Endogenous reference gene, probe primer and kit for quantitatively detecting HBV (Hepatitis B Virus) nucleic acid

Abstract

The invention discloses an endogenous reference gene, a primer probe and a kit for quantitatively detecting HBV (Hepatitis B Virus) nucleic acid. The nucleotide sequence of the endogenous reference gene is shown as SEQ ID NO: 1 or SEQ ID NO: 2. Two endogenous reference gene sequences capable of being used for quantitatively detecting HBV nucleic acid and several groups of primer probes for endogenous reference gene detection and HBV nucleic acid gene detection are obtained through screening, quantitative detection of HBV nucleic acid can be rapidly and accurately achieved through the primer probes, the primer probes can be used for detecting HBV genotype A-I, and the detection range is wider.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology, and more specifically, the present invention relates to an internal standard gene, a probe primer and a kit for quantitatively detecting HBV nucleic acid. Background Art

[0002] HBV-DNA quantification has important reference value in the diagnosis of hepatitis B, the assessment of hepatitis B disease status, whether it is suitable to start antiviral treatment, and the judgment of drug efficacy after starting antiviral treatment. High-sensitivity HBV-DNA detection reagents can detect viral loads with a lower limit of 20IU / ml or lower, and can accurately diagnose low viremia. At present, most high-sensitivity HBV-DNA detection reagents use the external standard method for quantification, that is, first make a standard curve, and use the standard curve to make positive and negative judgments and positive values ​​for the test samples. When using the external standard method for quantification, the preparation of the standard curve requires 4 to 5 people's extraction reagents and amplification reagents, which increases the cost of the reagents. At the same time, the external standard method is also complicated.

[0003] The internal standard quantitative method has become one of the best solutions for achieving quantification because it does not require the preparation of an additional standard curve and the result analysis is simpler. However, the current technical bottlenecks of the internal standard quantitative method are: how to find an internal standard gene that does not interfere with the target detection primer probe and has basically the same amplification efficiency; how to improve the anti-interference ability of the entire amplification system.

[0004] In addition, the current high-sensitivity HBV-DNA detection reagent can only detect HBV genotype AH, and the detection range needs to be expanded. Summary of the invention

[0005] Based on this, the object of the present invention is to provide an internal standard gene that does not interfere with HBV nucleic acid detection and has basically the same amplification efficiency, as well as primer probes for detecting the internal standard gene and HBV gene.

[0006] The specific technical solutions for achieving the above-mentioned invention objectives include the following.

[0007] In a first aspect of the present invention, an internal standard gene for quantitative detection of HBV nucleic acid is provided, and the nucleotide sequence thereof is shown in SEQ ID NO:1 or SEQ ID NO:2.

[0008] The second aspect of the present invention provides a primer probe for detecting the above-mentioned internal standard gene, which is selected from any one of the following groups:

[0009] Group A: primers having sequences as shown in SEQ ID NO:3 and SEQ ID NO:4, and a probe having a sequence as shown in SEQ ID NO:5;

[0010] Group B: including primers having sequences as shown in SEQ ID NO:9 and SEQ ID NO:4, and a probe having a sequence as shown in SEQ ID NO:5;

[0011] Group C: includes primers whose sequences are shown in SEQ ID NO:6 and SEQ ID NO:7, and a probe whose sequence is shown in SEQ ID NO:8.

[0012] The third aspect of the present invention provides a kit for quantitatively detecting HBV nucleic acid, comprising the above-mentioned internal standard gene, the above-mentioned probe primer, and a primer probe for detecting HBV gene, wherein the primer probe for detecting HBV gene is selected from any one of the following groups:

[0013] Group 1: primers having sequences as shown in SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 15 and SEQ ID NO: 16, and probes having sequences as shown in SEQ ID NO: 20 and SEQ ID NO: 22;

[0014] Group 2: primers having sequences as shown in SEQ ID NO: 10 and SEQ ID NO: 12, SEQ ID NO: 15 and SEQ ID NO: 17, and probes having sequences as shown in SEQ ID NO: 20 and SEQ ID NO: 22;

[0015] Group 3: primers having sequences as shown in SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15 and SEQ ID NO: 17, and probes having sequences as shown in SEQ ID NO: 21 and SEQ ID NO: 23;

[0016] Group 4: primers with sequences as shown in SEQ ID NO:13 and SEQ ID NO:14, SEQ ID NO:18 and SEQ ID NO:19, and probes with sequences as shown in SEQ ID NO:21 and SEQ ID NO:22.

[0017] The fourth aspect of the present invention provides a method for quantitatively detecting HBV nucleic acid for non-diagnostic purposes, comprising the following steps: performing nucleic acid detection on a sample to be tested using the above-mentioned kit.

[0018] Based on the research experience of internal standard method nucleic acid quantitative detection and internal standard sequence, the inventors of the present invention obtained two internal standard gene sequences that can be used for quantitative detection of HBV nucleic acid after a large number of experiments, and found several sets of primer probes that do not interfere with each other in internal standard gene detection and HBV nucleic acid gene detection, and have basically the same amplification efficiency. Using the primer probes of the present invention, quantitative detection of HBV nucleic acid can be accurately and quickly achieved, and can be used to detect HBV genotype AI, with a wider detection range. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is a representative experimental profile of the primer probes for detecting the candidate internal standard IS in Example 1 of the present invention.

[0020] Figure 2 This is a representative experimental diagram of the primer probes for detecting the S gene and / or C gene in Example 2 of the present invention.

[0021] Figure 3 This is a representative experimental diagram of the primer probes for detecting HBV and internal standard IS in Example 3 of the present invention.

[0022] Figure 4 This is the detection limit verification result of the second set of primer probes for detecting HBV and internal standard IS in Example 3 of the present invention.

[0023] Figure 5 This is the NC verification result of the second set of primer probes for detecting HBV and internal standard IS in Example 3 of the present invention.

[0024] Figure 6 This is the NTC verification result of the second set of primer probes for detecting HBV and internal standard IS in Example 3 of the present invention.

[0025] Figure 7 The amplification curves and standard curves of the HBV standards at various concentration gradients in Example 4 of the present invention are shown. DETAILED DESCRIPTION

[0026] In order to facilitate the understanding of the present invention, the present invention will be described more fully below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0027] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those commonly understood by those skilled in the art to which the present invention belongs. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used in the present invention includes any and all combinations of one or more of the related listed items.

[0028] Unless otherwise specified, the embodiments are carried out according to conventional experimental conditions or the conditions recommended in the manufacturer's instructions. The instruments, raw materials and reagents used in the present invention without indicating the manufacturer are all conventional products that can be purchased commercially.

[0029] The difficulty of the internal standard quantitative method is to screen suitable internal standard genes and design suitable primer probes for the screened internal standard genes. On the one hand, it is necessary to ensure that the internal standard gene sequence and the target sequence are compatible. On the other hand, it is necessary to ensure that the amplification of the internal standard gene sequence does not interfere with the amplification of the target sequence, and the amplification efficiency of the internal standard gene sequence is basically consistent with the amplification efficiency of the target sequence. The inventors of the present invention use 7 genes including artificially synthesized gene sequences and gene sequences from bacteria, viruses, plants, etc. as candidate internal standard sequences, and design multiple primers and probe sequences for each internal standard sequence and the S gene and C gene of the HBV virus, and finally find that there are two genes suitable as internal standard genes for quantitative detection of HBV nucleic acid, and there are 5 groups of primer probes that can be used as primer probes for quantitative detection of HBV nucleic acid. When the 5 groups of primer probes are used to detect HBV virus and internal standard genes, the amplification of the internal standard gene sequence will not interfere with the amplification of the target sequence, and the amplification efficiency of the internal standard gene sequence is basically consistent with the amplification efficiency of the target sequence.

[0030] In some embodiments of the present invention, an internal standard gene for quantitative detection of HBV nucleic acid is disclosed, and its nucleotide sequence is shown as SEQ ID NO: 1 or SEQ ID NO: 2, preferably SEQ ID NO: 1.

[0031] In other embodiments of the present invention, a primer probe for detecting the above-mentioned internal standard gene is disclosed, which is selected from any one of the following groups:

[0032] Group A: primers having sequences as shown in SEQ ID NO:3 and SEQ ID NO:4, and a probe having a sequence as shown in SEQ ID NO:5;

[0033] Group B: including primers having sequences as shown in SEQ ID NO:9 and SEQ ID NO:4, and a probe having a sequence as shown in SEQ ID NO:5;

[0034] Group C: including primers having sequences as shown in SEQ ID NO:6 and SEQ ID NO:7, and a probe having a sequence as shown in SEQ ID NO:8;

[0035] In some embodiments, the primer probe is the primer probe described in group A.

[0036] In some of the embodiments, both the 5' and 3' ends of the probe are modified with fluorescent groups; and / or the fluorescent groups modified with the 5' and 3' ends are different; and / or the 5' end is modified with Cy5 or FAM, and the 3' end is modified with BHQ1 or BHQ3.

[0037] In other embodiments of the present invention, the use of the above primer probe in preparing a kit for quantitative detection of HBV nucleic acid is disclosed.

[0038] In other embodiments of the present invention, a kit for quantitatively detecting HBV nucleic acid is disclosed, comprising the above-mentioned internal standard gene, the above-mentioned probe primer combination, and a primer probe for detecting HBV gene, wherein the primer probe for detecting HBV gene is selected from any one of the following groups:

[0039] Group 1: primers having sequences as shown in SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 15 and SEQ ID NO: 16, and probes having sequences as shown in SEQ ID NO: 20 and SEQ ID NO: 22;

[0040] Group 2: primers having sequences as shown in SEQ ID NO: 10 and SEQ ID NO: 12, SEQ ID NO: 15 and SEQ ID NO: 17, and probes having sequences as shown in SEQ ID NO: 20 and SEQ ID NO: 22;

[0041] Group 3: primers having sequences as shown in SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15 and SEQ ID NO: 17, and probes having sequences as shown in SEQ ID NO: 21 and SEQ ID NO: 23;

[0042] Group 4: primers with sequences as shown in SEQ ID NO:13 and SEQ ID NO:14, SEQ ID NO:18 and SEQ ID NO:19, and probes with sequences as shown in SEQ ID NO:21 and SEQ ID NO:22.

[0043] In some embodiments, the kit includes: an internal standard gene whose sequence is shown in SEQ ID NO: 1, the primer probe described in Group A, and the primer probe described in Group 2.

[0044] In some embodiments, the kit includes: an internal standard gene whose sequence is shown in SEQ ID NO: 1, the primer probe described in group C, and the primer probe described in group 4.

[0045] In some of the embodiments, both the 5' and 3' ends of the probe are modified with fluorescent groups; and / or the fluorescent groups modified with the 5' and 3' ends are different; and / or the 5' end is modified with Cy5 or FAM, and the 3' end is modified with BHQ3 or BHQ1.

[0046] In some of the embodiments, the working concentrations of the primers for detecting the internal standard gene and the HBV gene are both 180nM to 220nM; the working concentrations of the probes for detecting the internal standard gene and the HBV gene are both 80nM to 120nM.

[0047] In other embodiments of the present invention, a method for quantitatively detecting HBV nucleic acid for non-diagnostic purposes is disclosed, comprising the following steps: extracting DNA of the sample to be tested and the internal standard gene, and performing nucleic acid detection using the above-mentioned kit.

[0048] The present invention is described in detail below with reference to the accompanying drawings and specific embodiments.

[0049] Example 1 Obtaining the internal standard IS gene and its detection primer probe

[0050] In this embodiment, 7 gene sequences are used as candidate internal standard IS genes, and multiple detection primers and probes are designed for each candidate internal standard IS gene to obtain primers and probes suitable for detecting the internal standard. Specifically, the following steps are included:

[0051] 1. Design of primers and probes for internal standard IS detection

[0052] 1. Candidate internal standard IS1 gene (SEQ ID NO: 1)

[0053] TACCTACTCAGGTATAaaatttccggTGTATCTTCCGGCTTAAGCTTTTCGATCGGCTTAGAGC

[0054] AAATGCCCTGGAAAAGCGTCGTCATCGCGTTGAGAGCGTAGACTGAAAGCTTCATATAC

[0055] CTACTCAGGTAatatatatGATTCAATGCCTGAGCTACTCACACGCCGCATAATAGTATGCGT

[0056] CACGTAAGAAGTGAAGAAGAGGACGCAAATGCCACAGGGTATTTCGCAACGGCGAA

[0057] GAGAGCATCGGTCACTCTATAAACGTATGTTCGGGCTTTGTGGACATATAATGGTACAGT

[0058] GACCGAGACGAGAGGGATATTTTCTACCGCTCGCCGCAGTACGAATATAGGTATACGGCG

[0059] GCCCGTTtttCGTGTATCTTCCGGCTTAAGCTTTTTGCGATCGGCTTAGAGCAAATGCCCTGG

[0060] AAAAGCGTCGTCATCGCGTTGAGAGCGTAGACTGAAAGCTTCATA

[0061] Four upstream primers, four downstream primers and four probes were designed for the candidate internal standard IS1 gene, and the specific sequences are shown in Table 1.

[0062] Table 1

[0063]

[0064] 2. Candidate internal standard IS2 gene (adapted from palm gene, SEQ ID NO: 2)

[0065] GGGAGGCTAAGAACATTGCTGCCGAGAGAACAACAGAGGGGAAGGAGACTAGTAAGGGGAAGATGAAGGAGTACAATGAGCTGGTCCAAGGCATCCCTTCAATTGGGCAGTTCCTGCTTACTCTACCAGCAATTCACTCCACGATCGTGTTTGTGTGCATCAAGTATGTTCCTGTCCCTGTTGTCCCTCTAGAGGAAAGATTCCTCTTTCGAAGGGTATGCCAGAA GGACTACCACATGTTCCGCTGCGTTGCCCGATATGGATATAAttttATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTTTTTGTCTTTGGCTACAGCCCAAAGACTCGCCTTAAAACGATTGGCAGCCGGCCTACTGGTTTCGCAGCGCAG

[0066] Four upstream primers, four downstream primers and three probes were designed for the candidate internal standard IS2 gene, and the specific sequences are shown in Table 2.

[0067] Table 2

[0068]

[0069] 3. Candidate internal standard IS3 gene (Ganoderma lucidum 18S gene, SEQ ID NO: 40)

[0070] GTTTGGGTGCAGACCCATGTTCCCAAGATCACGAGCCTGCTGCTTAGGCCTCCATTCTGTTTGACCCCTCACAATCTCAGTCCCATCCTCGAGCCGCAGAAGATGCTGGCACACGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGG CTCTCAGTGTGATAATGTCTACGCTGCGACCGTGAAGCGTTTGGCGAGCTTCTAACCGTCTCAGTTGGAGATTATCCCTCCTACCACGCTTCTTATCGTAAACATCATTGGTGTGGTGGCTGGTGTCTCAAATGCGATAAACAATGGATACGAATCTT

[0071] Three upstream primers, four downstream primers and three probes were designed for the candidate internal standard IS3 gene, and the specific sequences are shown in Table 3.

[0072] Table 3

[0073]

[0074] 4. Candidate internal standard IS4 gene (Curvularia spp. gene, SEQ ID NO: 51)

[0075] GGGGACCTCTATTTGGCAAGCTCTCTTCGCATTCTGGGTGATTGTCCACCTTTATCCttTG

[0076] AACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACC

[0077] CTCAAGCTTTGCTTGGTGTTGGGCGTTTTTGTCTTTGGCTACAGCCCAAAGACTCGCCTT

[0078] AAAACGATTGGCAGCCGGCCTACTGGTTTttTGAATCATCGAATCTTTGAACGCACCTTGC

[0079] GCCCTCTGGTATTCCGGAGAGCATGCCTGTTTGAGTGTCATGTAGACTCAATCCCTCGGG

[0080] TTTCCGAGGAGATTGGACTTGGGTGTTGCCGCTTTGCCGGCTCGCCTTA

[0081] Four upstream primers, three downstream primers and four probes were designed for the candidate internal standard IS4 gene, and the specific sequences are shown in Table 4.

[0082] Table 4

[0083]

[0084] 5. Candidate internal standard IS5 gene (rice gene, SEQ ID NO: 63)

[0085] CTCACCGACTCCAACTACCGTCCATGTACGATCCATACTAGATCTGACCAACTGCCCATC

[0086] CTACCTCCTCTACGTTCTTGACAGCCCGTCTTTGTCTCAGTAGAGTCTTTCAGTGGCATG

[0087] TTTCGGTCCTCTTTCCCATTACTTAGAAAAAGTGAGCCACCGGTTCAGGTACAAGATACT

[0088] ATCATTACCGCCTGGACAATTAGACATCCAACCCGTAATCGCAACGACCCAATGCCTTGA

[0089] TCCGATACTGTTCGAATAGCATTTCCTGCTGCAGTTTGAGCGGCAAAAGGTGTCCCCCT

[0090] CGTGTACCTTTGAATCCGCAAGTACCGGCGGAGGACCAAGAAATCACCCGACCTCGTAC

[0091] ATCTGTAACAGTTACAATAGTATTGTTGAAAACTAGCTTGAACGTGGAAACGCTTCTTTAAT

[0092] GGAACTTTTGTTTTAGCTGGTCGTGACCAAGAAACCACCGGTTTTGCTTGGTGGGCCGG

[0093] GAATGCCAGACTTATCAATTTGTCGGGTAAACTACTTGGAGCTCACGTAGCCCATGCAGG

[0094] ATTAATCGTATTCTGGGCCGGAGCAATGAACCTATTTGAAGTGGCCCATTTCGTACCAGA

[0095] AAAACCCATGTATGAACAAGGGTTGATTTTACTT

[0096] Four upstream primers, four downstream primers and three probes were designed for the candidate internal standard IS5 gene, and the specific sequences are shown in Table 5.

[0097] Table 5

[0098]

[0099]

[0100] 6. Candidate internal standard IS6 gene (roseleaf cluster virus gene, SEQ ID NO: 75)

[0101] CACGTATTTGCGACGTTTCAACTATTTCCAACCGCGCGGTCGATTCCGCGGACGAATTAA

[0102] TTTTCGAATTAAGCGCCTCGGAGCGTACTTTACCTGGGGAGGTGTTCTTCCTCCGCTTTG

[0103] AGCAACTGGGTGGTGCTGCGGTTATTCTTAGGTTGTGTGAATGTGGGGCGTAGAGTAAA

[0104] ATTTTCGAAGCGAAAGACATTAATCAAGGTACGAGTGGTAAATGAGTGTGCTCAGGTCA

[0105] CTGTGGGAGATGGTTGTGCTGAAGAATATAAAACCAGGTTGGTCATGTAAAGAAGTTTC

[0106] TGGTTGTGATGCCATCGAACGACCTCAAAGGGTGACCACCACTGCCACTACAAGTGTGC

[0107] CGCAGCGGGCATTACCACCTTCCACGCCTTTTGTGGAGTTGTCAACGCCGTATCGGGATT

[0108] TAGGTGAAGTGGAT

[0109] Four upstream primers, four downstream primers and two probes were designed for the candidate internal standard IS6 gene, and the specific sequences are shown in Table 6.

[0110] Table 6

[0111]

[0112] 7. Candidate internal standard IS7 gene (okra cellulose gene, SEQ ID NO: 86)

[0113] AGAAAGCTGGGGCCATGAATGCTTTGGTGCGTGTTTCTGCTGTCATCTCCAATGCTCCTT

[0114] TCCTGCTGAATGTTGATTGTGATCACTACATAAACAACAGCAAGGCTCTTCGTGAAGCCA

[0115] TGTGCTTTGTCTTTTTTGATATCAACATGAAAGGCCTGGATGGGATTCAAGGACCTATT

[0116] TATGTTGGAACTGGATGCGTCTTCAGGAGGCAGGCACTCTATGGATATGATGCCCCTGCC

[0117] AAGAAAAAGCCTCCAAGAAGGACATGCAATTGTTCGCCTATTAACCTCTCAGATCGTCT

[0118] GCACCAGGTTTTACGTTGGGCTCTGGGATCTGTTGAAATTTTCTTGAGCAGGCATTGCCC

[0119] ATTATGGTACGGGTATGGTTGTGGATTGAAACCCTTGGAGCGCTTTTCGTATATTGCTTCT

[0120] GTTGTGTACCCTTTGACCTCAATTCCACTGCTCGTGTATTGTACACTGCCGGCTA

[0121] Four upstream primers, four downstream primers and two probes were designed for the candidate internal standard IS7 gene, and the specific sequences are shown in Table 7.

[0122] Table 7

[0123]

[0124] 2. Screening of primer probes for internal standard IS genes that meet the detection requirements

[0125] Using the nucleic acid of each internal standard pseudovirus (synthesized by Fubaiao, first synthesizing each internal standard IS gene fragment, and then using conventional methods to coat a layer of protein) as a template, PCR amplification was performed using the amplification system in Table 8 and the amplification program in Table 9. According to the PCR amplification curve, it was determined whether the above primer probes met the detection requirements - the detection limit reached 50cp / mL, the NTC was non-specific, and the linear amplification efficiency was 98% to 105%.

[0126] Table 8

[0127] name concentration Dosage (μL) Lyophilized Buffer / 5 Buffer mixture 10* 2.5 dNTPs 25mM 1 <![CDATA[MgCl2]]> 200mM 0.8 Thermosensitive UDG enzyme 1U / μL 0.5 DNA polymerase 5U / μL 0.6 F 10μM 0.8 R 10μM 0.8 P 10μM 0.4 Fluorescent dyes 25uM 1 template / 30 <![CDATA[H2O]]> / Add to 50

[0128] Table 9

[0129]

[0130]

[0131] The results showed that among the primers and probes for candidate internal standard IS1 gene detection, SEQ ID NO:3, SEQ ID NO:4 and SEQ ID NO:5; SEQ ID NO:3, SEQ ID NO:4 and SEQ ID NO:29; SEQ ID NO:3, SEQ ID NO:4 and SEQ ID NO:30; SEQ ID NO:3, SEQ ID NO:4 and SEQ ID NO:31; SEQ ID NO:9, SEQ ID NO:4 and SEQ ID NO:5; SEQ ID NO:9, SEQ ID NO:27 and SEQ ID NO:30, a total of 6 groups met the requirements for detecting viral nucleic acid;

[0132] Among the primer probes for the candidate internal standard IS2 gene, SEQ ID NO:6, SEQ ID NO:7 and SEQ ID NO:8; SEQ ID NO:6, SEQ ID NO:7 and SEQ ID NO:38, a total of 2 groups meet the requirements for detecting viral nucleic acid;

[0133] Among the primer probes for the candidate internal standard IS3 gene, SEQ ID NO:41, SEQ ID NO:44 and SEQ ID NO:48, a total of 1 group, met the requirements for detecting viral nucleic acid;

[0134] Among the primer probes for candidate internal standard IS4 gene detection, SEQ ID NO:52, SEQ ID NO:56 and SEQ ID NO:59; SEQ ID NO:52, SEQ ID NO:56 and SEQ ID NO:60; SEQ ID NO:55, SEQ ID NO:58 and SEQ ID NO:60, a total of 3 groups meet the requirements for detecting viral nucleic acid;

[0135] Among the primer probes for the candidate internal standard IS5 gene, SEQ ID NO:64, SEQ ID NO:68 and SEQ ID NO:72; SEQ ID NO:67, SEQ ID NO:71 and SEQ ID NO:72, a total of 2 groups, meet the requirements for detecting viral nucleic acid;

[0136] Among the primer probes for the candidate internal standard IS6 gene, SEQ ID NO:76, SEQ ID NO:80 and SEQ ID NO:84; SEQ ID NO:76, SEQ ID NO:80 and SEQ ID NO:85; SEQ ID NO:76, SEQ ID NO:81 and SEQ ID NO:85, a total of 3 groups meet the requirements for detecting viral nucleic acid;

[0137] Among the primer probes for the candidate internal standard IS7 gene, a total of 1 group of SEQ ID NO:87, SEQ ID NO:91 and SEQ ID NO:95 meet the requirements for detecting viral nucleic acid.

[0138] The representative experimental profile of the primer probe for detecting the candidate internal standard IS is shown in FIG. Figure 1 ( Figure 1a to g in the figure are respectively detected by primer probes IS1-F1, IS1-R1 and IS1-P1, IS2-F1, IS2-R1 and IS2-P1, IS3-F1, IS3-R1 and IS3-P1, IS4-F1, IS4-R1 and IS4-P1, IS5-F1, IS5-R1 and IS5-P1, IS6-F1, IS6-R1 and IS6-P1, IS7-F1, IS7-R1 and IS7-P1 to detect the corresponding internal standard pseudoviruses. Figure 1 It can be seen that the linearity and LOD of amplification using the primer probe obtained in this example meet the detection requirements.

[0139] Example 2 Obtaining Primer Probes for Detecting HBV Nucleic Acid Targets

[0140] In this embodiment, the S gene (SEQ ID NO: 97) and C gene (SEQ ID NO: 98) of HBV are used as targets, and multiple amplification primers and probes are designed respectively. In order to increase the detection sensitivity and prevent missed detection, the S gene and C gene of HBV are mixed into the same detection channel. Since the S gene and the C gene are mixed, they are easy to interfere with each other to produce non-specific amplification curves. Therefore, the target primers and probes cannot interfere with each other to produce non-specificity, and at the same time, the linear amplification efficiency and the detection limit can meet the requirements.

[0141] 1. Primer and probe design

[0142] S gene (SEQ ID NO:97):

[0143] TCAGGATTCCTAGGACCCCTGCTCGTGTTACAGGCGGGGTTTTTCTTGTTGACAAAAATC

[0144] CTCACAATACCACAGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGGAAC

[0145] ACCCGTGTGTCTTGGCCAAAATTCGCAGTCCCAACCTCCAATCACTCACCAACCTCTT

[0146] GTCCTCCAATTTGTCCTGGTTATCGCTGGATGTGTCTGCGGCGTTTTATCATCTTCCTCTT

[0147] CATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTATCAAGGTATGTTGCCC

[0148] GTTTGTCCTCTAATTCCAGGATCATCAACCACCAGCACGGGACCATGCAAAACCTGCAC

[0149] GACTCCTGCTCAAGGAACCTCTATGTTTCCCTCATGTTGCTGTACAAAACCTTCGGACGG

[0150] AAACTGCACCTGTATTCCCAT

[0151] Seven upstream primers, nine downstream primers and five probes were designed for the S gene, and the specific sequences are shown in Table 10.

[0152] Table 10

[0153]

[0154] C gene (SEQ ID NO:98):

[0155] GAAGAGAAACTGTTCTTGAGTATTTGGTGTCTTTTGGAGTGTGGATTCGCACTCCTCCTG

[0156] CTTATAGACCACCAAATGCCCCTATCTTATCAACACTTCCGGAAACTACTGTTGTTAGAC

[0157] GACGAGGCAGGTCCCCTAGAAGAAGAACTCCCTCGCCTCGCAGACGAAGGTCTCAATC

[0158] GCCGCGTCGCAGAAGATCTCAATCTCGGGAATCTCAATGTTAGTATTCCTTGGACTCATA

[0159] AGGTGGGAAACTTTACGGGGCTTTATTCTTCTACTGTACCTGTCTTTAATCCTAAATGGCA

[0160] AACTCCTTCTTTTCCTGACATTCATTTGCAGGAGGACATTATTAATAGATGTAAACAATTT

[0161] GTGGGCCCTCTTACAGTAAATGAAAAAAGGAGATTAAAATTAATTATGCCTGCTAGGTTT

[0162] TATCCCAATGTTACTAAATA

[0163] Seven upstream primers, six downstream primers and five probes were designed for the C gene, and the specific sequences are shown in Table 11.

[0164] Table 11

[0165]

[0166] 2. Obtaining primers and probes that meet the detection requirements

[0167] Using HBV standard (purchased from Conchestan) as the nucleic acid template, PCR amplification was performed using the amplification system in Table 8 and the amplification program in Table 9. Based on the PCR amplification curve, it was determined whether the above primer probes met the requirements for HBV nucleic acid detection - the detection limit reached 5 IU / mL, the NTC was non-specific, and the linear amplification efficiency was 98% to 105%.

[0168] The results showed that among the primers and probes for S gene detection, SEQ ID NO:10, SEQ ID NO:11 and SEQ ID NO:20; SEQ ID NO:10, SEQ ID NO:11 and SEQ ID NO:110; SEQ ID NO:10, SEQ ID NO:12 and SEQ ID NO:20; SEQ ID NO:99, SEQ ID NO:14 and SEQ ID NO:110; SEQ ID NO:101, SEQ ID NO:14 and SEQ ID NO:21; SEQ ID NO:10, SEQ ID NO:11 and SEQ ID NO:111; SEQ ID NO:99, SEQ ID NO:107 and SEQ ID NO:110; SEQ ID NO:13, SEQ ID NO:14 and SEQ ID NO:21; SEQ ID NO:13, SEQ ID NO:14 and SEQ ID NO:111, a total of 10 groups met the requirements for detecting HBV viral nucleic acid; among the primers and probes for C gene detection, SEQ ID NO:15, SEQ ID NO:16 and SEQ ID NO:22; SEQ ID NO:15, SEQ ID NO:16 and SEQ ID NO:23; SEQ ID NO:15, SEQ ID NO:17 and SEQ ID NO:22; SEQ ID NO:15, SEQ ID NO:17 and SEQ ID NO:23; SEQ ID NO:18, SEQ ID NO:19 and SEQ ID NO:22; SEQ ID NO:15, SEQ ID NO:17 and SEQ ID NO:121; SEQ ID NO:15, SEQ ID NO:16 and SEQ ID NO:122; SEQ ID NO:116, SEQ ID NO:120 and SEQ ID NO:23, a total of 8 groups meet the requirements for detecting HBV viral nucleic acid.

[0169] Representative experimental profiles of primer probes for detecting HBV nucleic acid S gene and C gene are shown in Figure 2 As shown, SEQ ID NO: 10, SEQ ID NO: 12 and SEQ ID NO: 20 were used to detect HBV virus, and SEQ ID NO: 15, SEQ ID NO: 17 and SEQ ID NO: 22 were used to detect HBV virus. The amplification curves were linear ( Figure 2a and b); SEQ ID NO: 100, SEQ ID NO: 14 and SEQ ID NO: 20 were used to detect HBV virus, and SEQ ID NO: 113, SEQ ID NO: 16 and SEQ ID NO: 122 were used to detect HBV virus, and the detection limit did not meet the detection requirements ( Figure 2 c and d); using SEQ ID NO: 100, SEQ ID NO: 104 and SEQ ID NO: 111 to detect NTC, SEQ ID NO: 115, SEQ ID NO: 19 and SEQ ID NO: 22 to detect NTC, there is a tail phenomenon, indicating that there is interference and does not meet the detection requirements ( Figure 2 ef).

[0170] Among the primer probes for simultaneous detection of S gene and C gene, a total of 16 groups meet the requirements for detecting HBV viral nucleic acid, as shown in Table 12.

[0171] Table 12

[0172]

[0173] Example 3 Obtaining primer probes for detecting HBV nucleic acid targets and internal standard IS

[0174] After extracting nucleic acid by mixing 200 μL HBV standard (purchased from Conchestan) and 10 μL internal standard pseudovirus, 30 μL was taken as a template and PCR amplification was performed using the amplification system in Table 8 and the amplification program in Table 9. According to the PCR amplification curve, each primer probe was tested to see whether it met the requirements for HBV nucleic acid detection - the HBV detection limit reached 5 IU / mL, the NTC was non-specific, and the linear amplification efficiency of the HBV standard and the internal standard IC was 98% to 105%.

[0175] Representative experimental profiles of primers and probes for detecting HBV and internal standard pseudoviruses are shown in Figure 2. Figure 3 shown.

[0176] SEQ ID NO: 10, SEQ ID NO: 12 and SEQ ID NO: 20, SEQ ID NO: 15, SEQ ID NO: 17 and SEQ ID NO: 22 and SEQ ID NO: 9, SEQ ID NO: 4 and SEQ ID NO: 5 were used to detect HBV virus and internal standard pseudovirus, and the detection limit, linearity and specificity were good ( Figure 3a, b and c); SEQ ID NO: 13, SEQ ID NO: 14 and SEQ ID NO: 21, SEQ ID NO: 15, SEQ ID NO: 17 and SEQ ID NO: 23 and SEQ ID NO: 9, SEQ ID NO: 27 and SEQ ID NO: 30 were used to detect HBV virus and internal standard pseudovirus, and the internal standard was nonspecific ( Figure 3 d); SEQ ID NO: 101, SEQ ID NO: 14 and SEQ ID NO: 20, SEQ ID NO: 18, SEQ ID NO: 19 and SEQ ID NO: 22 and SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 30 were used to detect HBV virus and internal standard pseudovirus. In the linear range test, high concentration of target will inhibit the amplification efficiency of the internal standard gene ( Figure 3 e); using SEQ ID NO: 13, SEQ ID NO: 14 and SEQ ID NO: 21, SEQ ID NO: 18, SEQ ID NO: 19 and SEQ ID NO: 22 and SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 38 to detect HBV virus and internal standard pseudovirus, the amplification of the internal standard gene will be inhibited ( Figure 3 f) in.

[0177] Among the primer probes for simultaneous detection of S gene, C gene and internal standard IS, a total of 5 groups meet the requirements for detecting HBV viral nucleic acid, and the statistics are shown in Table 13.

[0178] Table 13

[0179]

[0180] Among them, the linear amplification efficiency of group 2 for HBV standard and internal standard pseudovirus was the best (99.5%~

[0181] 100.5%), the best effect. 5IU / mL repeated 20 times, 100% detection rate ( Figure 4 ); the negative sample with internal standard was repeated 10 times, and the results were all negative ( Figure 5 ); The negative sample without internal standard was repeated 10 times, and no tailing of the target and internal standard curves occurred ( Figure 6 ), indicating good specificity and qualified reagents.

[0182] Example 4 Method for quantitative detection of HBV nucleic acid by internal standard method

[0183] This example takes internal standard gene 1 (sequence is SEQ ID NO: 1, primers are SEQ ID NO: 3 and SEQ ID NO: 4, and probe is SEQ ID NO: 5) as an example to explain in detail how to use the internal standard method to quantitatively detect HBV nucleic acid, including the following steps:

[0184] 1. Calculate internal standard concentration

[0185] Each batch of internal standard reagent needs to be calibrated with the national standard of hepatitis B virus nucleic acid to calculate the concentration of the internal standard reagent:

[0186] (1) Use the national standard of hepatitis B virus nucleic acid (5 IU / mL, batch number 340022-201601) and negative serum to prepare 8 concentrations (1.0E+08 IU / mL, 1.0E+07 IU / mL, 1.0E+06 IU / mL, 1.0E+05 IU / mL, 1.0E+04 IU / mL, 1.0E+03 IU / mL, 1.0E+02 IU / mL, 1.0E+01 IU / mL) in a gradient dilution;

[0187] (2) Take 200 μL of each standard sample of each concentration, add 10 μL of internal standard gene IS1 solution (i.e., SEQ ID NO: 1), and then use a magnetic bead nucleic acid extraction kit (Wondfo, Guangzhou) to extract DNA.

[0188] (3) Take out the eight-tube PCR freeze-dried tube from the kit and centrifuge at 6000 rpm for 10 seconds. According to the total number of samples to be tested, the number of PCR reaction tubes required is set as N (N = number of samples + negative quality control + strong positive quality control + weak positive quality control), take 30 μL of the extracted DNA sample as a template and put it into the eight-tube with freeze-dried blocks, cover the lid, shake and mix, and then put the eight-tube into the amplification instrument (Shanghai Hongshi SLAN-96S) for PCR amplification (reaction system is the same as Table 8), and the amplification program is shown in Table 14.

[0189] Table 14

[0190]

[0191] (4) Fluorescence signal collection channels are FAM channel and Cy5 channel, and experimental results are analyzed

[0192] Each concentration was measured 3 times and then the average value was calculated; the accuracy of each dilution concentration value required that the logarithmic deviation between the theoretical value and the measured value be within the range of ±0.5. The results are shown in Table 15 and Figure 7 shown.

[0193] Table 15

[0194]

[0195] From Table 15 and Figure 7 The results show that the average value of the test results of the above gradient concentration samples is linearly positively correlated with the theoretical value, |r|>0.95; the lg logarithm of the average value of the gradient concentration and the Ct value are used as the standard curve, and the linear correlation coefficient |R|≥0.98; then through the formula Wherein E represents the amplification efficiency. In this embodiment, E of HBV and the internal standard is 100%±5%, which is approximately 100%. Therefore, the internal standard concentration of this batch is calculated to be 2150 IU / mL.

[0196] 2. Detect the HBV nucleic acid concentration of the sample to be tested

[0197] Take 200 μL of the sample to be tested, add 10 μL of the above-mentioned internal standard gene IS1 solution (i.e., SEQ ID NO: 1), and use a magnetic bead method nucleic acid extraction kit (Guangzhou Wanfu) to extract DNA. Take 30 μL of the extracted DNA sample as a template, prepare the reaction system shown in Table 8, and perform PCR amplification according to the amplification program in Table 14. The fluorescence signal collection channels are FAM channel and Cy5 channel.

[0198] By formula Wherein E represents the amplification efficiency. In this embodiment, E of HBV and the internal standard is 100%±5%, which is approximately 100%. The internal standard concentration is 2150 IU / mL, so as to calculate the HBV virus concentration of the sample to be tested.

[0199] Example 5 Methodological verification of the method for detecting HBV nucleic acid by the internal standard method of the present invention

[0200] 1. Sensitivity

[0201] The method of Example 4 was used to detect the national standard of hepatitis B virus (batch number 300022-201601) with concentrations of 10 IU / mL, 5 IU / mL, 2 IU / mL and 1 IU / mL (internal standard concentration was 2150 IU / mL), and each sample was measured 20 times. The results are shown in Table 16.

[0202] Table 16

[0203]

[0204] Therefore, the detection limit of the method of the present invention is 2 IU / mL.

[0205] 2. Precision

[0206] The method of Example 4 was used to detect HBV-R1 (1.0E+04 IU / mL), HBV-R2 (100 IU / mL) (standard, purchased from Conchestan) and negative sample R3 (serum purchased from Technopath), and each sample was measured 20 times, and the results of the melting peak and Tm value of each channel (FAM, VIC) of the fluorescent PCR were counted. The results are shown in Table 17.

[0207] Table 17

[0208] name concentration Test results HBV-R1 1.0E+04IU / mL 100％(20 / 20) HBV-R2 100IU / mL 100％(20 / 20) HBV negative sample - R3 - 100％(20 / 20)

[0209] 3. Repeatability

[0210] HBV-R1 (1.0E+04 IU / mL), HBV-R2 (100 IU / mL) and negative sample R3 (same source) were tested using the method of Example 4, and each sample was tested 20 times. The results showed that the CV of the logarithmic value of the average value of the 20 concentrations was ≤5.0%.

[0211] 4. Interference verification

[0212] In order to investigate the effect of endogenous substances that may exist in serum samples on the test results, one HBV positive sample and one negative sample (samples from clinical sources) were equally divided into four parts using serum samples, endogenous interfering substances human whole blood, mucin and hemoglobin were added to three parts, and no substance was added to one part. After the sample and the interfering substance were fully mixed, they were left to stand for 1 hour, nucleic acid was extracted, and three batches of detection reagents were used for detection (same as Example 4), each batch was tested 10 times, and then the peak was counted and the Tm value of the peak was correct. The results are shown in Table 18.

[0213] Table 18

[0214]

[0215] The results in Table 18 show that the endogenous interfering substances that may exist in serum, such as whole blood, mucin and hemoglobin, were added to the samples and nucleic acid was extracted for testing. The test results all met the requirements, no inhibition was observed, and there was no interference with the test results.

[0216] 5. Detection of HBV gene range

[0217] The method of Example 4 was used to detect HBV-A genotype, HBV-B genotype, HBV-C genotype, HBV-D genotype, HBV-E genotype, HBV-F genotype, HBV-G genotype, HBV-H genotype and HBV-I genotype (all pseudovirus samples, synthesized by Fubai'ao, with concentrations of 1.0E+04 IU / mL and 1.0E+02 IU / mL, respectively). Each sample was measured 3 times, and the results are shown in Table 19.

[0218] Table 19

[0219] Type Concentration (IU / mL) Average concentration of test (IU / mL) Average concentration lg logarithm CV HBV-A genotype 1.00E+04 1.03E+04 4.01 ＜5％ HBV-B genotype 1.00E+04 9.94E+03 4.00 ＜5％ HBV-C genotype 1.00E+04 1.01E+04 4.00 ＜5％ HBV-D genotype 1.00E+04 1.10E+04 4.04 ＜5％ HBV-E genotype 1.00E+04 1.05E+04 4.02 ＜5％ HBV-F genotype 1.00E+04 9.95E+03 4.00 ＜5％ HBV-G genotype 1.00E+04 1.02E+04 4.01 ＜5％ HBV-H genotype 1.00E+04 1.05E+04 4.02 ＜5％ HBV-I genotype 1.00E+04 1.01E+04 4.00 ＜5％ HBV-A genotype 1.00E+02 1.10E+02 2.04 ＜5％ HBV-B genotype 1.00E+02 1.04E+02 2.02 ＜5％ HBV-C genotype 1.00E+02 9.84E+01 1.99 ＜5％ HBV-D genotype 1.00E+02 1.03E+02 2.01 ＜5％ HBV-E genotype 1.00E+02 1.02E+02 2.01 ＜5％ HBV-F genotype 1.00E+02 1.06E+02 2.03 ＜5％ HBV-G genotype 1.00E+02 1.02E+02 2.01 ＜5％ HBV-H genotype 1.00E+02 1.08E+02 2.03 ＜5％ HBV-I genotype 1.00E+02 1.15E+02 2.12 ＜5％

[0220] The results in Table 19 indicate that the detection method of the present invention can cover the detection of the AI ​​genotype of HBV.

[0221] Example 6 Clinical sample detection effect

[0222] The method of Example 4 was used to test the remaining samples after 50 clinical HBV tests. The control kit was a hepatitis B high-sensitivity kit (S Company). The test results of the kit of the present invention were compared with the test results of the kit of S Company (external standard method quantification, regression curve y=0.9561x+0.2973, |R|>0.95, P=0.001) to evaluate the accuracy of the detection method of the present invention for sample detection. The absolute value of the difference in the lg logarithmic values ​​of the two met the requirements within 0.5. The results are shown in Table 20.

[0223] Table 20

[0224]

[0225]

[0226]

[0227] The results show that the results of quantitatively detecting HBV virus using the internal standard method of the present invention are consistent with the results of the method for detecting HBV virus using the external standard method of S Company.

[0228] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0229] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. An internal standard gene for quantitative detection of HBV nucleic acid, characterized in that: The nucleotide sequence is shown in SEQ ID NO: 1 or SEQ ID NO: 2, preferably SEQ ID NO:

1.

2. A primer probe for detecting the internal standard gene according to claim 1, characterized in that: The primer probe is selected from any one of the following groups: Group A: primers having sequences as shown in SEQ ID NO:3 and SEQ ID NO:4, and a probe having a sequence as shown in SEQ ID NO:5; Group B: including primers having sequences as shown in SEQ ID NO:9 and SEQ ID NO:4, and a probe having a sequence as shown in SEQ ID NO:5; Group C: including primers having sequences as shown in SEQ ID NO:6 and SEQ ID NO:7, and a probe having a sequence as shown in SEQ ID NO:8; The primer probe described in Group A is preferred.

3. The primer probe for detecting the internal standard gene according to claim 2, characterized in that: The 5' and 3' ends of the probe are both modified with fluorescent groups; and / or, the fluorescent groups modified with the 5' and 3' ends are different; and / or, the 5' end is modified with Cy5 or FAM, and the 3' end is modified with BHQ1 or BHQ3.

4. Use of the primer probe according to claim 2 or 3 in preparing a kit for quantitative detection of HBV nucleic acid.

5. A kit for quantitatively detecting HBV nucleic acid, characterized in that: It comprises the internal standard gene according to claim 1, the probe primer according to claim 2 or 3, and a primer probe for detecting the HBV gene, wherein the primer probe for detecting the HBV gene is selected from any one of the following groups: Group 1: primers having sequences as shown in SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 15 and SEQ ID NO: 16, and probes having sequences as shown in SEQ ID NO: 20 and SEQ ID NO: 22; Group 2: primers having sequences as shown in SEQ ID NO: 10 and SEQ ID NO: 12, SEQ ID NO: 15 and SEQ ID NO: 17, and probes having sequences as shown in SEQ ID NO: 20 and SEQ ID NO: 22; Group 3: primers having sequences as shown in SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15 and SEQ ID NO: 17, and probes having sequences as shown in SEQ ID NO: 21 and SEQ ID NO: 23; Group 4: primers with sequences as shown in SEQ ID NO:13 and SEQ ID NO:14, SEQ ID NO:18 and SEQ ID NO:19, and probes with sequences as shown in SEQ ID NO:21 and SEQ ID NO:

22.

6. The kit for quantitative detection of HBV nucleic acid according to claim 5, characterized in that: include: The sequence of the internal standard gene is shown in SEQ ID NO: 1; The primer probe described in Group A; 2 sets of primer probes.

7. The kit for quantitative detection of HBV nucleic acid according to claim 5, characterized in that: include: The sequence of the internal standard gene is shown in SEQ ID NO: 1; Primer probes as described in Group C; 4 sets of primer probes.

8. The kit for quantitative detection of HBV nucleic acid according to claim 5, characterized in that: The 5' and 3' ends of the probe are both modified with fluorescent groups; and / or the fluorescent groups modified with the 5' and 3' ends are different; and / or the 5' end is modified with Cy5 or FAM, and the 3' end is modified with BHQ3 or BHQ1.

9. The kit for quantitatively detecting HBV nucleic acid according to any one of claims 5 to 8, characterized in that: The working concentrations of the primers for detecting the internal standard gene and the HBV gene are both 180nM to 220nM, and the working concentrations of the probes for detecting the internal standard gene and the HBV gene are both 80nM to 120nM.

10. A method for quantitative detection of HBV nucleic acid for non-diagnostic purposes, characterized in that: The following steps are involved: Extract DNA from the sample to be tested and the internal standard gene, and perform nucleic acid detection using the kit described in any one of claims 5 to 9.

Images