Two herbicide-tolerant genes of eriodictyon and their applications

Abstract

The application discloses two herbicide-resistant genes of Puccinellia distans and application thereof, and belongs to the technical field of herbicide-resistant genes.The CDS sequences of the PfGSTup and PfGSTl1 genes of Puccinellia distans are disclosed for the first time, the CDS sequence of the PfGSTup gene is shown as SEQ ID NO.1, and the CDS sequence of the PfGSTl1 gene is shown as SEQ ID NO.4;the PfGSTup and PfGSTl1 genes are expressed in E.coli for the first time, and the transgenic E.coli can obtain the drug resistance to mesosulfuron-methyl, two new mesosulfuron-methyl-resistant GST family candidate genes derived from Puccinellia distans are provided;the provided PfGSTup and PfGSTl1 genes can be used for the culture of wheat varieties resistant to ALS inhibitor herbicides, and provide two candidate genes for the research on the mechanism of Puccinellia distans resistant to ALS inhibitor herbicides, the resistance detection of Puccinellia distans, and the determination of the use period and the use amount of the herbicide.

Description

Technical Field

[0001] This invention relates to the field of herbicide resistance gene technology, and in particular to two herbicide-resistant genes of *Gnaphalium affine* and their applications. Background Technology

[0002] Herbicide resistance in weeds refers to the ability of weeds that were previously effectively controlled with certain doses of herbicides to survive and reproduce even with the same or higher doses of the same herbicide. The continuous evolution of herbicide resistance in weeds is influenced by various factors, such as herbicide type, weed type, and pollination method. According to statistics from the Global Resistant Weeds Network (www.weedscience.org), as of November 2024, 273 weed species worldwide had developed resistance to 168 herbicides with 21 different mechanisms of action. The most serious problem is resistance to acetolactate synthase (ALS, EC 4.1.3.18) inhibitor herbicides, with 175 weed species already resistant to these inhibitors.

[0003] Acetolactate synthase (ALS) or AHAS (Acetohydroxyacid synthase) is a crucial enzyme in the biosynthesis of branched-chain amino acids. ALS is a key enzyme in the first stage of the biochemical reactions necessary for plant life processes, specifically the synthesis of isoleucine, leucine, and valine. ALS inhibitor herbicides bind to the pathway through which substrates enter the catalytic reaction center, inhibiting the synthesis of branched-chain amino acids by blocking substrate access to the enzyme reaction center. This leads to the inhibition of related protein synthesis, ultimately interfering with normal plant cell mitosis, causing plant growth arrest and death. ALS inhibitor herbicides are widely used globally due to their broad-spectrum weed control, high crop selectivity, low mammalian toxicity, and environmental friendliness. Methsulfuron-methyl is a widely used ALS inhibitor herbicide, effective against both grasses and broadleaf weeds, with particularly strong control over gramineous weeds.

[0004] Polypogon fugitives (Polypogon fugitives) are annual overwintering weeds belonging to the genus Polypogon of the Poaceae family. They possess wide adaptability and easily become dominant species in their growing environment. Their growth cycle coincides with that of summer-ripening crops such as wheat and rapeseed, making them one of the major pests in these fields. In pursuit of better control, farmers have indiscriminately increased herbicide usage (repeatedly using the same type of herbicide), leading to varying degrees of resistance to different types of herbicides. In recent years, their damage has intensified annually. Identifying herbicide-resistant functional genes in Polypogon fugitives can clarify the resistance mechanism to mesosulfuron-methyl, providing a theoretical basis for the scientific and rational chemical control of resistant Polypogon fugitives and offering potential genetic resources for transgenic crop breeding. Furthermore, molecular interaction analysis between the detoxification proteins encoded by resistance genes and herbicides is valuable for herbicide structure optimization and the design of novel herbicides. Summary of the Invention

[0005] The purpose of this invention is to provide two herbicide-resistant genes for *Clerodendrum trichotomum* and their applications. These genes provide candidate genes for studying the mechanism of *Clerodendrum trichotomum* resistance to mesosulfuron-methyl and for breeding herbicide-resistant wheat varieties. This will contribute to the effective control of *Clerodendrum trichotomum*, sustainable agricultural development, and food security.

[0006] To achieve the above objectives, the present invention provides two herbicide-tolerant genes for *Gnaphalium affine*, the CDS sequence of the PfGSTup gene is shown in SEQ ID NO.1, and the CDS sequence of the PfGSTl1 gene is shown in SEQ ID NO.4.

[0007] As mentioned above, the two herbicide-resistant genes of *Gnaphalium affine* play a role in mesosulfuron-methyl resistance. Expression of the PfGSTup and PfGSTl1 genes increases resistance to mesosulfuron-methyl.

[0008] The application of the two herbicide-resistant genes in *Triticum aestivum* as described above in detecting resistance to mesosulfuron-methyl.

[0009] The above-mentioned application of the two herbicide-tolerant genes of *Gnaphalium affine* in the selection and dosage of herbicides for *Gnaphalium affine* is described in the context of testing whether *Gnaphalium affine* is suitable for control with mesosulfuron-methyl and the effective dosage of mesosulfuron-methyl.

[0010] The above-mentioned application of the two herbicide-tolerant genes of *Gnaphalium affine* in the breeding of herbicide-tolerant wheat varieties, wherein the herbicide is an ALS inhibitor herbicide.

[0011] Preferably, the herbicide is mesosulfuron-methyl.

[0012] Therefore, the two herbicide-resistant genes of *Gnaphalium affine* provided by this invention and their applications have the following specific technical effects:

[0013] (1) This invention discloses for the first time the CDS sequences of the PfGSTup and PfGSTl1 genes of *Gnaphalium affine*. The CDS sequence of the PfGSTup gene is shown in SEQ ID NO.1. The CDS sequence of the PfGSTl1 gene is shown in SEQ ID NO.4. Both PfGSTup and PfGSTl1 genes belong to the GST family.

[0014] (2) This invention is the first to discover that expressing the PfGSTup and PfGSTl1 genes in Escherichia coli can enable transgenic Escherichia coli to acquire resistance to mesosulfuron-methyl, providing two new candidate genes of the mesosulfuron-methyl resistance GST family derived from sphagnum moschata.

[0015] (3) By performing molecular docking analysis between PfGSTup and PfGSTl1 genes and mesosulfuron, it was shown that both PfGSTup and PfGSTl1 genes have a high binding capacity with mesosulfuron, and can conjugate reduced glutathione and oxidized herbicide molecules, which has a certain promoting effect on detoxification metabolism.

[0016] (4) The PfGSTup and PfGSTl1 genes provided by this invention can be used to breed wheat varieties resistant to ALS inhibitor herbicides, and provide two candidate genes for studying the mechanism of ALS inhibitor herbicide resistance of *Gnaphalium affine*, detecting resistance of *Gnaphalium affine*, and determining the timing and dosage of application. Attached Figure Description

[0017] To more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings used in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 These are electrophoresis gel images of the PCR products of the cloned PfGSTup gene in Example 1 and the cloned PfGSTl1 gene in Example 2 of this invention.

[0019] Figure 2 This is the NCBI online BLAST alignment analysis result of the amplified sequence in Embodiment 3 of the present invention;

[0020] Figure 3This is the result of comparing the PfGSTup gene cloning sequence with the Unigene obtained from the transcriptome sequencing data of *Gnaphalium affine* using UGENE 50.0 in Example 3 of this invention; where TRINITY_DN32199_c0_g1_i3_2_PfGSTup\revcompl is the reverse complementary sequence of the Unigene obtained from the transcriptome sequencing of *Gnaphalium affine*, and PfGSTup_Clone and PfGSTup_Expression are the constructed cloning vector sequence and expression vector sequence, respectively;

[0021] Figure 4 This is the result of comparing the protein sequence encoded by the PfGSTup gene with the protein sequence encoded by the Unigene obtained from the transcriptome sequencing data of *Clematis chinensis* using UGENE 50.0 in Example 3 of this invention; where TRINITY_DN32199_c0_g1_i3_2_PfGSTup is the protein sequence encoded by the Unigene obtained from the transcriptome sequencing of *Clematis chinensis*, and PfGSTup_Clone and PfGSTup_Expression are the protein sequences encoded by the target gene inserted into the constructed cloning vector and expression vector, respectively;

[0022] Figure 5 This is the NCBI online BLAST alignment analysis result of the amplified sequence in Embodiment 4 of the present invention;

[0023] Figure 6 This is the result of comparing the PfGSTl1 gene cloning sequence with the Unigene obtained from the transcriptome sequencing data of *Gnaphalium affine* using UGENE 50.0 in Example 4 of this invention; where TRINITY_DN42636_c0_g1_i1_3_PfGSTl1\revcompl is the reverse complementary sequence of the Unigene obtained from the transcriptome sequencing of *Gnaphalium affine*, and PfGSTl1_Clone and PfGSTl1_Expression are the constructed cloning vector sequence and expression vector sequence, respectively;

[0024] Figure 7 This is the result of comparing the protein sequence encoded by the PfGSTl1 gene with the protein sequence encoded by the Unigene obtained from the transcriptome sequencing data of *Clematis chinensis* using UGENE 50.0 in Example 4 of this invention; where TRINITY_DN42636_c0_g1_i1_3_PfGSTl1 is the protein sequence encoded by the Unigene obtained from the transcriptome sequencing of *Clematis chinensis*, and PfGSTl1_Clone and PfGSTl1_Expression are the protein sequences encoded by the target gene inserted into the constructed cloning vector and expression vector, respectively;

[0025] Figure 8These are colony photographs from Embodiment 7 of the present invention;

[0026] Figure 9 This refers to the colony count results in Example 7 of the present invention;

[0027] Figure 10 This is the docking result of mesosulfuron-methyl with PfGSTup molecules in Example 9 of the present invention; where A represents the binding of PfGSTup protein structure with mesosulfuron-methyl and reduced glutathione (GSH), the yellow compound is mesosulfuron-methyl, and the green compound is reduced glutathione; B represents the binding site, amino acid, and hydrogen bond length of mesosulfuron-methyl with PfGSTup; and C represents the binding site, amino acid, and hydrogen bond length of reduced glutathione with PfGSTup.

[0028] Figure 11 This is the docking result of mesosulfuron-methyl with PfGSTl1 molecules in Example 9 of the present invention; where A represents the binding of PfGSTl1 protein structure with mesosulfuron-methyl and reduced glutathione, the red compound is mesosulfuron-methyl, and the yellow compound is reduced glutathione; B represents the binding site, amino acid, and hydrogen bond length of mesosulfuron-methyl with PfGSTl1; and C represents the binding site, amino acid, and hydrogen bond length of reduced glutathione with PfGSTl1. Detailed Implementation

[0029] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments.

[0030] To make the objectives, technical solutions, and advantages of this application clearer, more thorough, and more complete, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings and embodiments. The following detailed descriptions are all descriptions of embodiments, intended to provide further detailed explanation of the present invention. Unless otherwise specified, all technical terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0031] The instruments, equipment, reagents and materials used in the examples were all obtained commercially; the experimental steps not described in detail are conventional methods in the art.

[0032] Example 1

[0033] The specific steps for cloning the PfGSTup gene from *Clematis chinensis* are as follows:

[0034] S11. The full-length CDS of the PfGSTup gene sequence was obtained by transcriptome sequencing. The CDS sequence of the PfGSTup gene is shown in SEQ ID NO.1. Specific primers for amplifying the full length of the PfGSTup gene were designed. The upstream primer sequence is shown in SEQ ID NO.2, and the downstream primer sequence is shown in SEQ ID NO.3. The primer sequence information was sent to Sangon Biotech (Shanghai) Co., Ltd. to synthesize primers.

[0035] SEQ ID NO.1:

[0036] ATGGCCGGAGGAGAAAACAAGGAAGTGAAGGTGCTGGGCATGTGGGCGAGCCCGTTCGTCCTGCGAGTGCGGCTTGCGCTCAGCCTCAAGGGCATCAGCTACGAGTACGTCGAGGAGGACCTCAAGAGCAAGAGCGAGCTGCTCCTGACATCCAACCCCGTGCACAAGGCGGTGCC TGTGCTGCTCCACGACGGCAAGTCCGTCTGCGAGTCGTCGGTCATCCTGCAATACATAGACGAGGCCTTCACCGGCGTGGGGCCCCTCTCTCCTCCCGGAGGATCCCCATGACCGCGCCAATGCTCGTTTCTGGGCCGCTTACATTGACGACAAGCTGGTGAAAGCGTCGAACCAGG CGTCGAGGGGCAAGACGGAGGAGGAGAAGGAGGAGGGAAAGAAGCAGGCAGCCGCCGCGGTGGAAACCCTGGAGGGAGCCCTGAAGGAGTGCTCCAAGGGGAAACATTCTTCGGTGGCGACAGTGCCGGCTACGTGGACGTCGTTCCGGCGGCCTCCTCGCATGGGTTCACGCG GGCGACGCGATGAAGGGCGTCAAGACCTTCGACCCCGCCACGACTCCGCTCTTGGCCGCGTGGGCGGACAGCTTCGACGCGTTGGACGCGGTCGAGGCTGTCATGCCGGACGTCGGTAAGCTAGTTGAGTTTGCCATGGCGATGCATGCTCGCGCCGCCGCCACCGCAACGAACTAG

[0037] SEQ ID NO.2:ATGGCCGGAGGAGAAAACA

[0038] SEQ ID NO.3:CTAGTTCGTTGCGGTGGCG

[0039] S12. Select uniform and plump seeds of the resistant *Clerodendrum trichotomum* population JS-13. Soak the seeds in warm water at 30-40℃ for 12 hours, then transfer them to 9cm petri dishes lined with double-layered filter paper. Add appropriate amounts of deionized water to the petri dishes to keep the filter paper moist, and then transfer the petri dishes to a light incubator for germination. The incubator conditions are set as follows: 25 / 20℃ (day / night), alternating between light and dark for 12 hours. When the seeds germinate to about 0.5cm, select germinating seeds of uniform growth and place them in 12cm diameter plastic seedling pots. The soil used for plant cultivation is soil from the Shandong Agricultural University teaching and experimental base farm that has no history of herbicide application. The sowing rate is 10 plants per pot. When the seedlings reach the 2-leaf stage, retain 5 uniformly growing plants per pot.

[0040] use Total RNA was extracted from the leaves of *Hylocereus undatus* using the Plant Total RNA Isolation Mini Kit. A 1 μL sample of the extracted total RNA was then measured using an ultra-micro spectrophotometer to determine its OD value. 260 and OD 280 The ratio; take 2 μL of total RNA extracted from *Gnaphalium affine* and mix it with 2 μL of 10x DNA loading buffer, add ddH2O to make up to 20 μL, and detect the integrity of the RNA extracted from *Gnaphalium affine* by agarose gel electrophoresis.

[0041] Following the instructions accompanying the All-in-One First-Strand Synthesis MasterMix kit, the obtained high-quality RNA was reverse transcribed into cDNA: using 1 μg of total RNA as a template, Oligo(dT)... 20 VN was used as a primer to prepare the reaction system. The reaction was incubated at 37°C for 2 min and at 55°C for 5 min. After the reaction, the obtained cDNA was immediately placed on ice and stored at -20°C for later use.

[0042] S13. Using the obtained cDNA as a template, and the primers synthesized in step S11 as primers, use... MaxSuper-Fidelity DNAPolymerase amplifies the full-length gene. The total volume of the amplification reaction system is 50 μL, including: 25 μL 2×PhantaMax MasterMix (Dye Plus), 2 μL upstream primer (10 μmol·L⁻¹). -1 ), 2 μL of downstream primer (10 μmol·L -14 μL template DNA, 17 μL ddH2O. PCR reaction conditions were: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 65℃ annealing for 15 s, 72℃ extension for 30 s, for a total of 34 cycles; final extension at 72℃ for 5 min.

[0043] S14. After the PCR reaction, the amplification products were detected by 1% agarose gel electrophoresis and observed in a UV gel imaging system. The results are as follows: Figure 1 As shown, a 705 bp band was excised and purified using a gel extraction kit. The purified target fragment was quantified using a NanoDrop One spectrophotometer for the construction of the cloning vector.

[0044] Example 2

[0045] The cloning of the *Gnaphalium affine* PfGSTl1 gene followed the same steps as in Example 1, except that the CDS sequence of the PfGSTl1 gene is shown in SEQ ID NO.4, the upstream sequence of the specific primers for amplifying the full length of the PfGSTl1 gene is shown in SEQ ID NO.5, and the downstream sequence is shown in SEQ ID NO.6. The electrophoresis results of the PCR products are shown below. Figure 1 As shown, the fragment size is 744bp.

[0046] SEQ ID NO.4:

[0047] ATGGCCGCCGCCGCCACAGCAGCAGCTCCAGCCAGGAGCTTCACGAAAGA

[0048] AGTGCTCCCGCCTGCACTGTGCGCCGTCTCCGAGCCCCCTCCCCTTCGA

[0049] TGGCACCACCAGGCTGTATATTTGCTACTTCTGCCCCTTTGCTCAGCGCGCT

[0050] TGGGTTACCCGGAACTGCAAGGGTTTGCAGGACGAGATCAAGCTAGTCGC

[0051] CATTAATCTGGAGGACAAACCAGCTTGGTACAAGGAGAAGGTTTACCCAC

[0052] GGGGCACGGTGCCTTCCCTGGAGCACGACGGCAAGGTCGTCGGAGAGAG

[0053] CCTGGATTTGATCAAATACATCGACACCAATTTCCAGGGCCCGGCGCTGCTT

[0054] CCTCAAGACCCTGCTAAGAGGCAGTTTGCTGACGAGCTGATTGCGTACGCT

[0055] GACGCCTTTAAAAAAGCACTCTACGCGCCCTTGATCTCCAAAGTAGTCATG

[0056] TCAGATGAGGCTGTTGCTGCTTTAGACAAGATCGAAGCTGCCCTGTCCAAG

[0057] TTCAGTGACGGCCCCTTCTTCCTTGGCCAGCTTAGTTTGGCTGATATTGCGT

[0058] ACGTCACCATCGTGGAGAGGGTTCAGATATACTATTCCCACGTGAGGAGCT

[0059] ACGAGATCACCAAAGGCAGGCCCAACCTTGAGAAATTCATCGAGGAGATG

[0060] AACAAGATTGAAGCATACAAGCAAACCAAAAACCAACCGCTCATCTTGCT

[0061] TGATGTTGCGAAGAGGCATCTCAAGATTGCTTGA

[0062] SEQ ID NO.5:ATGGCCGCCGCCGCCACAGCA

[0063] SEQ ID NO.6:TCAAGCAATCTTGAGATGCCCTTCTCGC

[0064] Example 3

[0065] The recombinant cloning vector containing the PfGSTup gene from *Gnaphalium affine* was constructed using the following steps:

[0066] S31. The purified product from Example 1 was ligated to the cloning vector TA / Blunt-Zero using the TA / Blunt-Zero Cloning Kit. The ligation reaction mixture consisted of 1 μL 5×TA / Blunt-Zero Cloning Mix, 2 μL of the purified target gene product, and 2 μL ddH2O. The ligation reaction conditions were 25°C for 5 min. After the reaction, the centrifuge tubes were placed on ice for later use.

[0067] S32. Thaw DH5α competent cells on ice. When the cells are in an ice-water mixture, add 10 μL of the ligation product obtained in step S31, and gently tap the bottom of the centrifuge tube to mix. Incubate on ice for 25 min. Heat shock at 42°C for 45 s, then quickly place on ice and incubate for 2 min. Add 700 μL of antibiotic-free LB sterile medium, mix well, and shake at 37°C and 200 rpm for 60 min. Centrifuge the incubated culture at 5000 rpm for 1 min, discard 900 μL of supernatant, gently pipette the remaining culture to resuspend it, and spread it onto a plate containing 50 mg·L⁻¹ of LB medium. -1 Place ampicillin on LB sterile solid medium plates, invert the plates and incubate overnight at 37°C.

[0068] After bacterial colonies have grown on the plate, single colonies are picked for PCR verification. The PCR primers, reaction system, and amplification conditions are the same as in step S13 of Example 1. The verified positive clones are then inoculated onto a plate containing 50 mg·L⁻¹ of... -1 The bacteria were cultured in sterile LB broth containing ampicillin; 1 mL of the overnight culture was sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. The sequencing results were analyzed using NCBI online BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blast home). The results are as follows: Figure 2 As shown, sequence alignment analysis with the NCBI database revealed that the cloned gene shared 85.04% similarity with the wheat GSTU6 sequence. Further analysis using UGENE 50.0 to align the cloned sequence with the Unigene obtained from the transcriptome sequencing data of *Hemiberlesia lataniae* revealed a single-base mutation in the cloned sequence, resulting in a leucine mutation at position 11 to valine. Figure 3 , Figure 4 This indicates that the GST gene of *Gnaphalium affine* was successfully cloned, annotated as PfGSTup, and the positive bacterial culture identified by sequencing was preserved for the construction of the expression vector.

[0069] Example 4

[0070] The recombinant cloning vector for the *P. truncatum* PfGSTl1 gene was constructed using the same steps as in Example 3, except that the CDS sequence of the PfGSTl1 gene is shown in SEQ ID NO.4, the upstream sequence of the specific primers for amplifying the full length of the PfGSTl1 gene is shown in SEQ ID NO.5, and the downstream sequence is shown in SEQ ID NO.6. Sequence alignment analysis with the NCBI database showed that the cloned gene had 85.04% similarity to the wheat GSTU6 gene. Figure 5 Sequence alignment analysis using UGENE 50.0 revealed that the CDS region of the cloned sequence was completely identical to the Unigene sequence obtained from the transcriptome sequencing data of *Clematis chinensis*. Figure 6 , Figure 7 This indicates that the GST gene of *Gnaphalium affine* was successfully cloned, annotated as PfGSTl1, and the positive bacterial culture confirmed by sequencing was preserved for the construction of the expression vector.

[0071] Example 5

[0072] Recombinant expression vectors containing the PfGSTup and PfGSTl1 genes of *Gnaphalium affine* were constructed, and the specific steps are as follows:

[0073] S51. Using the bacterial cultures with correct sequencing results from Examples 3 and 4 as templates, respectively, the following steps were taken: MaxSuper-Fidelity DNA Polymerase amplified the full-length PfGSTup and PfGSTl1 genes. The reaction system and amplification conditions were the same as in step S13 of Example 1. The PCR products were subjected to agarose gel electrophoresis, and the target fragments were recovered using a gel extraction kit and quantified using a NanoDrop One spectrophotometer.

[0074] S52. Construct the expression vector from the recovered target gene product according to the pEASY-Blunt E1 Expression Kit instructions. The reaction mixture consisted of 1 μL PCR product, 1 μL pEASY-Blunt E1 Expression Vector, and 3 μL ddH2O. The blank control group was the EControl Template included in the kit. Mix gently and incubate at 25°C for 10 min. After the reaction, place the centrifuge tubes on ice.

[0075] Example 6

[0076] The ligation products obtained in Example 5 were transformed into Escherichia coli BL21(DE3) in the following specific steps:

[0077] Two tubes of *E. coli* BL21(DE3) competent cells were thawed on ice. When the cells were in an ice-water mixture, 5 μL of the recombinant expression vectors for the PfGSTup and PfGSTl1 genes successfully constructed in Example 5 were added to each tube. The cells were then gently stirred at the bottom of the centrifuge tubes to mix thoroughly. The tubes were incubated on ice for 25 min; then incubated in a 42°C water bath for 90 s, and immediately returned to ice for 2 min. 700 μL of antibiotic-free LB sterile medium was added to the centrifuge tubes, mixed thoroughly, and then incubated at 37°C, 200 rpm for 60 min. After incubation, the bacterial suspension was centrifuged at 5000 rpm for 1 min, 900 μL of supernatant was discarded, and the remaining bacterial suspension was gently resuspended by pipetting and spread onto a medium containing 50 mg / L of [unspecified medium]. -1 Ampicillin was cultured on LB sterile solid agar plates, which were then inverted and incubated overnight at 37°C. Once bacterial colonies appeared, single colonies were picked for PCR verification. Validated positive clones were inoculated onto a medium containing 50 mg / L of ampicillin. -1 The culture was prepared in LB sterile liquid medium containing ampicillin. One mL of the overnight culture was sent to Shanghai Sangon Biotech Co., Ltd. for sequencing verification. The sequencing results were analyzed by sequence alignment using UGENE 50.0 software. The results showed successful transformation.

[0078] Example 7

[0079] The sensitivity of *E. coli* BL21 transfected with the PfGSTup and PfGSTl1 genes in Example 6 to mesosulfuron-methyl was investigated. The specific steps are as follows:

[0080] S71. Accurately weigh 106 mg of mesosulfuron technical grade, dissolve it in 10 mL of acetone, and then add it to chromatographic grade acetonitrile to prepare a solution of 1000 mg·L⁻¹. -1 The mother liquor is then diluted with acetonitrile to the required concentration.

[0081] S72. Single colonies of BL21 cells successfully transformed with the PfGSTup and PfGSTl1 genes were inoculated into 20 mL of LB medium containing ampicillin (final concentration 50 mg / mL) and cultured overnight at 37°C with shaking. The OD of the bacterial culture was then measured. 600 When the concentration of the bacterial culture reached 0.6, centrifuge at 5000g for 1 min, discard the supernatant, and resuspend the bacterial blocks in 1 mL of antibiotic-free LB medium. Take 1 μL of the bacterial suspension and drop it onto LB solid medium containing 50 mg / mL ampicillin, 1 mM IPTG, and final concentrations of 0, 0.05, 0.5, 5, 50, and 500 μM mesosulfuron-methyl, respectively. Incubate at 37℃ for 24 h, then analyze and photograph the growth of *E. coli* BL21. Use *E. coli* BL21 transfected with an empty vector as a control. The results are as follows: Figure 8 As shown.

[0082] S73. 50 μL of bacterial suspension was spread onto LB solid medium containing 50 mg / mL ampicillin, 1 mM IPTG, and mesosulfuron-methyl standard solution, respectively. After incubation at 37°C with shaking for 24 h, the colony count was recorded. Results are as follows: Figure 9 As shown.

[0083] Depend on Figure 8 It can be seen that under mesosulfuron-methyl stress treatment, the growth of *E. coli* BL21 transformed with the blank vector was slow. Although the growth of BL21 transformed with PfGSTl1 and PfGSTup was inhibited under high concentrations of mesosulfuron-methyl, it could still grow normally. This indicates that the expression of the target genes PfGSTl1 and PfGSTup enhanced the resistance of *E. coli* BL21 to mesosulfuron-methyl. These results suggest that overexpression of PfGSTl1 and PfGSTup can confer mesosulfuron-methyl resistance to *E. coli*.

[0084] Depend on Figure 9 It can be seen that in the group without mesosulfuron-methyl treatment, there was no significant difference in the growth of recombinant E. coli with empty vector and PfGSTup / PfGSTl1. However, in the mesosulfuron-methyl treatment group, the number of BL21 colonies transformed with empty vector was significantly inhibited compared with PfGSTup and PfGSTl1, and decreased with increasing mesosulfuron-methyl concentration: when the mesosulfuron-methyl concentration was 0.5 μM, the number of BL21 colonies transformed with empty vector decreased by 79.8%; when the mesosulfuron-methyl concentration was 50 μM, BL21 transformed with empty vector could no longer grow normally on the culture medium. The number of BL21 colonies transformed with PfGSTup and PfGSTl1 also decreased with increasing mesosulfuron-methyl concentration; when the mesosulfuron-methyl concentration was 500 μM, the number of PfGSTup and PfGSTl1 colonies decreased by 94.59% and 87.60%, respectively, compared with 0.05 μM mesosulfuron-methyl.

[0085] Example 8

[0086] The physicochemical properties of the PfGSTup and PfGSTl1 genes were analyzed, and the specific steps are as follows:

[0087] The physicochemical parameters of PfGSTup and PfGSTl1 were calculated using Expasy ProtParam, and the results are shown in Table 1.

[0088] Table 1

[0089]

[0090] The results showed that the predicted molecular weight of PfGSTup was 24.99 kDa; the theoretical isoelectric point was 5.11, indicating that it may be an acidic protein; and the extinction coefficient at 280 nm was 59025 M. -1 ·cm-1 The results indicate that it can be analyzed by ultraviolet spectroscopy; the instability index is 33.97, indicating that it is a stable protein; the lipophilicity index is 88.89, indicating that it has high thermal stability; and the total average hydrophilicity is -0.064, indicating that it is a hydrophobic protein.

[0091] The predicted molecular weight of PfGSTl1 is 27.59 kDa; its theoretical isoelectric point is 7.60, indicating that it may be a basic protein; and its extinction coefficient at 280 nm is 58010 M. -1 cm -1 The results indicate that it can be analyzed by ultraviolet spectroscopy; the instability index is 42.49, indicating that it is relatively weak; the lipophilicity index is 96.48, indicating that it has high thermal stability; and the total average hydrophilicity is -0.080, indicating that it is a hydrophobic protein.

[0092] Prosite conserved domain analysis showed that the PfGSTup sequence belongs to the Tau subfamily of the GST family, possessing conserved N-terminal and C-terminal domains. The N-terminal domain is located at positions 9-82, and the C-terminal domain is located at positions 94-220. The PfGSTl1 sequence belongs to the Lambda subfamily of the GST family, with its N-terminus being a sulfur oxidase, and its N-terminal domain being located at positions 20-109, while the C-terminal domain is located at positions 121-241.

[0093] Example 9

[0094] Molecular docking analysis was performed on the proteins encoded by the PfGSTup and PfGSTl1 genes with mesosulfuron-methyl. The specific steps are as follows:

[0095] Homology modeling of PfGSTup was performed using SWISS-Model, with 1gwc.1 selected as the template protein. This protein is highly similar to the target protein, with a GMQE value of 0.87.

[0096] The docking results of the herbicide mesosulfuron-methyl with PfGSTup molecules are as follows: Figure 10As shown, the docking results indicate that PfGSTup, predicted by SWISS-MODEL, forms suitable spatial complementarity with mesosulfuron-methyl. The lowest binding energy of PfGSTup with mesosulfuron-methyl is -7.43 kcal / mol, and the binding energy is less than -5 kcal / mol, indicating that PfGSTup can stably bind with mesosulfuron-methyl. PfGSTup forms three hydrogen bonds with mesosulfuron-methyl: SER119, ARG120, and LYS181. Reduced glutathione (GSH), after molecular docking to select the lowest binding energy conformation, has a binding energy of -1.61 kcal / mol. It can form two hydrogen bonds with PfGSTup at ASP40 and LEU41, and the spatial distance between reduced glutathione and mesosulfuron-methyl is relatively small. The molecular docking results, to some extent, demonstrate that PfGSTup can conjugate reduced glutathione with oxidized herbicide molecules.

[0097] The PfGSTl1 structure uses 4pqh.1 as a template and has a GMQE value of 0.83. The template protein is highly similar to the PfGSTl1 protein, both belonging to the lambda subfamily of the GST family.

[0098] The docking results of mesosulfuron-methyl with PfGSTl1 molecules are as follows: Figure 11 As shown, the docking results indicate that PfGSTl1, predicted by SWISS-MODEL, forms suitable spatial complementarity with mesosulfuron-methyl. The lowest binding energy of PfGSTl1 with mesosulfuron-methyl is -7.15 kcal / mol, exhibiting a relatively high binding energy. PfGSTl1 and mesosulfuron-methyl can form four hydrogen bonds: LEU102, VAL88, SER101, and GLU100. Reduced glutathione (GSH), after molecular docking to select the lowest binding energy conformation, has a binding energy of -1.52 kcal / mol. It can form three hydrogen bonds with PfGSTl1 at LYS139, ASP136, and LYS140. Furthermore, the spatial distance between reduced glutathione and mesosulfuron-methyl is relatively small. These molecular docking results suggest that PfGSTl1 can conjugate reduced glutathione with oxidized herbicide molecules, potentially promoting detoxification metabolism.

[0099] Therefore, this invention discloses for the first time the CDS sequences of the *Gnaphalium affine* PfGSTup and PfGSTl1 genes. The CDS sequence of the PfGSTup gene is shown in SEQ ID NO.1, and the CDS sequence of the PfGSTl1 gene is shown in SEQ ID NO.4. It is also the first discovery that expressing the PfGSTup and PfGSTl1 genes in *Escherichia coli* can induce transgenic *E. coli* to acquire resistance to mesosulfuron-methyl, providing two new candidate genes from the *Gnaphalium affine* mesosulfuron-methyl resistance GST family. The provided PfGSTup and PfGSTl1 genes can be used for the cultivation of wheat varieties resistant to ALS inhibitor herbicides, providing two candidate genes for research on the mechanism of *Gnaphalium affine* resistance to ALS inhibitor herbicides, *Gnaphalium affine* resistance detection, and determination of application timing and dosage.

[0100] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can still be made to the technical solutions of the present invention, and these modifications or equivalent substitutions cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.

Claims

1. Two herbicide-tolerant genes in *Gnaphalium affine*, characterized by: The CDS sequence of the PfGSTup gene is shown in SEQ ID NO.1, and the CDS sequence of the PfGSTl1 gene is shown in SEQ ID NO.

4.

2. The role of the two herbicide-resistant genes of *E. coli* as described in claim 1 in enhancing the herbicide resistance of *E. coli* to mesosulfuron-methyl, characterized in that: Expression of the PfGSTup and PfGSTl1 genes enhances resistance to mesosulfuron-methyl in Escherichia coli.

Images