Use of Z4225448710 in the preparation of a medicament for inhibiting the activity of African swine fever virus E165R protein
Patent Information
- Application Number
- CN202411869914.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-18
- Publication Date
- 2026-09-15
- Estimated Expiration
- 2044-12-18
AI Technical Summary
然而,目前针对非洲猪瘟病毒E165R蛋白的药物研究并不常见
[0017]Beneficial Effects: Compared with existing technologies, this invention has the following significant advantages: This invention targets the ASFVE165R protease active domain and uses Autodock Vina for molecular docking. Virtual screening from over 440,000 compounds yielded a small molecule inhibitor, Z4225448710, targeting the ASFVE165R protein. Molecular dynamics simulations were conducted, elucidating the interaction mechanism between the small molecule compound and the target protein at the molecular level. This small molecule compound exhibits no significant cytotoxicity at the cellular level and significantly inhibits ASFVE165R protein activity at concentrations ranging from 0.5 to 128 μM, demonstrating its potential as an active ingredient in drugs targeting African swine fever virus.
Smart Images

Figure CN119587541B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of chemical pharmaceuticals, specifically relating to the application of the small molecule compound Z4225448710 in the preparation of a drug that inhibits the activity of the African swine fever virus E165R protein. Background Technology
[0002] African swine fever virus (ASFV) is a complex nucleoplasmic large DNA virus that infects domestic and wild pigs of all ages, causing highly fatal African swine fever (ASF). Initially prevalent in most of sub-Saharan Africa, ASF has rapidly spread to numerous countries worldwide within a century, posing a serious threat to the global pig farming industry. To date, there are still no safe and effective vaccines or drugs for the prevention or treatment of ASF.
[0003] ASFV encodes a dUTP nucleotide hydrolase (dUTPase) called E165R. E165R belongs to the class I dUTPase family, which includes dUTPases from humans, Escherichia coli, feline immunodeficiency virus, equine infectious anemia virus, Mycobacterium tuberculosis, and white spot syndrome virus. Proteins with these characteristics are found to be universally expressed in a variety of organisms and viruses. The E165R gene is similar to the Mycobacterium tuberculosis dUTPase in terms of overall protein structure and active site. E165R is located in the cytoplasm of infected cells and maintains viral genome fidelity during replication by regulating the deoxyuridine triphosphate (dUTP) / deoxyuridine triphosphate (dTTP) ratio. Previous studies have shown that the deletion of E165R can significantly inhibit ASFV replication in vitro. Therefore, E165R can serve as a potential drug target for inhibiting ASFV infection. The availability of high-resolution crystal structures for E165R provides a basis for the development of ASFV-related immunogenic drugs. However, drug research targeting the E165R protein of African swine fever virus is currently uncommon. Therefore, it is more meaningful to search for compounds that target E165R and inhibit ASFV replication. Summary of the Invention
[0004] Purpose of the invention: The technical problem to be solved by the present invention is to provide the application of the small molecule compound Z4225448710 in the preparation of drugs that inhibit the activity of African swine fever virus E165R protein.
[0005] Technical solution: In order to solve the above-mentioned technical problems, the present invention provides the application of the small molecule compound Z4225448710 in the preparation of drugs for diseases related to the activity of African swine fever virus E165R protein or in the preparation of formulations that inhibit the activity of African swine fever virus E165R protein.
[0006] The molecular formula of the small molecule compound Z4225448710 is C 19 H 20 N6O3, structural formula:
[0007]
[0008] The IUPAC name of the small molecule compound Z4225448710 is N-[({4H,5H,6H,7H,8H-cyclohepta[d][1,2]oxazol-3-yl}carbamoyl)amino]-3-phenyl-1H-pyrazole-5-carboxamide.
[0009] The drug or preparation mentioned includes single-ingredient or compound preparations.
[0010] The concentration of the small molecule compound Z4225448710 in the drug or preparation is 0.5–128 μM.
[0011] The dosage form of the compound preparation is selected from tablets, sprays, granules, capsules, oral liquids, injections, or suspensions.
[0012] The drug or preparation includes a pharmaceutically acceptable carrier, which includes at least one of excipients, glidants, diluents, preservatives, colorants, flavoring agents, wetting agents, suspending agents, stabilizers, isotonic agents, solvents, and emulsifiers.
[0013] The present invention also includes a pharmaceutical preparation for combating African swine fever virus, wherein the active ingredient in the pharmaceutical preparation includes the small molecule compound Z4225448710.
[0014] The concentration of the small molecule compound Z4225448710 in the aforementioned anti-African swine fever virus drug formulation is 0.5–128 μM.
[0015] The present invention also includes a formulation for inhibiting the activity of African swine fever virus E165R protein, wherein the active ingredient in the formulation includes the small molecule compound Z4225448710.
[0016] The concentration of the small molecule compound Z4225448710 in the preparation for inhibiting the activity of African swine fever virus E165R protein is 0.5–128 μM.
[0017] Beneficial Effects: Compared with existing technologies, this invention has the following significant advantages: This invention targets the ASFVE165R protease active domain and uses Autodock Vina for molecular docking. Virtual screening from over 440,000 compounds yielded a small molecule inhibitor, Z4225448710, targeting the ASFVE165R protein. Molecular dynamics simulations were conducted, elucidating the interaction mechanism between the small molecule compound and the target protein at the molecular level. This small molecule compound exhibits no significant cytotoxicity at the cellular level and significantly inhibits ASFVE165R protein activity at concentrations ranging from 0.5 to 128 μM, demonstrating its potential as an active ingredient in drugs targeting African swine fever virus. Attached Figure Description
[0018] Figure 1 This is a schematic diagram showing the binding pattern of the small molecule compound Z4225448710 with the ASFV E165R protein monomer structure.
[0019] Figure 2 Purification and identification of ASFV E165R protein; Figure 2 A represents the purification status of ASFV E165R protein as determined by SDS-PAGE, where lane M is the Protein Marker and lanes 1, 2, 3, and 4 represent the purified protein. Figure 2 B is for Western Blot validation of ASFV E165R protein, where lane M is Protein Marker, lane 1 is purified E165R protein, and lane 2 is pCold control.
[0020] Figure 3 The results show the SPR affinity determination of the small molecule compound Z4225448710 with the ASFV E165R protein. Figure 3 A shows the coupling sensing diagrams of compound Z4225448710 at different concentrations on the chip surface; Figure 3 B represents the kinetic fitting curves of compound Z4225448710 at different concentrations on the chip surface.
[0021] Figure 4 Cytotoxicity evaluation of compound Z4225448710 at different concentrations.
[0022] Figure 5 The enzyme activity inhibition assay was performed to determine the inhibitory activity of compound Z4225448710 on the African swine fever virus E165R protein. Detailed Implementation
[0023] The technical solution of the present invention will be further described below with reference to the accompanying drawings.
[0024] Unless otherwise stated, the experimental methods, detection methods, and preparation methods disclosed in this invention all employ conventional techniques in molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related fields. These techniques have been well described in existing literature; see Sambrook et al., *MOLECULAR CLONING: ALABORATORY MANUAL*, Second edition, Cold Spring Harbor Laboratory Press, 1989 and Third edition, 2001; Ausubel et al., *CURRENT PROTOCOLS IN MOLECULAR BIOLOGY*, John Wiley & Sons, New York, 1987 and periodic updates; these series *METHODS IN ENZYMOLOGY*, Academic Press, San Diego; Wolffe, *CHROMATINSTRUCTURE AND FUNCTION*, Third edition, Academic Press, San Diego, 1998; *METHODS IN ENZYMOLOGY*, Vol. 304, Chromatin (PM Wassarman and AP Wolffe, eds.), Academic Press, San Diego, 1999; and *METHODS IN MOLECULAR*. BIOLOGY, Vol. 119, Chromatin Protocols (PB Becker, ed.) Humana Press, Totowa, 1999, etc.
[0025] Example 1: Screening of small molecule compounds based on the E165R protein structure
[0026] Since the structure of the E165R protein is known, the ASFV E165R structure data (PDB ID: 6LJ3) was downloaded from the protein structure library. Water molecules, impurity atoms, and metal ions that did not form coordination relationships in the crystal were removed, and the energy of the entire protein structure was minimized to obtain the monomer structure for subsequent virtual screening.
[0027] 3D structures of 448,388 compounds were downloaded from the Enamine Advanced drug database, and molecular docking was performed using AutodockVina software. The specific steps are as follows: Binding pocket locations were defined based on the E165R active site (X-axis: -9.695, Y-axis: 14.741, Z-axis: -7.291), and the bin size was set to... The protein monomer structure was imported and docked using Autodock Vina software to screen for E165R inhibitors. The quality of small molecule compounds was assessed based on the predicted results. Compounds with an affinity less than -10 kcal / mol were selected as candidate compounds (Z4225448710) for further affinity verification with the protein. The figure shows the binding mode of small molecule compound Z4225448710 to the ASFV E165R protein monomer structure. Figure 1 ).Depend on Figure 1 It is known that the small molecule compound Z4225448710 interacts with multiple amino acids of the E165R protein. For example, it forms hydrogen bonds with Arg71 and Ser72, exhibits π-π stacking interactions with Tyr94, and has hydrophobic interactions with Ile23, Ile90, and Ile132.
[0028] Example 2: Expression and purification of ASFV E165R protein
[0029] (1) Construction of prokaryotic expression plasmid pCold-E165R
[0030] Using the genome of African swine fever virus strain CHINA / 2018 / AnhuiXCGQ as a template, the E165R sequence (SEQ ID NO: 3) was amplified by PCR using forward primer (SEQ ID NO: 1: 5'-atggagctcggtaccctcgagATGGCAACAAATTTTTTTATTCAACC-3') and reverse primer (SEQ ID NO: 2: 5'-agcagagattacctatctagaTTAAGTTCTCATAATCCCGGCC-3').
[0031] ATGGCAACAAATTTTTTTATTCAACCTATCACCGAAGAAGCTGAAGCATACTACCC
[0032] ACCTTCCGTGATAACGAATAAACGGAAGGACCTGGGGGTAGACGTATACTGTTGCT
[0033] CCGACCTAGTGCTTCAACCTGGACTAAATATTGTTCGCCTGCATATTAAAGTAGCAT
[0034] GCGAACACATGGGCAAAAAATGCGGTTTTAAAATCATGGCGAGAAGCAGTATGTG
[0035] CACCCATGAACGGCTGCTCATCCTTGCAAACGGAATTGGTTTAATAGACCCGGGTT
[0036] ATGTGGGCGAGCTCATGCTCAAGATCATTAATCTTGGCGACAACCCGGTCCAAATA
[0037] TGGGCCAAAGAATGTTTGGTGCAGTTGGTGGCCCAAGGTGACCATGTGCCTGACC
[0038] The gene ATATCAACATCCTAAAAAGAAACCAAATATTTCCGCTGTTTGCGCCTACCCCAAGAGGCGAGGGTAGATTTGGGAGCACGGGCGAGGCCGGGATTATGAGAACTTAA) was then recovered by agarose gel electrophoresis. The PCR product was ligated into a linearized pCold vector (catalog number 3361, TAKARA) digested with XhoI and XbaI using a one-step ligase, and transformed into DH5α competent cells. Single colonies were picked for identification, and positive clones were sequenced (Qingke Biotechnology Co., Ltd.) to obtain the prokaryotic expression plasmid pCold-E165R.
[0039] (2) Expression and purification of E165R protein
[0040] The pCold-E165R plasmid was transformed into BL21 competent cells. Single clones were picked and cultured in LB resistant medium at 37°C until OD = 0.6-0.8. Expression was induced at 15°C with the addition of 0.5 mM IPTG, and the target protein was purified using a His purification column, yielding a highly pure E165R protein of approximately 19 kDa. Western blotting analysis of the purified protein with a His tag primary antibody showed a specific band at 19 kDa, confirming the correctness of the target protein. Figure 2 ).
[0041] Example 3: Affinity determination (SPR) of small molecule compound Z4225448710 with artificially expressed E165R protein.
[0042] The interaction between the compound and the E165R protein was analyzed using a Biacore T200 surface plasmon resonance (SPR) analyzer. The instruments used were the Biacore T200, and the materials used included: NTA sensor chip (catalog number 28994951, Cytiva); E165R protein; compound Z4225448710 (catalog number Z4225448710, purchased from Shanghai Taoshu Biotechnology Co., Ltd.); HBS running buffer (catalog number BR100670, Cytiva); NTAreagent kit (catalog number 28995043, Cytiva); and analytical grade DMSO.
[0043] The specific experimental steps are as follows:
[0044] (1) Chip pretreatment and nickel ion chelation: Without activating the chip surface, the NTA sensor chip was rinsed with HBS running buffer until the baseline was stable. Then, nickel solution from the NTAreagent kit was injected to chelate nickel ions onto the NTA sensor chip surface. After the nickel solution was saturated with NTA sensor chip, it was washed with 3mM EDTA and waited for the binding of E165R protein.
[0045] (2) E165R protein conjugation: The recombinant E165R protein prepared in Example 2 was prepared to a concentration of 20 μg / mL using HBS running buffer. The protein was injected at a flow rate of 10 μL / min for 10 min, with channel Fc-2 set as the conjugated protein channel and channel Fc-1 as the control channel.
[0046] (3) Preparation of HBS running buffer and compound: Dissolve compound Z4225448710 in DMSO and prepare different concentrations (3.125, 6.25, 12.5, 25, 50, 100 μg / mL) with HBS running buffer containing 5% DMSO. At the same time, prepare 5% DMSO concentration calibration curves with 4.5% and 5.8% calibration stock solutions (DMSO concentration points are 4.5%, 4.7%, 4.9%, 5%, 5.2%, 5.4%, 5.6%, 5.8%, respectively).
[0047] (4) Kinetic detection: The compounds of different concentrations obtained in step 3) were injected at a flow rate of 30 μL / min for 1 min and dissociated for 2 min for kinetic detection. After dissociation, the compounds bound to the chip surface were eluted so that the chip could be reused.
[0048] (5) Data Analysis: Kinetic analysis was performed based on the simulation model. First, solvent correction was performed, and then affinity fitting analysis was performed on the exported compound data to obtain affinity KD data.
[0049] The results showed that the equilibrium dissociation constant KD of the small molecule compound Z4225448710 and the ASFV E165R protein was 8.88 μM. Figure 3 This indicates that it has high binding activity to the E165R protein and may be a potential small molecule antagonist of the ASFV E165R protein.
[0050] Example 4: Detection of the cytotoxicity of different concentrations of compound Z4225448710 on PAM cells using the CCK-8 assay.
[0051] PAM cells were spaced at 1.5 × 10⁶ cells per well. 5 The cells were seeded in 96-well plates and cultured at 37°C until fully adherent. The small molecule compound Z4225448710 was serially diluted with 1640 medium containing 2% serum and added to the PAM cells. After culturing at 37°C for 48 hours, the cell culture medium was discarded, and 100 μL of serum-free 1640 medium and 10 μL of CCK-8 solution (Dongren Chemical Technology Co., Ltd.) were added to each well in the dark. After further incubation at 37°C for 1 hour, the absorbance of the cells was measured at 450 nm.
[0052] The results showed that at a concentration of 200 μM, the small molecule compound Z4225448710 maintained a PAM cell survival rate of over 80% and did not affect PAM cell survival. Figure 4 ).
[0053] Example 5 Enzyme Activity Inhibition Experiment: Determination of the inhibitory activity of compound Z4225448710 on African swine fever virus E165R protein.
[0054] Take 10 enzyme centrifuge tubes and add 5 μL of recombinant ASFV E165R protein (1.05 mg / mL) prepared in Example 2 and 5 μL of Z4225448710 at different concentrations (0 μM, 0.5 μM, 1 μM, 2 μM, 4 μM, 8 μM, 16 μM, 32 μM, 64 μM, 128 μM), respectively. Incubate in a metal bath at 37°C for 3 min. Then, add 1 μL of dUTP (100 mmol / L) to each tube and place them in a 37°C metal bath. After 1 min, stop the heating and add DEPC to each centrifuge tube to a total volume of 800 μL. Vortex for 30 s. Then, add 50 μL of molybdic acid, 100 μL of solution A (5 g sodium bisulfite and 0.25 g sodium sulfite dissolved in 50 mL distilled water), and 50 μL of solution C (5 g sodium bisulfite and 0.25 g sodium sulfite dissolved in 50 mL distilled water) in sequence. Vortex for 30 s and let stand at room temperature for 10 min. Then, add 100 μL of solution B (solution B is obtained by diluting solution A 15 times with distilled water), 50 μL of solution C, and 100 μL of anhydrous ethanol in sequence. Vortex for 30 s and measure the 575 nm OD value.
[0055] Experimental results show that compound Z4225448710 of the present invention can significantly inhibit the activity of E165R protein at concentrations of 0.5–128 μM. Figure 5 ).
Claims
1. The application of the small molecule compound Z4225448710 in the preparation of drugs against African swine fever virus, characterized in that, The molecular formula of the compound Z4225448710 is C 19 H 20 N6O3, structural formula: 。 2. The application according to claim 1, characterized in that, The drugs include single-ingredient or compound preparations.
3. The application according to claim 1, characterized in that, The concentration of the small molecule compound Z4225448710 in the drug is 0.5~128 μM.
4. The application according to claim 2, characterized in that, The dosage form of the compound preparation is selected from tablets, sprays, granules, capsules, oral liquids, injections, or suspensions.
5. The application according to claim 1, characterized in that, The drug includes a pharmaceutically acceptable carrier, which includes at least one of a flow aid, diluent, preservative, colorant, flavoring agent, wetting agent, suspending agent, stabilizer, isotonic agent, solvent, and emulsifier.