), 1.88(s, 3H), 1.76-1.74(m, 3H).

[0614] 1.5 Preparation of intermediate 3-4 (TFA salt)

[0615]

[0616] The three reactions proceeded in parallel.

[0617] Compound 3 (180 g, 293 mmol) and TFA (33.5 g, 293 mmol, 21.8 mL) were added to a mixture of Pd / C (18.0 g, 16.3 mmol, 10% purity) in THF (1.80 L) under an argon atmosphere. The suspension was vented and purged three times with hydrogen. The mixture was stirred for 2 hours at H2 (50 Psi) and 30 °C. LCMS (product: RT = 0.697 min) showed the consumption of compound 3 and detected a product peak. The three reactions were combined. The mixture was filtered through a celite filter, and the filtrate was concentrated under reduced pressure to remove the solvent. Without purification, intermediate 3-4 (TFA salt) was given as a yellow solid (393 g, 660 mmol, 74.8% yield, 99.6% purity, TFA).

[0618] 1 H NMR: (400MHz, DMSO-d6)

[0619] δ=7.92(d, J=9.1Hz, 4H), 5.27-5.17(m, 1H), 5.03-4.91(m, 1H), 4.60-4.50(m, 1H), 4.09-3.97(m, 4H), 3.85(s , 2H), 3.65-3.46(m, 10H), 3.04-2.92(m, 2H), 2.10(s, 3H), 2.00(s, 3H), 1.94-1.86(m, 3H), 1.82-1.71(m, 4H).

[0620] 2. Preparation of intermediate 3-5

[0621] 2.1 Preparation of compound 5

[0622]

[0623] DIEA (30.3 g, 234 mmol, 40.8 mL, 6.60 eq) was added in a single batch to a DCM (1.00 L) solution of compound 4B (10.0 g, 35.5 mmol, 1.00 eq) and the previously prepared compounds 3-4 (46.3 g, 78.2 mmol, 2.20 eq, TFA) at 25 °C. The mixture was stirred at 25 °C for 30 minutes. HBTU (30.3 g, 234 mmol, 40.8 mL, 6.60 eq) was then added to the mixture. The mixture was stirred at 25 °C for 16 hours. LCMS (product: RT = 0.681 mins) showed that the reaction was complete, and the mixture was concentrated under vacuum. 0.50 NHCl (200 mL x 2) was added to the mixture at 20 °C, and the mixture was extracted with DCM (3 x 500 mL). The organic layers were combined and washed with saturated NaHCO3 (3 x 800 mL) until pH = 8. The mixture was then washed with brine (3 x 500 mL), dried over Na2SO4, and purified by vacuum concentration. The residue was purified by column chromatography (SiO2, DCM:MeOH = 50:1-15:1). The residue was concentrated under vacuum at 40 °C and purified by preparative-MPLC (column: 800 g Agela C18; mobile phase: [water-ACN]; 15-45% for 25 min; 45% for 10 min). The residue was dried under vacuum to obtain compound 5 as a yellow solid (approximately 180 g + 75.0 g + 87.0 g + 40.0 g + 38.0 g).

[0624] 417.0g of compounds 3-4 were converted into compound 5 through 9 batches.

[0625] 2.2 Preparation of intermediate 3-3

[0626]

[0627] Compound 5 (73.0 g, 61.7 mmol, 1.00 eq) and TFA (7.04 g, 61.7 mmol, 4.57 mL, 1.00 eq) were added to 300 mL of THF containing Pd / C (3.00 g, 10% content) under an argon atmosphere. The suspension was degassed and purged three times with hydrogen. The mixture was stirred for 16 hours at 20 °C and H2 (20 Psi). TLC (dichloromethane:methanol = 8:1, R f =0.0) indicates the reaction is complete. The mixture was filtered through celite, and the filtrate was concentrated under pressure to remove the solvent to obtain compound 3-3 as a white solid (approximately 33.4 g + 129 g + 75.0 g).

[0628] 1 H NMR: (400MHz, DMSO)

[0629] δ=8.53 (t, J=5.2Hz, 1H), 8.18 (d, J=2.4Hz, 3H), 8.03 (t, J=5.2Hz, 1H), 7.84 (dd, J=3.6H z, 2H), 5.22 (d, J=3.2Hz, 2H), 4.96 (dd, J=3.2Hz, 2H), 4.55 (d, J=8.4Hz, 2H), 4.02 (t, J= 8.8Hz, 6H), 3.77-3.59(m, 5H), 3.58-3.45(m, 21H), 3.40-3.20(m, 4H), 2.18(t, J=7.6Hz , 2H), 2.17(d, J=8.0Hz, 6H), 2.10(s, 6H), 1.99(s, 6H), 1.90-1.80(m, 8H), 1.77(s, 6H).

[0630] 3. Preparation of compound E7

[0631] 3.1 Preparation of Compound 3

[0632]

[0633] Compound 1 (2.00 g, 1.87 mmol, prepared according to the method described above for intermediate 3-3) was dissolved in DCM (20.0 mL) at room temperature. DIEA (0.135 mL, 0.814 mmol) and compound 2 (0.550 g, 0.814 mmol) were added sequentially to the solution, followed by nitrogen purging three times. The reaction mixture was stirred at 25 °C for 16 hours. The MS response of the product was detected by liquid chromatography-mass spectrometry (LC-MS), and thin-layer chromatography (dichloromethane / methanol = 5 / 1) showed the disappearance of the starting material and the formation of new spots. The reaction mixture was concentrated under reduced pressure, and the crude product was purified by column chromatography (dichloromethane / methanol = 5 / 1) to give compound 3 (approximately 780 mg) as a white solid.

[0634] 1 H NMR (400MHz, CD3OD)

[0635] δ=7.28-7.42(m, 5H), 5.30-5.34(m, 4H), 5.04-5.14(m, 6H), 4.63-4.67( m, 4H), 4.36-4.44 (m, 2H), 4.00-4.20 (m, 23H), 3.91-3.95 (m, 4H), 3.69-3 .77(m, 9H), 3.52-3.67(m, 32H), 3.34-3.43(m, 9H), 2.29-2.31(m, 4H), 2. 14 (s, 12H), 2.03 (s, 12H), 1.92-1.96 (m, 24H). LCMS: m / z=1221.6 (M / 2+H)+ .

[0636] 3.2 Preparation of compound 4

[0637]

[0638] Compound 3 (1.10 g, 0.451 mmol) was dissolved in MeOH (10.0 mL) at room temperature. 10% wet Pd / C (0.050 g, 0.451 mmol) was added to this solution, and the mixture was purged with hydrogen three times. The reaction mixture was stirred at 25 °C for 18 hours under a hydrogen atmosphere (14.696 psi). The MS response of the product was detected by liquid chromatography-mass spectrometry (LC-MS). Thin-layer chromatography (dichloromethane / methanol = 10 / 1, phosphomolybdic acid for colorimetric analysis) showed that the starting material was completely consumed and new spots were formed. The reaction mixture was filtered, and the filtrate was concentrated under reduced pressure to give a white solid, compound 4 (approximately 840 mg).

[0639] 1 H NMR (400MHz, CD3OD)

[0640] δ=5.32-5.34(m4H), 5.06-5.10(m, 4H), 4.63-4.65(m, 4H), 4.38-4.40(m, 2H), 3.99-4.20(m, 20H), 3.90-3.97(m, 4H), 3.69-3.76(m, 6H) , 3.50-3.68 (m, 36H), 3.35-3.44 (m, 11H), 2.28-2.38 (m, 4H), 2.15 (s, 12H), 2.03 (s, 12H), 1.90-1.94 (m, 24H). LCMS: m / z=1154.7 (M / 2+H) + .

[0641] 3.3 Preparation of compound 6

[0642]

[0643] Compound 5 (232 mg, 0.364 mmol) was dissolved in DCM (10.0 mL) at room temperature. HBTU (207 mg, 0.546 mmol), DIEA (0.181 mL, 1.09 mmol), and compound 4 (840 mg, 0.364 mmol) were added sequentially to the solution, followed by nitrogen purging three times. The reaction mixture was stirred at 25 °C for 1 hour. Liquid chromatography-mass spectrometry (LC-MS) detected the disappearance of the starting material, and thin-layer chromatography (dichloromethane / methanol = 5 / 1) showed the disappearance of the starting material and the formation of new spots. The reaction mixture was concentrated under reduced pressure, and the crude product was purified by column chromatography (dichloromethane / methanol = 8 / 1–5 / 1) to give a white solid compound 6 (approximately 620 mg).

[0644] 1 H NMR (400MHz, CD3OD)

[0645] δ=7.41-7.43(m, 2H), 7.23-7.34(m, 7H), 6.83-6.90(m, 4H), 5.31-5.35(m, 4H), 5.01-5.12(m , 4H), 4.63-4.65(m, 4H), 4.41-4.45(m, 2H), 4.31-4.33(m, 1H), 3.99-4.22(m, 22H), 3.87-3.9 7(m, 6H), 3.58-3.81(m, 45H), 3.34-3.43(m, 10H), 2.19-2.40(m, 10H), 2.14(s, 12H), 2.02(s , 12H), 1.92-1.96 (mz, 24H), 1.48-1.63 (m, 4H), 1.28-1.38 (m, 8H). LCMS: m / z=1460.0 (M / 2+H) + .

[0646] 4. Preparation of compound E7

[0647]

[0648] Compound 6 (300 mg, 0.103 mmol) was dissolved in DCM (10.0 mL) at room temperature. DIEA (0.102 mL, 0.618 mmol), compound 7 (10.3 mg, 0.103 mmol), and DMAP (12.6 mg, 0.103 mmol) were added sequentially to the solution, followed by three purgings with nitrogen. The reaction mixture was stirred at 25 °C for 2 hours. Liquid chromatography-mass spectrometry (LC-MS) detected the disappearance of the starting material. The reaction mixture was concentrated under reduced pressure, and the crude product was prepared by preparative high-performance liquid chromatography (preparative-HPLC, column: Waters Xbridge BEHC18100*30 mm*10 μm; mobile phase: water-ACN; B%: 17%-57%, 5 min) to obtain a white solid compound E7 (53.0 mg, yield 17.08%, purity 78.94%).

[0649] 1 H NMR (400MHz, CD3OD)

[0650] δ=7.41-7.45(m, 2H), 7.17-7.34(m, 7H), 6.85-6.89(m, 4H), 5v2-5.36(m, 4H), 5.03-5.13(m, 4H), 4.63-4 .67(m, 4H), 4.38-4.47(m, 2H), 4.32-4.34(m, 1H), 4.01-4.26(m, 22H), 3.88-4.00(m, 6H), 3.77-3.81(m, 7H), 3.49-3.76(m, 45H), 3.33-3.47(m, 10H), 2.56-2.62(m, 2H), 2.45-2.55(m, 3H), 2.21-2.38(m, 7H), 2 .14(s, 12H), 2.05-2.11(m, 2H), 2.02(s, 12H), 1.92-1.96(m, 24H), 1.47-1.68(m, 4H), 1.28-1.34(m, 8H)

[0651] MS: m / z = 3022.36(M+H) + .

[0652] Example 2 Preparation of compound E13

[0653] 1. Preparation of intermediate 2-2

[0654]

[0655] 1.1 Preparation of Compound 3

[0656]

[0657] The four reactions were carried out in parallel.

[0658] 4-Methylmorpholine (434 g, 4.30 mol, 472 mL) was added to a THF (1.75 L) solution of compound 1 (250 g, 741 mmol), and the mixture was then cooled to 0 °C. Isobutyl chloroformate (243 g, 1.78 mol, 233 mL) was added to the reaction mixture over 10 minutes, maintaining the reaction temperature below 4.0 °C. After the addition, the mixture was stirred for 40 minutes or longer, and compound 2 (526 g, 1.78 mol) was added sequentially to the reaction mixture over 10 minutes, maintaining the reaction temperature below 4.0 °C. After the addition, the ice bath was removed, and the reaction mixture was allowed to warm to room temperature for 2 hours. TLC (petroleum ether / ethyl acetate = 1 / 1, compound 1R) f =0.43) indicates that compound 1 was completely consumed and a new spot was formed. The four reactions were combined. The reaction solution was poured into a cold (0°C) 0.50M HCl (aq.) (12.0L) solution under stirring and stirred for about 10 minutes. Then EtOAc (4.00L x 3) was added, stirred for a period of time, the layers separated, and the organic phase was washed with brine (10.0L), dried with Na2SO4, and concentrated under vacuum to produce a thick, colorless oil. Hexane (1.20L) was added to the stirred oil. White fumes appeared in the solution and then disappeared after further stirring. Seed crystals (1.20g, 0.10wt%) were added, at which point white crystals slowly formed. Within 20 minutes, the suspension became thick enough to impede stirring, at which point additional hexane (6.00L) was added, and the mixture was stirred for 12 hours. The suspension was filtered, washed with hexane (1.20L), and dried to obtain compound 3 (about 1.20kg) as a white solid.

[0659] 1 H NMR: (400MHz DMSO)

[0660] δ=8.10-8.08(m, 1H), 7.62-7.60(m, 1H), 7.38-7.31(m, 5H), 5.11-4.94(m, 2H), 4.12-4.09(m, 1H) , 3.92-3.87(m, 1H), 2.25-2.19(m, 4H), 1.90-1.88(m, 2H), 1.73-1.67(m, 2H), 1.40-1.39(m, 27H).

[0661] 1.2 Preparation of Compound 4

[0662]

[0663] The five reactions were carried out in parallel.

[0664] A solution of compound 3 (240 g, 415 mmol) in HCOOH (2.40 L) was stirred at 45 °C for 2 h. LCMS (compound 4 = 0.570 min) showed that compound 3 was completely consumed and the desired m / z peak appeared. Five reactions were combined. The mixture was diluted and concentrated with toluene and ACN (1.50 L each). Formic acid was removed by azeotropic drying three times with ACN and toluene (500 mL each) in a 1:1 ratio. Compound 4 was dried under high vacuum. The residue was then stirred with DCM (500 mL) and the organic layer was discarded. The residue was then dried twice with ACN (400 mL) under vacuum, followed by azeotropic drying nine times with toluene (400 mL) to give compound 4 (approximately 800 g) as a white solid.

[0665] 1 H NMR: (400MHz DMSO)

[0666] δ=12.4-12.2(m, 2H), 8.12-8.10(m, 1H), 7.62-7.60(m, 1H), 7.38-7.34(m, 5H), 5.07-5.02(m, 2H) , 4.22-4.17(m, 1H), 3.99-3.96(m, 1H), 2. 31-2.21(m, 4H), 2.00-1.93(m, 2H), 1.76-1.75(m, 2H).

[0667] 1.3 Preparation of Compound 6

[0668]

[0669] To a stirred DMF (2.00 L) solution containing compound 4 (80.0 g, 194 mmol) and (384 g, 700 mmol, TFA), HOBT (103 g, 760 mmol), EDCI (146 g, 760 mmol), and DIEA (113 g, 877 mmol, 153 mL) were added sequentially. The reaction mixture was stirred at 20 °C for 2 hours. TLC (dichloromethane / methanol = 5 / 1, compound 6R) was recorded. f =0.43) showed that compound 4 was completely consumed and a new spot was formed. The reaction mixture was slowly poured into a stirred, cold 0.5 M HCl aqueous solution (230 mL), stirred for 10 min, a white solid was formed and filtered, and the aqueous phase was extracted twice with DCM (1.50 L). The combined organic phases were washed with 5% NaHCO3 (aq.) (200 mL), dried (Na2SO4), and then concentrated by pressure evaporation. The results were obtained by column chromatography (SiO2, dichloromethane / methanol = 5 / 1, compound 6R) f =0.43) The residue was purified to give compound 6 (about 180 g) as a yellow solid.

[0670] 1 H NMR: (400MHz DMSO)

[0671] δ7.95-7.91 (m, 3H), 7.82-7.80 (m, 4H), 7.39-7.31 (m, 6H), 5.21-5.01 (m, 3H), 5.00-4.96 (m, 5H), 4.56-4.53 (m, 3H), 4.02 (s, 1H), 3.88 (s, 9 H), 3.85 (s, 4H), 3.76 (s, 3H), 3.50-349 (m, 9H), 3.39-3.36 (m, 6H), 3. 19-3.15(m, 6H), 2.15-2.05(m, 12H), 1.99(s, 9H), 1.89-1.77(m, 21H).

[0672] 1.4 Preparation of intermediate 2-2

[0673]

[0674] Pd(OH)₂ / C (4.94 g, 3.52 mmol, 10% purity) was added to a dry hydrogenation flask under an argon atmosphere, followed by MeOH (350 mL), and then compound 6 (47.4 g, 28.5 mmol) and TFA (3.26 g, 28.5 mmol, 2.11 mL) were added sequentially. The mixture was stirred for 3 hours at 20 °C under H₂ (50 psi). The reaction was analyzed by TLC (dichloromethane / methanol = 5 / 1, intermediate 2-2R). f =0.25) The reaction was monitored, showing that compound 6 was consumed. The reaction mixture was filtered and the filtrate was concentrated under vacuum to obtain intermediate 2-2 (TFA salt) as a white solid (46.3 g, 94.6% yield, 95.7% purity, TFA).

[0675] 1 H NMR: (400MHz DMSO)

[0676] δ=8.56-8.50 (m, 1H), 8.14-8.05 (m, 4H), 7.99 (s, 1H), 7.88-7.82 (m, 4H), 5. 22-5.21(m, 3H), 4.99-4.96(m, 3H), 4.55-4.53(m, 3H), 4.09(s, 1H), 4.03(s, 9H), 3.87-3.79(m, 6H), 3.59-3.52(m, 1H), 3.51-347(m, 9H), 3.39-3.37(m, 5 H), 3.17-3.16(m, 6H), 2.22-2.10(m, 12H), 1.99(s, 9H), 1.93-1.73(m, 21H).

[0677] 2. Preparation of compound E13

[0678]

[0679]

[0680] 2.1 Preparation of compound Int1

[0681] 2.1.1 Preparation of compounds 1-2

[0682]

[0683] Compound 1-1 (38.0 g, 231 mmol), TsNHBoc (75.4 g, 278 mmol), K2CO3 (6.40 g, 46.3 mmol), and TEBA (5.27 g, 23.1 mmol) were added to a three-necked flask at room temperature. The reaction was carried out at 95 °C for 2 hours, followed by cooling to 25 °C. TLC (PE / EA = 2 / 1, UV 254 nm) showed that the reaction was complete. The reaction solution was diluted with water (500 mL), extracted with dichloromethane (200 mL x 3), concentrated under reduced pressure, and the crude product was purified by column chromatography (PE / EA = 10 / 1-3 / 1) to give a colorless oily compound 1-2 (40.0 g).

[0684] 1 H NMR (400MHz, CDCl3)

[0685] δ7.72 (d, J=8.4Hz, 2H), 7.28-7.39 (m, 7H), 4.72-4.86 (m, 2H), 4.42-4.5 6(m, 2H), 3.52-3.61m, 2H), 3.14-3.39(m, 2H), 2.43(s, 3H), 1.47(s, 9H)

[0686] 2.1.2 Preparation of compounds 1-4

[0687]

[0688] Compounds 1-2 (79.0 g, 181 mmol), 1-3 (4.21 g, 30.5 mmol), and TEBA (3.47 g, 15.2 mmol) were reacted at 95 °C for 3 hours. The reaction was completed by TLC (PE / EA = 2 / 1, UV 254 nm). The reaction solution was diluted with water (500 mL), extracted with dichloromethane (200 mL x 3), concentrated under reduced pressure, and the crude product was purified by column chromatography (PE / EA = 10 / 1-3 / 1) to give colorless oily compound 1-4 (approximately 40.0 g).

[0689] 1 H NMR (400MHz, CDCl3)

[0690] δ=7.64-7.77(m, 2H), 7.27-7.38(m, 13H), 5.05-5.16(m, 1H), 4.50-4.59(m, 4H), 4.03-4.11(m, 1H), 3 .62-3.76(m, 2H), 3.44-3.58(m, 3H), 3.25-3.33(m, 2H), 3.15-3.20(m, 1H), 2.42(s, 3H), 1.46(s, 9H)

[0691] 2.1.3 Preparation of compounds 1-5

[0692]

[0693] Under ice bath conditions, compounds 1-4 (77.0 g, 128 mmol) and Et3N (28.6 mL, 205 mmol) were added sequentially to dichloromethane (800 mL), followed by the slow addition of methanesulfonyl chloride (24.2 g, 212 mmol). The reaction was carried out at 25 °C for 2 hours, and LC-MS showed that the reaction was complete. The reaction solution was washed with water (800 mL), and the organic phase was concentrated under reduced pressure to give a colorless oily compound 1-5 (approximately 90.0 g).

[0694] LCMS(ESI): m / z = 700.1(M+Na) + ;

[0695] 1H NMR (400MHz, CDCl3) δ7.68 (d, J=8.4Hz, 2H), 7.28-7.39 (m, 12H), 5.10-5.20 (m, 1H), 4.93-5.02 (m, 1H), 4.52-4.61 (m, 4H), 3.72-3. 88 (m, 2H), 3.52-3.67 (m, 4H), 3.27-3.36 (m, 1H), 3.15-3.22 (m, 1H), 3.04 (s, 3H), 2.43 (s, 3H), 1.43 (s, 9H). LCMS: m / z=700.1 (M+Na) + .

[0696] 2.1.4 Preparation of compounds 1-6

[0697]

[0698] Compounds 1-5 (90.0 g, 133 mmol) and potassium carbonate (91.8 g, 664 mmol) were added to MeOH (900 mL) at room temperature. The reaction was carried out at 66 °C for 2 h. TLC (PE / EA = 2 / 1, UV 254 nm) showed the formation of new spots. The organic phase was concentrated under reduced pressure, the reaction solution was diluted with water (200 mL), extracted with dichloromethane (200 mL x 3), the organic phase was concentrated under reduced pressure, and the crude product was purified by column chromatography (PE / EA = 30 / 1-2 / 1) to give a white solid compound 1-6 (approximately 64.0 g).

[0699] 1 H NMR (400MHz, CDCl3) δ7.62 (d, J=8.4Hz, 2H), 7.27-7.39 (m, 12H), 4.48-4.62 ( m, 4H), 3.93-4.08 (m, 2H), 3.55-3.69 (m, 4H), 2.84-3.10 (m, 4H), 2.44 (s, 3H)

[0700] 1.1.5 Preparation of compounds 1-7

[0701]

[0702] Compounds 1-6 (69.0 g, 143 mmol) and magnesium shavings (54.7 g, 2.28 mol) were added to MeOH (400 mL) at room temperature and reacted at 66 °C for 1 h. TLC (DCM / MeOH = 10 / 1, UV 254 nm) showed that the starting materials reacted completely and new spots were formed. The reaction solution was diluted with water (3000 mL) and saturated ammonium chloride aqueous solution (3000 mL), extracted with dichloromethane (1000 mL x 3), and the organic phase was washed with saturated sodium bicarbonate (300 mL x 3). The organic phase was concentrated under reduced pressure to give a colorless oily compound 1-7 (approximately 32.0 g).

[0703] 1 H NMR (400MHz, CDCl3) δ7.27-7.40(m, 10H), 4.57(s, 4H), 3.90-4.00(m, 2H), 3.59-3.69(m, 4H), 2.77-3.04(m, 4H)

[0704] 1.1.6 Preparation of compounds 1-8

[0705]

[0706] Compound 1-7 (8.00 g, 24.4 mmol) was added to HCl (100 mL, 12 M) at room temperature and reacted at 50 °C for 2 hours. The reaction solution was concentrated under reduced pressure to give a colorless oily compound 1-8 (approximately 3.60 g, HCl salt).

[0707] 1 H NMR (400MHz, CDCl3) δ4.12-4.22 (m, 2H), 3.78 (d, J=4.4Hz, 4H), 3.17-3.30 (m, 4H)

[0708] 1.1.7 Preparation of compound Int-1

[0709]

[0710] Compounds 1-8 (8.29 g, 24.5 mmol) were added to pyridine (50 mL, 618 mmol) at room temperature, followed by the addition of DMTrCl (4.77 g, 12.3 mmol). The reaction mixture was reacted at 25 °C for 18 hours, and TLC (DCM / MeOH = 10 / 1, UV 254 nm) showed product formation. The reaction solution was concentrated under reduced pressure, diluted with saturated ammonium chloride (200 mL), extracted with DCM (100 mL x 3), and the organic phase was concentrated under reduced pressure. The crude product was separated by column chromatography (DCM / MeOH = 99 / 1-10 / 1) to obtain a yellow solid Int-1 (approximately 2.6 g, 5.78 mmol, 23.6%).

[0711] 1 H NMR (400MHz, CDCl3) δ7.38-7.50 (m, 2H), 7.25-7.36 (m, 6H), 7.18-7.25 (m, 1H), 6.87 (d, J=8.8Hz, 4H), 4.26-4.40 (m, 1H) ), 3.94-4.05 (m, 1H), 3.85 (d, J=4.4Hz, 2H) 3.73-3.82 (m, 6H), 3.34-3.41 (m, 1H), 3.23-3.30 (m, 3H), 3.05-3.23 (m, 2H)

[0712] 2.2 Preparation of compound Int6

[0713] 2.2.1 Preparation of Compound 3

[0714]

[0715] Compound 1 (1.00 g, 3.05 mmol) was dissolved in anhydrous N,N-dimethylformamide (10.0 mL) at 25 °C. HOBt (0.54 g, 3.97 mmol), EDCI (0.76 g, 3.97 mmol), and DIEA (1.51 mL, 9.16 mmol) were added sequentially, followed by compound 2 (0.79 g, 3.66 mmol). The mixture was stirred at 25 °C for 2 hours. Liquid chromatography-mass spectrometry (LC-MS) showed complete reaction of the starting material and formation of the product. Thin-layer chromatography (dichloromethane:methanol = 10:1) showed complete reaction of the starting material and formation of the product. Dichloromethane (200 mL) was added to the mixture, which was then washed three times each with saturated citric acid solution (20 mL x 3), saturated sodium bicarbonate solution (20 mL x 3), and saturated brine (20 mL x 3). The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain the crude product. The crude product was purified by column chromatography (dichloromethane:methanol = 10:1) to give yellow oily compound 3 (about 1.00 g).

[0716] 1 H NMR (400MHz, CD3OD) δ7.21-7.41 (m, 10H), 4.47-4.60 (m, 4H), 3.88-4.01 (m, 2H), 3.75 (dd, J=3.2, 13.2 Hz, 1H), 3.63-3.65 (m, 3H), 3.40-3.63 (m, 7H), 2.27-2.34 (m, 4H), 1.50-1.60 (m, 4H), 1.28-1.34 (m, 8H)

[0717] LCMS: m / z = 526.8(M+H)+ .

[0718] 2.2.2 Preparation of compound 4

[0719]

[0720] Compound 3 (380 mg, 0.20 mmol) was dissolved in anhydrous methanol (10.0 mL) at 25 °C, and 10% wet Pd / C (500 mg, 4.70 mmol) was added. The reaction mixture was stirred at 50 °C for 12 hours. Liquid chromatography-mass spectrometry (LC-MS) showed product formation. The reaction mixture was filtered through diatomaceous earth, and the filtrate was concentrated under reduced pressure to give a yellow oily compound 4 (approximately 600 mg).

[0721] 1 H NMR (400MHz, CD3OD) δ3.79-3.89 (m, 2H), 3.73 (dd, J=3.6, 13.2Hz, 1H), 3.64-3.68 (m, 5H), 3.57-3.62 (m, 2H), 3.48-3 .56(m, 2H), 3.38-3.47(m, 1H), 1.58-1.62(m, 5H), 1.34(d, J=2.8Hz, 11H), 1.30-1.37(m, 1H).LCMS: m / z=346.5(M+H) + .

[0722] 2.2.3 Preparation of compound 5

[0723]

[0724] Compound 4 (600 mg, 1.74 mmol) was dissolved in pyridine (3.00 mL) at 25 °C, and DMTrCl (883 mg, 2.61 mmol) was added. The reaction mixture was stirred at 25 °C for 1 hour. Liquid chromatography-mass spectrometry (LC-MS) showed product formation. Thin-layer chromatography (dichloromethane:methanol = 10:1) showed complete reaction of the starting materials and formation of the product. Dichloromethane (200 mL) was added to the mixture, and the mixture was washed three times with saturated sodium bicarbonate solution (20 mL x 3) and brine (20 mL x 3). The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain the crude product. The crude product was purified by column chromatography (petroleum ether:ethyl acetate = 3:1) to give a colorless liquid compound 5 (approximately 475 mg).

[0725] 1H NMR (400MHz, CD3OD) δ7.41-7.43(m, 2H), 7.16-7.34(m, 7H), 6.83-6.87(m, 4 H), 3.88-4.04(m, 2H), 3.77-4.09(m, 7H), 3.61-3.68(m, 4H), 3.43-3.58(m, 3 H), 3.33-3.38 (m, 1H), 3.14-3.20 (m, 1H), 3.05 (dd, J=8.4, 13.2Hz, 1H), 2.2 0-2.42(m, 4H), 1.51-1.60(m, 4H), 1.25-1.39(m, 8H).LCMS: m / z=648.3(M+H) + .

[0726] 2.2.4 Preparation of compound Int-6

[0727]

[0728] Compound 5 (475 mg, 0.73 mmol) was dissolved in tetrahydrofuran (8.00 mL) and H₂O (2.00 mL) at 25 °C, and lithium hydroxide monohydrate (36.9 mg, 0.89 mmol) was added. The reaction mixture was stirred at 25 °C for 12 hours. Thin-layer chromatography (dichloromethane:methanol = 10:1) showed that the starting material reacted completely and the product was formed. The reaction mixture was concentrated under reduced pressure and then freeze-dried directly to give compound 6 (approximately 430 mg) as a white solid.

[0729] 2.3 Preparation of compound E13

[0730] 2.3.1 Preparation of Compound 7

[0731]

[0732] Compound Int-6 (100 mg, 0.156 mmol) was dissolved in anhydrous N,N-dimethylformamide (3.00 mL) at 25 °C, followed by the sequential addition of HBTU reagent (89.0 mg, 0.234 mmol), DIEA (0.078 mL, 0.47 mmol), and intermediate C (254 mg, 0.156 mmol, synthesized according to the method of intermediate 2-2 in Example 2). The reaction mixture was stirred at 25 °C for 12 hours. Thin-layer chromatography (dichloromethane:methanol = 10:1) showed the formation of new spots. Dichloromethane (200 mL) was added to the mixture, which was then washed three times with saturated sodium bicarbonate solution (20 mL x 3) and three times with brine (20 mL x 3). The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain the crude product. The crude product was purified by column chromatography (dichloromethane:methanol = 10:1) to give the yellow oily product compound 7 (approximately 140 mg).

[0733] 1 H NMR (400MHz, CD3OD) δ7.43 (d, J=8.4Hz, 2H), 7.18-7.34 (m, 7H), 6.81-6.91 (m, 4H), 5.34 (d, J=2.8Hz, 3H), 5.09-5 .11(m, 3H), 4.62-4.66(m, 3H), 4.27-4.35(m, 2H), 4.07-4.17(m, 9H), 4.00-4.07(m, 4H), 3.89-3.98(m, 5H), 3.79 (d, J=2.4Hz, 6H), 3.69-3.75(m, 5H), 3.60-3.64(m, 9H), 3.52-3.56(m, 10H), 3.43-3.50(m, 4H), 3.39-3.40(m, 1H) ), 2.25-2.40(m, 8H), 2.13-2.15(m, 9H), 2.02(s, 9H), 1.94-1.96(m, 18H), 1.48-1.66(m, 4H), 1.21-1.36(m, 11H)

[0734] 2.3.2 Preparation of E13

[0735]

[0736] Compound 7 (400 mg, 0.187 mmol) was dissolved in anhydrous dichloromethane (5.00 mL), followed by the sequential addition of DIEA (0.18 mL, 1.12 mmol), DMAP (5.71 mg, 0.047 mmol), and finally compound 8 (112 mg, 1.12 mmol). The mixture was stirred at 25 °C for 3 hours. Thin-layer chromatography (dichloromethane:methanol = 10:1) showed the formation of new spots. Dichloromethane (200 mL) was added to the mixture, and the solution was washed three times with saturated brine (15.0 mL x 3). The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain the crude product. The crude product was separated by high performance liquid chromatography (column: Welch Xtimate C18 150*25mm*5um; mobile phase: water-ACN; gradient: 27%-57% / 11min; flow rate: 25ml / min) to give a white solid compound E13 (74.8mg, 0.033mmol, yield 17.9%).

[0737] LCMS(ESI): m / z=1149.5(M / 2+H) + ; 1 H NMR (400MHz, CD3OD) δ7.42-7.44(m, 2H), 7.18-7.34(m, 7H), 6.83-6.90(m, 4H), 5.33-5.34(m, 3H), 5.08-5.11(m, 3H), 4.61-4.68(m, 3 H), 4.27-4.36(m, 2H), 4.19-4.27(m, 1H), 4.10-4.19(m, 7H), 4.08(s, 2H), 4.00-4.07(m, 4H), 3.90-3.94(m, 4H), 3.83-3.89(m, 1H), 3 .79(d, J=2.4Hz, 6H), 3.70-3.72(m, 4H), 3.53-3.54(m, 15H), 3.44-3.48(m, 3H), 3.35-3.40(m, 4H), 3.10-3.23(m, 2H), 2.53-2.63(m, 4H), 2.22-2.40(m, 8H), 2.11-2.16(m, 9H), 2.05-2.10(m, 2H), 2.02(s, 9H), 1.90-1.97(m, 19H), 1.48-1.65(m, 4H), 1.29-1.32(m, 8H)

[0738] Example 3 Preparation of compound E2

[0739]

[0740] 1. Preparation of compound 2b

[0741]

[0742] Compound 2a (38.0 g, 231 mmol), TsNHBoc (75.4 g, 278 mmol), K2CO3 (6.40 g, 46.3 mmol), and TEBA (5.27 g, 23.1 mmol) were added to a three-necked flask at room temperature. The reaction was carried out at 95 °C for 2 hours, followed by cooling to 25 °C. TLC (PE / EA = 2 / 1, UV 254 nm) showed that the reaction was complete. The reaction solution was diluted with water (500 mL), extracted with dichloromethane (200 mL × 3), concentrated under reduced pressure, and purified by column chromatography (PE / EA = 10 / 1-3 / 1) to give title compound 2b (40.0 g). 1 H NMR (400MHz, CDCl3) δ7.72 (d, J=8.4Hz, 2H), 7.28-7.39 (m, 7H), 4.72-4.86 (m, 2H) , 4.42-4.56 (m, 2H), 3.52-3.61m, 2H), 3.14-3.39 (m, 2H), 2.43 (s, 3H), 1.47 (s, 9H)

[0743] Preparation of compound 2d

[0744]

[0745] Compound 2b (79.0 g, 181 mmol), compound 2c (24.7 g, 150.8 mmol), potassium carbonate (4.21 g, 30.5 mmol), and TEBA (3.47 g, 15.2 mmol) were reacted at 95 °C for 3 h. TLC (PE / EA = 2 / 1, UV 254 nm) showed that the reaction was complete. The reaction solution was diluted with water (500 mL), extracted with dichloromethane (200 mL × 3), concentrated under reduced pressure, and the crude product was purified by column chromatography (PE / EA = 10 / 1-3 / 1) to give compound 2d (40.0 q, yield 43.8%).

[0746] 1H NMR (400MHz, CDCl3) δ7.64-7.77(m, 2H), 7.27-7.38(m, 13H), 5.05-5.16(m, 1H), 4.50-4.59(m, 4H), 4.03-4.11 (m, 1H), 3.62-3.76 (m, 2H), 3.44-3.58 (m, 3H), 3.25-3.33 (m, 2H), 3.15-3.20 (m, 1H), 2.42 (s, 3H), 1.46 (s, 9H)

[0747] 3. Preparation of compound 2e

[0748]

[0749] Compound 2d (77.0 g, 128 mmol) and triethylamine (28.6 mL, 205 mmol) were added sequentially to dichloromethane (800 mL) under ice-water bath conditions, followed by the slow addition of methanesulfonyl chloride (24.2 g, 212 mmol). The reaction was carried out at 25 °C for 2 hours, and LC-MS showed that the reaction was complete. The reaction solution was washed with water (800 mL), and the organic phase was concentrated under reduced pressure to give crude compound 2e (90.0 g).

[0750] m / z: ES + [M + Na] + 700.1

[0751] 1 H NMR (400MHz, CDCl3) δ7.68 (d, J=8.4Hz, 2H), 7.28-7.39 (m, 12H), 5.10-5.20 (m, 1H), 4.93-5.02 (m, 1H), 4.52-4.61 (m, 4 H), 3.72-3.88(m, 2H), 3.52-3.67(m, 4H), 3.27-3.36(m, 1H), 3.15-3.22(m, 1H), 3.04(s, 3H), 2.43(s, 3H), 1.43(s, 9H).

[0752] 4. Preparation of compound 2f

[0753]

[0754] Compound 2e (90.0 g, 133 mmol) and potassium carbonate (91.8 g, 664 mmol) were added to methanol (900 mL) at room temperature. The reaction was carried out at 66 °C for 2 h. TLC (PE / EA = 2 / 1, UV 254 nm) showed the formation of new spots. The organic phase was concentrated under reduced pressure, the reaction solution was diluted with water (200 mL), extracted with dichloromethane (200 mL x 3), the organic phase was concentrated under reduced pressure, and the crude product was purified by column chromatography (PE / EA = 30 / 1-2 / 1) to give compound 2f (64.0 g, yield 99.9%).

[0755] 1 H NMR (400MHz, CDCl3) δ7.62 (d, J=8.4Hz, 2H), 7.27-7.39 (m, 12H), 4.48-4.62 ( m, 4H), 3.93-4.08 (m, 2H), 3.55-3.69 (m, 4H), 2.84-3.10 (m, 4H), 2.44 (s, 3H)

[0756] 5. Preparation of 2g of compound

[0757]

[0758] Compound 2f (69.0 g, 143 mmol) and magnesium chips (54.7 g, 2.28 mol) were added to methanol (400 mL) at room temperature and reacted at 66 °C for 1 h. TLC (DCM / MeOH = 10 / 1, UV 254 nm) showed that the starting material reacted completely and new spots were formed. The reaction solution was diluted with water (3000 mL) and saturated ammonium chloride aqueous solution (3000 mL), extracted with dichloromethane (1000 mL × 3), and the organic phase was washed with saturated sodium bicarbonate (300 mL × 3). The organic phase was concentrated under reduced pressure to give crude compound 2 g (32.0 g).

[0759] 1 H NMR (400MHz, CDCl3) δ7.27-7.40(m, 10H), 4.57(s, 4H), 3.90-4.00(m, 2H), 3.59-3.69(m, 4H), 2.77-3.04(m, 4H)

[0760] 6. Preparation of compound 2h

[0761]

[0762] At room temperature, 2 g (3.00 g, 9.16 mmol) of compound 1b, 1.90 mL (18.3 mmol) of compound 1b, and 1.01 mL (18.3 mmol) of acetic acid were added to 30 mL of methanol. The reaction was carried out at 25 °C for 18 h, followed by the addition of sodium cyanoborohydride (2.30 g, 36.7 mmol) and the reaction at 50 °C for 4 h. TLC (DCM / MeOH = 10 / 1) showed the formation of new spots. The reaction solution was diluted with water (50 mL), extracted with dichloromethane (30 mL × 3), and the organic phase was concentrated under reduced pressure. The crude product was purified by column chromatography (dichloromethane / methanol = 99 / 1-5 / 1) to give compound 2h (3.00 g, yield 79.9%).

[0763] 1 H NMR (400MHz, CDCl3) δ7.28-7.41(m, 10H), 4.51-4.71(m, 4H), 4.00-4.35(m, 2H ), 3.49-3.77(m, 4H), 2.69-2.98(m, 2H), 1.63-2.12(m, 7H), 1.16-1.44(m, 6H)

[0764] 7. Preparation of compound 2i

[0765]

[0766] Compound 2h (3.00 g, 7.32 mmol) was added to concentrated hydrochloric acid (10 mL, 12 M) at room temperature and reacted at 50 °C for 18 hours. TLC (DCM / MeOH = 10 / 1) showed the formation of new spots. The reaction solution was concentrated under reduced pressure to obtain crude compound 2i (2.00 g).

[0767] 1 H NMR (400MHz, CD3OD) δ4.27-4.38(m, 1H), 4.11-4.20(m, 1H), 3.96-4.04(m, 2H), 3.60-3.68(m, 3H), 3.36-3.43(m, 1H), 3.19-3.29(m, 2H), 3.11(s, 1H), 2.02-2.17(m, 2H), 1.90-2.00(m, 2H), 1.69-1.78(m, 1H), 1.57-1.69(m, 1H), 1.35-1.52(m, 3H), 1.20-1.31(m, 1H)

[0768] 8. Preparation of compound 2j

[0769]

[0770] Compound 2i (2.00 g, 8.72 mmol) was dissolved in pyridine (40 mL) at room temperature, followed by the addition of DMTrCl (2.96 g, 8.72 mmol). The reaction was carried out at 25 °C for 18 hours, and TLC (PE / EA = 1 / 1, UV 254 nm) showed that the reaction was complete. The reaction solution was concentrated under reduced pressure, and saturated ammonium chloride aqueous solution (200 mL) was added. The mixture was extracted with DCM (100 mL x 3), and the organic phase was concentrated under reduced pressure. The crude product was purified by column chromatography (dichloromethane / methanol = 99 / 1-10 / 1) to give compound 2j (1.40 g, yield 30.2%).

[0771] 9. Preparation of compound E2

[0772]

[0773] Compound 2j (660 mg, 1.24 mmol), compound 1h (374 mg, 1.24 mmol), and DCI (73.3 mg, 0.621 mmol) were added to DCM (10 mL) and reacted at 25 °C for 1 hour. TLC (PE / EA = 5 / 1, PMA) showed that the starting material reacted completely. Saturated sodium bicarbonate (50 mL) was added, and the mixture was extracted with DCM (30 mL x 3). The organic phase was concentrated under reduced pressure, and the crude product was separated by column chromatography (PE / EA = 99 / 1-30 / 1) to give compound E2 (350 mg, yield 19.3%).

[0774] m / z: ES + [M + H] + 732.2

[0775] 1 H NMR (400MHz, CDCl3) δ7.40-7.50 (m, 2H), 7.28-7.37 (m, 6H), 7.21 (d, J=7. 2Hz, 1H), 6.77-6.89(m, 4H), 3.67-4.07(m, 11H), 3.56-3.66(m, 2H), 3.04- 3.33(m, 2H), 2.30-2.96(m, 6H), 2.10-2.28(m, 1H), 1.63-1.88(m, 4H), 1. 47-1.52(m, 1H), 1.24-1.31(m, 3H), 1.15-1.23(m, 12H), 1.11-1.14(m, 1H)

[0776] Example 4: Preparation of siRNA

[0777] The siRNA disclosed herein was prepared using a solid-phase phosphoramide method well known in the art. Specific methods can be found, for example, in PCT publications WO2016081444 and WO2019105419, and are briefly described below.

[0778] 1. Preparation of siRNA without ligand linkage

[0779] 1.1 Justice Chain (SS Chain) Community

[0780] The oligonucleotide was synthesized using a solid-phase phosphoramide method, employing a blank CPG solid support as the starting cycle. Nucleoside monomers or nucleotide analog monomers were sequentially linked from the 3'-5' direction according to the nucleotide arrangement of the positive strand. Each linkage of a nucleoside monomer or nucleotide analog monomer involved four steps: deprotection, coupling, capping, and oxidation or thiolation. The synthesis conditions for 5 μmol oligonucleotides were as follows:

[0781] The nucleoside monomer or nucleotide analog monomer was provided in a 0.05 mol / L acetonitrile solution. The reaction conditions were identical for each step: 25°C. Deprotection was performed three times using a 3% trichloroacetic acid-dichloromethane solution. The coupling reaction was activated twice using a 0.25 mol / L ETT-acetonitrile solution. Capping was performed twice using a 10% acetic anhydride-acetonitrile and pyridine / N-methylimidazole / acetonitrile mixture (10:14:76, v / v / v). Oxidation was performed twice using a 0.05 mol / L iodine / tetrahydrofuran / pyridine / water mixture (70 / 20 / 10, v / v / v). Thiolysis was performed twice using a 0.2 mol / L PADS mixture of acetonitrile / 3-methylpyridine (1 / 1, v / v).

[0782] The nucleotide monomers for IB were purchased from Shanghai Zhaowei Technology Development Co., Ltd., product number OP-040.

[0783] 1.2 Synthesis of the antisense chain (AS chain)

[0784] The solid-phase phosphoramide synthesis method utilizes a blank CPG solid-phase support as the starting cycle, and nucleoside monomers or nucleotide analog monomers are sequentially linked from the 3'-5' direction according to the nucleotide arrangement sequence of the antisense strand. Each linkage of a nucleoside monomer or nucleotide analog monomer involves four steps: deprotection, coupling, capping, and oxidation or thiolation. The synthesis conditions for 5 μmol oligonucleotides of the antisense strand are the same as those for the sense strand.

[0785] 1.3 Purification and Annealing of Oligonucleotides

[0786] 1.3.1 Ammonolysis

[0787] The synthesized solid support (sense or antisense chain) was added to a 5 mL centrifuge tube, and 3% diethylamine / ammonia (v / v) was added. The mixture was reacted in a constant temperature water bath at 35℃ (or 55℃) for 16 hours (or 8 hours). After filtration, the solid support was washed three times with ethanol / water, 1 mL each time. The filtrate was concentrated by centrifugation and the crude product was purified.

[0788] 1.3.2 Purification

[0789] Purification and desalting methods are well known to those skilled in the art. For example, a column packed with strong anion exchange material can be used for elution purification with a sodium chloride-sodium hydroxide system, and the product can be collected and piped. Desalting can be performed using a gel-packed purification column with pure water as the elution system.

[0790] 1.3.3 Annealing

[0791] According to Table 6, the sense chain (SS chain) and the antisense chain (AS chain) are mixed in a molar ratio (SS chain / AS chain = 1 / 1.05), heated in a water bath to 70-95 degrees Celsius, held for 3-5 minutes, and then naturally cooled to room temperature. The system is then freeze-dried to obtain the product.

[0792] 2. Preparation of siRNA linked to the positive strand and ligand

[0793] 2.1 Ligand-CPG vector conjugation

[0794] 2.1.1 Ligation of compound E7 with the CPG support

[0795] Compound E7 (53 mg, 0.018 mmol) and HBTU (13.3 mg, 0.035 mmol) were mixed and dissolved by 5 mL of acetonitrile with shaking. Then, DIEA (9.0 mg, 0.07 mmol) and DMAP (2.1 mg, 0.018 mmol) were added and dissolved by shaking until clear. 550 mg of blank carrier Resin (CPG pore size) was weighed out. The solution was added to the reaction mixture, and the mixture was reacted overnight on a shaker at 20°C. Samples were taken and monitored, and thin-layer chromatography (TLC) was performed. The results showed that the reaction was complete, with DCM / methanol as the developing solvent (4 / 1). Phosphomolybdic acid was used for color development. The mixture was filtered using a sintered glass funnel, and the filter cake was washed with anhydrous acetonitrile (20 mL x 5). The filter cake was then collected and filtered under reduced pressure using an oil pump for 6 hours to obtain 530 mg of an off-white solid.

[0796] 530 mg of the condensed product was placed in a 50 mL round-bottom flask, and CapC (DMAP / acetonitrile), CapB (N-methylimidazolium / pyridine / acetonitrile), and CapA (acetic anhydride / acetonitrile) were added sequentially. The mixture was incubated overnight on a shaker at room temperature. After filtration, the filter cake was washed with acetonitrile (20 mL x 4). The filter cake was then collected and filtered under reduced pressure for 8 hours using an oil pump to obtain 200 mg of an off-white solid, which was used for solid-phase synthesis.

[0797] 2.1.2 Ligation of compound E13 with the CPG support

[0798] Compound E13 was linked to the CPG support using a method similar to that used for linking compound E7 to the CPG support.

[0799] 2.2 Synthesis of the Justice Chain (SS Chain)

[0800] Using a solid-phase phosphoramide synthesis method, the GL6 solid support prepared in Section 2.1.1 of Example 4 was used as the starting cycle, and nucleoside monomers were sequentially linked from the 3'-5' direction according to the nucleotide arrangement of the positive strand. Each linkage of a nucleoside monomer involved four steps: deprotection, coupling, capping, and oxidation or thiolation. The synthesis conditions for oligonucleotides at a scale of 5 μmol are as follows:

[0801] The nucleoside monomer was provided in a 0.05 mol / L acetonitrile solution. The reaction conditions were identical for each step: 25°C. Deprotection was performed three times using a 3% trichloroacetic acid-dichloromethane solution. The coupling reaction was activated twice using a 0.25 mol / L ETT-acetonitrile solution. Capping was performed twice using a 10% acetic anhydride-acetonitrile and pyridine / N-methylimidazole / acetonitrile mixture (10:14:76, v / v / v). Oxidation was performed twice using a 0.05 mol / L iodine / tetrahydrofuran / pyridine / water mixture (70 / 20 / 10, v / v / v). Thiolation was performed twice using a 0.2 mol / L PADS mixture of acetonitrile / 3-methylpyridine (1 / 1, v / v).

[0802] 2.3 Synthesis of the antisense strand (AS strand)

[0803] The solid-phase phosphoramide synthesis method utilizes a blank CPG solid-phase support as the starting cycle, and nucleoside monomers are sequentially linked from the 3'-5' direction according to the nucleotide arrangement sequence of the antisense strand. Each linkage of a nucleoside monomer involves four steps: deprotection, coupling, capping, and oxidation or thiolation. The synthesis conditions for 5 μmol oligonucleotides of the antisense strand are the same as those for the sense strand.

[0804] 2.4 Purification and Annealing of Oligonucleotides

[0805] 2.4.1 Ammonolysis

[0806] The synthesized solid support (sense or antisense chain) was added to a 5 mL centrifuge tube, and 3% diethylamine / ammonia (v / v) was added. The mixture was reacted in a constant temperature water bath at 35℃ (or 55℃) for 16 hours (or 8 hours). After filtration, the solid support was washed three times with ethanol / water, 1 mL each time. The filtrate was concentrated by centrifugation and the crude product was purified.

[0807] 2.4.2 Purification

[0808] Purification and desalting methods are well known to those skilled in the art. For example, a column packed with strong anion exchange material can be used for elution purification with a sodium chloride-sodium hydroxide system, the product collected and tubed, and desalting can be performed using a gel-packed purification column with pure water as the elution system.

[0809] 2.4.3 Annealing

[0810] According to Table 6, the sense chain (SS chain) and the antisense chain (AS chain) are mixed in a molar ratio (SS chain / AS chain = 1 / 1.05), heated in a water bath to 70-95℃, held for 3-5 minutes, and then naturally cooled to room temperature. The system is then freeze-dried to obtain the product.

[0811] siRNA conjugated with L96 and siRNA conjugated with NAG37 were obtained using a similar method.

[0812] Example 5: Screening of Huh7 cell line viability

[0813] Cell transfection

[0814] On day 1, Huh7 cell line (Nanjing Kebai, catalog number CBP60202) was digested, resuspended, and counted at 100 μL / well, 1×10⁻⁶ cells / well. 4 Cells were seeded per well in a 96-well plate, and transfection was performed 18 hours later.

[0815] The next day, the 20 μM siRNA stock solution prepared in Example 4 was diluted with Opti-MEM. 198 μL of Opti-MEM was added to 2 μL of the siRNA stock solution, and the mixture was mixed by pipetting and aspirating. The solution was then set aside for later use. For each experiment, the appropriate dilution procedure was performed according to the specific experimental requirements.

[0816] The next day, 14.1 μL of Opti-MEM was diluted with 0.9 μL of RNAiMAX (Thermo, 13778150), and the mixture was gently pipetted and incubated at room temperature for 5 min. Then, 15 μL of the prepared RNAi-MAX mixture and 15 μL of the diluted compound were gently pipetted and incubated to remove air bubbles. The mixture was incubated at room temperature for 10 min, and then 10 μL was added to each well of a 96-well plate. After incubation at 37°C and 5% CO2 for 24 h, RNA was extracted.

[0817] RNA extraction

[0818] Cell RNA was extracted using a nucleic acid extractor (Hangzhou Aosheng, Auto-pure96) following the operating procedures of the high-throughput cell RNA extraction kit (Fanzhi Medical, FG0412).

[0819] RNA reverse transcription

[0820] Preparation of denaturing reaction mixture, refer to PrimeScript TM II. 1st Strand cDNA Synthesis Kit (Takara, 6210B). Each well contains 1 μL Oligo dT Primer, 1 μL dNTP Mixture, and 12.5 μL template RNA. Denaturation reaction is performed by incubating at 65°C for 5 min in a standard PCR instrument. The mixture is then rapidly cooled on ice for 2 min.

[0821] Preparation of reverse transcription reaction solution, refer to PrimeScript. TMII 1st Strand cDNA Synthesis Kit (Takara, 6210B). Each well contains 4 μL of 5×Prime Script II Buffer, 0.5 μL of RNase Inhibitor, and 1 μL of Prime Script II RTase.

[0822] 14.5 μL of the denatured reaction solution was slowly mixed with the reverse transcription reaction solution and incubated at 42 °C for 45 min in a conventional PCR instrument for reverse transcription. The enzyme was then inactivated by incubation at 95 °C for 5 min, and the reverse transcription product (cDNA) was cooled at 4 °C.

[0823] After reverse transcription, 30 μL of distilled water free of DNase and RNase was added to each well of the cDNA sample.

[0824] Real-time PCR

[0825] ReferenceTaqMan TM The procedure for using Fast Advanced Master Mix (ABI, 4444965) was followed by quantitative real-time PCR (qPCR) in a 20 μL volume (ABI, QuantStudio3). The reaction program was: (50℃, 2 min) × 1 cycle; (95℃, 20 s) × 1 cycle; (95℃, 1 s; 60℃, 24 s) × 40 cycles.

[0826] Table 7 Primer Information

[0827]

[0828] Data statistics

[0829] Calculate 2 -ΔΔCt The value is then converted into a percentage to obtain the residual inhibition rate.

[0830] ΔΔCt=[(Ct experimental group target gene - Ct experimental group internal reference) - (Ct control group target gene - Ct control group internal reference)].

[0831] The final concentration of siRNA was 1 nM for high-throughput screening of siRNA compound cell line activity. The experimental screening results are shown in Table 8.

[0832] Table 8 shows the results of high-throughput screening of Huh7 cell line viability using 1 nM siRNA.

[0833]

[0834]

[0835] Example 6: Screening of Huh7 cell line activity using siRNA at five concentrations with 10-fold serial dilutions.

[0836] Similar to the activity screening in Example 5 above, further activity screening was performed using the Huh7 cell line.

[0837] The initial concentration of siRNA was 10 nM, and five concentration points (10 nM, 1 nM, 0.1 nM, 0.01 nM, 0.001 nM) were obtained through 10-fold serial dilutions for screening the activity of siRNA in Hep3B cell lines. The screening results are shown in Table 9, where columns 2-6 represent the residual inhibition rate and column 7 represents the IC50 value.

[0838] Table 9 shows the results of Huh7 cell line viability screening using siRNA at five different concentrations.

[0839] DR000405 19.9％ 35.9％ 68.1％ 85.0％ 102.9％ 0.0125 DR000424 7.5％ 17.3％ 50.4％ 79.1％ 95.1％ 0.0096 DR000430 12.7％ 31.2％ 74.5％ 108.0％ 97.9％ 0.0240 DR000436 7.4％ 30.7％ 84.0％ 102.4％ 101.4％ 0.0396 DR000442 10.6％ 28.1％ 69.0％ 106.0％ 102.2％ 0.0205 DR000447 9.6％ 27.9％ 69.7％ 92.1％ 99.3％ 0.0290 DR000460 4.6％ 15.1％ 62.5％ 87.4％ 89.0％ 0.0270 DR000588 8.7％ 23.4％ 61.3％ 98.8％ 96.1％ 0.0149 DR000616 9.4％ 22.1％ 49.7％ 83.4％ 94.4％ 0.0066 DR000619 4.0％ 17.8％ 45.2％ 79.8％ 99.6％ 0.0074 DR000621 4.0％ 10.9％ 51.8％ 89.0％ 88.4％ 0.0079 DR000624 4.6％ 21.8％ 62.0％ 94.7％ 90.7％ 0.0091 DR000625 15.6％ 33.2％ 70.1％ 93.5％ 106.5％ 0.0171 DR000808 4.7％ 17.4％ 61.2％ 81.0％ 94.7％ 0.0188

[0840] Example 7: Screening of human primary hepatocytes (PHH cells) for activity

[0841] Cell transfection

[0842] Take 1.4 mL of rat tail collagen solution (Sigma, C3867), add it to 40.6 mL of distilled water free of DNase and RNase, mix well, add 40 μL to each well of a 96-well culture plate, coat overnight at 4°C, and remove the coating solution the next day.

[0843] The next day, before use, the coated cell plates were rinsed with DPBS and the DPBS was removed. PHH cells (Shanghai Xuanyi, catalog number QYLF-HPMC) were revived at 37°C, added to resuscitation medium, centrifuged, resuspended, and counted. PHH cells were seeded in 96-well plates, 90 μL / well, 2 × 10⁶ cells / well. 4 Cells / well; replace with complete culture medium after 4 hours, and perform transfection after 18 hours.

[0844] On the third day, the 20 μM siRNA stock solution was diluted with Opti-MEM. 198 μL of Opti-MEM was added to 2 μL of siRNA stock solution and mixed by pipetting. This was taken as the first concentration point. The corresponding serial dilutions were performed according to the actual experimental needs.

[0845] On the third day, take 14.1 μL of Opti-MEM and dilute it with 0.9 μL of RNAiMAX (Thermo, 13778150). Gently pipette to mix and let stand at room temperature for 5 min. Then, take 15 μL of the prepared RNAi-MAX mixture and 15 μL of the diluted compound and gently pipette to mix, avoiding air bubbles. Let stand at room temperature for 10 min, then add 10 μL to each well of a 96-well plate. Incubate at 37°C in a 5% CO2 incubator for 24 h, then extract RNA.

[0846] RNA extraction

[0847] Cell RNA was extracted using a nucleic acid extractor (Hangzhou Aosheng, Auto-pure96) following the operating procedures of the high-throughput cell RNA extraction kit (Fanzhi Medical, FG0412).

[0848] RNA reverse transcription

[0849] Preparation of denaturing reaction mixture, refer to PrimeScript TM II. 1st Strand cDNA Synthesis Kit (Takara, 6210B). Each well contains 1 μL Oligo dT Primer, 1 μL dNTP Mixture, and 12.5 μL template RNA. Denaturation reaction is performed by incubating at 65°C for 5 min in a standard PCR instrument. The mixture is then rapidly cooled on ice for 2 min.

[0850] Preparation of reverse transcription reaction solution, refer to PrimeScript. TM II 1st Strand cDNA Synthesis Kit (Takara, 6210B). Each well contains 4 μL of 5×Prime Script II Buffer, 0.5 μL of RNase Inhibitor, and 1 μL of Prime Script II RTase.

[0851] 14.5 μL of the denatured reaction solution was slowly mixed with the reverse transcription reaction solution and incubated at 42 °C for 45 min in a conventional PCR instrument for reverse transcription. The enzyme was then inactivated by incubation at 95 °C for 5 min, and the reverse transcription product (cDNA) was cooled at 4 °C.

[0852] After reverse transcription, 30 μL of distilled water free of DNase and RNase was added to each well of the cDNA sample.

[0853] Real-time PCR

[0854] ReferenceTaqMan TMThe procedure for using Fast Advanced Master Mix (ABI, 4444965) was followed by quantitative real-time PCR (qPCR) in a 20 μL volume (ABI, QuantStudio3). The reaction program was: (50℃, 2 min) × 1 cycle; (95℃, 20 s) × 1 cycle; (95℃, 1 s; 60℃, 24 s) × 40 cycles.

[0855] Table 10 Primer Information

[0856] hACTB-PF ACGTGGACATCCGCAAAGAC 125 / hACTB-PR TCTTCATTGTGCTGGGTGCC 126 / hACTB-P AACACAGTGCTGTCTGGCGGCACCA 127 5'TET, 3'BHQ2 hANG3-PF CACTTCAACTGTCCAGAGGGT 128 / hANG3-PR TCCTCTTCTCCTCTCTGGCTT 129 / hANG3-P AGGCTGGTGGTGGCATGATGAGTGTGG 130 5'6-FAM, 3'BHQ1

[0857] Data statistics

[0858] Calculate 2 -ΔΔCt The value is then converted into a percentage to obtain the residual inhibition rate.

[0859] ΔΔCt=[(Ct experimental group target gene - Ct experimental group internal reference) - (Ct control group target gene - Ct control group internal reference)].

[0860] The initial concentration of siRNA was 10 nM, and it was serially diluted 10-fold to obtain 5 concentration points (10 nM, 1 nM, 0.1 nM, 0.01 nM, 0.001 nM). The activity of siRNA in human primary liver cells was screened, and the screening results are shown in Table 11. Columns 2-6 are the residual inhibition rate, and column 7 is the IC50 value.

[0861] Table 11 shows the results of screening human primary hepatocytes using five concentrations of siRNA.

[0862]

[0863]

[0864] Example 8psi CHECK2GSSM-5Hits Off-target Activity Screening

[0865] plasmid preparation

[0866] Based on the siRNA sequence, the corresponding antisense strand off-target plasmid was designed, and the psiCHECK2GSSM-5Hits recombinant plasmid was prepared by Sangon Biotech (Shanghai) Co., Ltd., and the recombinant plasmid was diluted to 1000 ng / μL for later use.

[0867] Cell transfection

[0868] In each well of a 96-well plate, seed the plate with 100 μL of HEK293A cell resuspension (Nanjing Kebai, catalog number CBP60436), and incubate at 8 × 10⁸ cm⁻¹. 3Cells / well

[0869] On the second day, the complete culture medium in the wells was first aspirated and replaced with 80 μL of Opti-MEM culture medium per well, and then starved for about 1.5 h.

[0870] siRNA preparation: Dilute the siRNA 3-fold starting from a final concentration of 40 nM, resulting in 11 concentration points (10 nM, 3.3333 nM, 1.1111 nM, 0.37037 nM, 0.12346 nM, 0.04115 nM, 0.01372 nM, 0.00457 nM, 0.00152 nM, 0.00051 nM, 0.00017 nM).

[0871] Preparation of plasmid mixture: The amount of plasmid prepared per well is 0.01 μL / well and Opti-MEM 8.99 μL / well.

[0872] Preparation of Lipo mixture: Add 2 μL of Lipo20000 and 9.8 μL of Opti-MEM to each well to dilute Lipo2000 (Lipofectamine) with Opti-MEM. TM The Lipo mixture was obtained by transfection with 2000 transfection reagent (Thermo, 11668019) and allowed to stand at room temperature for 5 min.

[0873] 22 μL of the prepared Lipo mixture, 2.2 μL of siRNA, and 19.8 μL of the plasmid mixture were aliquoted into corresponding wells and named wellA mixture. After mixing thoroughly by pipetting, the mixture was incubated at room temperature for 20 min before co-transfection. 20 μL of wellA mixture was added to each well, along with the original 80 μL of Opti-MEM, for a final volume of 100 μL per well. After incubation at 37°C and 5% CO2 for 4 h, 100 μL of DMEM medium containing 20% ​​fetal bovine serum was added to each well. The cells were then incubated at 37°C and 5% CO2 for 24 h before detection.

[0874] Result detection

[0875] Before the experiment, mix the Dual- Luciferase (Dual- The Luciferase AssaySystem (Promega, E2940) was reconstituted and, after equilibration to room temperature, DMEM was added to each tube at a 1:1 ratio to prepare substrate I. The mixture was prepared fresh for immediate use. The Dual- Stop & Remelt the buffer and, after equilibration to room temperature, mix it with Dual- Stop & Prepare substrate II using a 100:1 ratio of substrate 100:1, and use immediately. Remove the existing culture medium from the 96-well plate using a vacuum pump. Add 150 μL of substrate I to each well and incubate on a shaker at room temperature for 10 min. Transfer 120 μL of substrate I to a 96-well microplate and read the Firefly chemiluminescence value using a Tecan (Infinite 200) microplate reader. Add 60 μL of substrate II to each well and incubate on a shaker at room temperature for 10 min. Read the Renilla chemiluminescence value using a microplate reader.

[0876] Data Analysis and Processing

[0877] Fluorescence activity was measured using a microplate reader. The collected Renilla signals were normalized using the Firefly signal standard. The inhibitory effect of siRNA was determined by comparing the results without treatment (residual inhibitory activity). The calculation process is as follows:

[0878] Homogenized Ren / Fir ratio: Ratio = Renilla (renilla luciferase) / Firefly (firefly luciferase).

[0879] Residual inhibition rate = (RatiosiRNA / Ratiocontrol)*100%, take the average of two replicates: where Ratiocontrol is the Ratio value of the control well (without siRNA) (take the average of two replicates).

[0880] Plotting: Using Graphpad Prism

[0881] Half-maximal inhibitory concentration (IC50): In this experiment, the top and bottom plots were used. The IC50 value was obtained by the formula Y = Bottom + (Top - Bottom) / (1 + 10^((LogIC50 - X) * HillSlope)), where Y = 50 and X = log(concentration).

[0882] The off-target activity screening results of siRNAs in psiCHECK2 GSSM-5Hits are shown in Table 12, where columns 2-12 represent the residual inhibition rate and column 13 represents the IC50 value. The results indicate that DR000405, DR000424, DR000430, DR000442, DR000447, DR000619, and DR000621, disclosed in this study, exhibited lower off-target activity against HEK293A cells compared to the positive control DR001483.

[0883] Table 1. Off-target activity screening results of 2psiCHECK2 GSSM-5Hits

[0884]

[0885] Example 9: Screening of mouse HDI model activity

[0886] HDI Animal Modeling

[0887] Using a tail vein high-pressure injection method, six- to eight-week-old female Balb / c mice were transfected in vivo using a dual-gene stable transfection system. The transfection model was established via the tail vein, and within 5-7 seconds, Piggy-Bac transposon plasmid (purchased from Suzhou Bangye) and Piggy-Bac helper plasmid (purchased from Suzhou Bangye) containing different mass ratios of the target gene cDNA sequence (Genbank accession number NM_014495.2) (mass ratio 1:1, total plasmid amount 100ug) were injected. The delivery solution (total volume of 10% of animal body weight, Mirusbio-MIR 5240) was injected into mice, and they were placed back in their cages for observation for 30 minutes after injection. Serum samples were collected at various time points after modeling (day 7-day 35) to detect SEAP expression levels, with the day of modeling as day 0.

[0888] The dual-gene stable transfection system includes a Piggy-Bac helper plasmid and a Piggy-Bac transposon plasmid. The Piggy-Bac helper plasmid provides the Piggy-Bac transposase. The Piggy-Bac transposon plasmid is based on the Piggy-Bac transposon and contains a dual-gene expression element containing the secretory alkaline phosphatase gene (SEAP) and the target gene (ANGPTL3). SEAP and ANGPTL3 are co-expressed.

[0889] Detection of SEAP expression

[0890] Reagent kit (Phospha-Light) TM SEAP reporter gene assay system (Invitrogen, T1016) standard was diluted 2-fold at an initial concentration of 15 mU / mL to obtain 7 concentration points.

[0891] Mix the CSPD substrate with the reaction buffer at a ratio of 1:20 to prepare the reaction solution. Dilute the 5× dilution buffer to 1× dilution buffer with distilled water free of DNase and RNase. Mix the serum with the 1× dilution buffer in a centrifuge tube to prepare the sample dilution solution. Incubate the sample dilution solution at 65°C for 30 min, then cool to room temperature. Add 50 μL of the sample dilution solution to each well of a 96-well plate, then add 50 μL of assay buffer to each well and incubate at room temperature for 5 min. Add 50 μL of reaction solution to each well and incubate at room temperature for 20 min. Read the SEAP chemiluminescence value on a microplate reader (Tecan, Infinite 200).

[0892] The efficacy of siRNA compounds in inhibiting target gene expression was evaluated by measuring SEAP expression levels in serum. Lower SEAP chemiluminescence values ​​indicated better inhibition of target gene expression by the siRNA compounds. Samples capable of inhibiting SEAP expression levels were selected as nucleic acid drugs.

[0893] On day 15 after modeling, mice were given a single subcutaneous administration according to Table 13: 200 μl of physiological saline containing 3 mg / kg (mpk) RNAi reagent; or 200 μl of physiological saline without RNAi reagent as a control (vehicle). The HDI model screening results are shown in Table 14.

[0894] Table 13 Dosage of RNAi reagent administered subcutaneously to mice in a single dose

[0895]

[0896]

[0897] Table 14 Experimental results of the HDI stable plasmid mouse model

[0898]

[0899] Example 10: Screening of HDI activity in mouse model

[0900] According to the method in Example 9 above, the sequences in Table 15 were further screened for activity, and the results are shown in Table 16.

[0901] Table 15. siRNA Sequences

[0902]

[0903] Table 16. Experimental results of the HDI stable plasmid mouse model

[0904]

[0905]

[0906] Example 11 Screening of mouse HDI model activity

[0907] According to the method of Example 9, the sequences in Table 17 were further screened for activity, and the results are shown in Table 18.

[0908] Table 17. siRNA sequences

[0909]

[0910]

[0911] Table 18. Experimental results of the HDI stable plasmid mouse model

[0912]

Claims

1. A siRNA for inhibiting the expression of ANGPTL3 protein in cells, said siRNA comprising a sense strand and an antisense strand forming a double-stranded region, wherein: (a) The chain of justice is STM1s-UmsCmCmAmCmGmUmUmGfCfUfUmGmAmAmAmUmUmGmAmAms-STM1s-GL6, The antisense chain is UmsUfsCmAfAmUfUmUfCmAfAmGfCmAfAmCfGmUfGmsGfsAm; (b) The chain of justice is STM1-STM1-UmsCmCmAmCmGmUmUmGfCfUfUmGmAmAmAmUmUmGmAmsAm-STM1-STM1s-GL6, The antisense chain is UmsUfsCmAfAmUfUmUfCmAfAmGfCmAfAmCfGmUfGmsGfsAm; or, (c) The chain of justice is STM1s-UmsCmCmAmCmGmUmUmGfCfUfUmGmAmAmAmUmUmGmAmAm-STM1-STM1s-GL6, The antisense chain is UmsUfsCmAfAmUfUmUfCmAfAmGfCmAfAmCfGmUfGmsGfsAm; Wherein, STM1 represents the nucleotide substitution with the following structure: ， Wherein, GL6 represents the GalNAc delivery vector with the following structure, wherein Indicates the position where the phosphate ester group or thiophosphate ester group is linked to the siRNA. 。 2. A cell containing the siRNA as described in claim 1.

3. A pharmaceutical composition comprising siRNA as claimed in claim 1, or cells as claimed in claim 2, and optionally a pharmaceutically acceptable carrier or excipient.

4. A kit comprising the siRNA as claimed in claim 1, the cells as claimed in claim 2, or the pharmaceutical composition as claimed in claim 3.

Images