Construction method and application of crisper / cas9-based ovarian cancer brca1 mutant cell model
By constructing a BRCA1 mutant cell model of ovarian cancer and optimizing editing efficiency using the CRISPR/Cas9 system, the challenge of constructing a BRCA1 mutant cell model of ovarian cancer was solved, achieving efficient gene editing and functional validation, and providing support for precision diagnosis and prognostic assessment of ovarian cancer.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- TIANJIN MEDICAL UNIV
- Filing Date
- 2024-11-04
- Publication Date
- 2026-06-09
AI Technical Summary
Existing technologies make it difficult to efficiently construct BRCA1 mutant cell models of ovarian cancer, and the CRISPR/Cas9 gene editing system has low editing efficiency in homology repair-related genes, affecting the precision diagnosis and prognostic assessment of ovarian cancer.
An ovarian cancer BRCA1 mutant cell model was constructed using the CRISPR/Cas9 system. By constructing a stable lenti-Cas9 cell line, a lentiGuide-Puro-gRNA recombinant vector, and combining multiple transfections with ssODN and interference with the key factor MLH1 in the mismatch repair pathway, the efficiency of CRISPR/Cas9 editing of the BRCA1 gene was optimized.
It increased the BRCA1 gene mutation rate, verified the function of novel mutation sites, and provided a theoretical and experimental basis for the precise diagnosis and prognostic assessment of ovarian cancer. It can mutate wild-type into pathogenic or correct back to wild-type for the purpose of studying disease mechanisms and treatment.
Smart Images

Figure CN119614508B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, specifically a method for constructing and applying a CRISPR / Cas9-based BRCA1 mutant cell model of ovarian cancer. Background Technology
[0002] Globally, ovarian cancer (OV) is the leading cause of death among gynecological malignancies, posing a serious threat to women's health. 10%-15% of ovarian cancer cases are related to genetic factors, primarily caused by BRCA1 / 2 mutations. BRCA1 is a tumor suppressor gene involved in DNA repair and is closely related to cancer development. The lifetime risk of developing ovarian cancer in the average woman is 1.4%, while the cumulative risk for BRCA1 mutation carriers is as high as 44%.
[0003] BRCA1 / 2 are genetic susceptibility genes for ovarian cancer. Mutations in these genes can impair high-fidelity repair function in the homologous recombination repair (HRR) pathway, increasing genomic breaks and instability, and consequently increasing cancer risk. Furthermore, studies have confirmed that BRCA mutations are associated with improved prognosis in ovarian cancer patients, making them more likely to undergo secondary cytoreductive surgery. Therefore, the discovery of pathogenic mutations in the BRCA1 / 2 genes can help assess the genetic susceptibility of ovarian cancer patients, develop corresponding genetic management measures (including preventative surgery, regular screening programs, and family genetic risk assessments), assist in developing precision medicine treatment plans (such as predicting the efficacy of platinum-based chemotherapy / PARPi), and assess the prognosis of cancer patients, thereby enabling precise diagnosis and treatment and improving outcomes.
[0004] The CRISPR / Cas9 system is currently the most commonly used gene editing technology. There are three main types, with the most common Type II CRISPR system consisting of two components: the Cas9 nuclease and artificially synthesized guide RNA (gRNA). When the Cas9-gRNA complex recognizes the adjacent motif (PAM) sequence in the NGG (N = A, T, C, or G) protospacer region, the gRNA pairs with the target DNA strand, recruiting the Cas9 nuclease to cleave the DNA strand, creating a double-strand break 3 bp upstream of the PAM. Double-strand breaks (DSBs) are mainly repaired through two mechanisms: one is the dominant intracellular non-homologous end joining (NHEJ) repair mechanism, which can lead to small insertions or deletions; the other is homologous recombination repair (HDR), which adds a foreign template to generate new DNA. The latter introduces a foreign DNA template that needs to contain homologous sequences near the target site, typically requiring a relatively long homologous arm (30-50 bp). The HDR process utilized by CRISPR / Cas9 is a complex process that depends on many variables, such as the cell type of the target DNA, chromatin state, and cell cycle. Currently, although CRISPR gene editing has received widespread attention, improving its editing efficiency, especially for homology repair-related genes, remains a research challenge.
[0005] Therefore, this study aims to establish a method for endogenous editing of the BRCA1 gene based on the classic CRISPR / Cas9 system, optimize its process, improve the BRCA1 mutation rate, and combine the amplification effect of the exogenous point mutation reporter system to double-validate the function of novel mutation sites in the BRCA1 gene, thereby providing a theoretical and experimental basis for its application in ovarian cancer screening, precision diagnosis and treatment, and prognostic assessment. Summary of the Invention
[0006] This application aims to solve the above-mentioned technical problems by proposing a method for constructing and applying a CRISPR / Cas9-based BRCA1 mutant cell model of ovarian cancer.
[0007] In a first aspect, the present invention provides a method for constructing a CRISPR / Cas9-based BRCA1 mutant cell model of ovarian cancer, which is achieved by the following technical solution.
[0008] A method for constructing a CRISPR / Cas9-based BRCA1 mutant cell model of ovarian cancer includes the following steps:
[0009] S1. Construct a stable lenti-Cas9 cell line;
[0010] S2. Construct the lentiGuide-Puro-gRNA recombinant vector: the gRNA sequence containing the BRCA1c.5091T>A and c.5521del point mutations is shown in SEQ ID NO.5 and SEQ ID NO.6;
[0011] S3. Transfect the lentiGuide-Puro-gRNA recombinant vector into a stable lenti-Cas9 cell line;
[0012] S4. Transfect ssODN into gRNA and Cas9 stable ovarian cancer cells: ssODN sequences are shown in SEQ ID NO.13 and SEQ ID NO.14.
[0013] Secondly, this invention provides an improved method for constructing a CRISPR / Cas9-based BRCA1 mutant cell model of ovarian cancer, which is achieved by the following technical solution.
[0014] A method for constructing a CRISPR / Cas9-based BRCA1 mutant cell model of ovarian cancer is proposed. Based on the above method, the efficiency of CRISPR / Cas9 editing of the BRCA1 gene is improved by repeatedly transfecting ssODN and / or interfering with MLH1, a key factor in the mismatch repair pathway.
[0015] Furthermore, ssODN is transfected 2-3 times.
[0016] Furthermore, the siRNA sequence of the MLH1 molecule is shown in SEQ ID NO.47-49.
[0017] Thirdly, the present invention provides a first use of a CRISPR / Cas9-based ovarian cancer BRCA1 mutant cell model, which is achieved by the following technical solution.
[0018] An application of an ovarian cancer BRCA1 mutant cell model prepared by the above method in the preparation of products for evaluating the sensitivity of chemotherapeutic drugs.
[0019] Fourthly, the present invention provides a second use of the CRISPR / Cas9-based ovarian cancer BRCA1 mutant cell model, which is achieved by the following technical solution.
[0020] The application of an ovarian cancer BRCA1 mutant cell model prepared by the above method in the preparation of products for ovarian cancer diagnosis, treatment or prognostic assessment.
[0021] This application has achieved the following beneficial effects.
[0022] This invention relates to a highly efficient CRISPR / Cas9 gene editing technology targeting novel mutation sites (c.5091T>A and c.5521del) in the BRCA1 gene. With the maturity and widespread adoption of high-throughput sequencing technology, more and more hotspot mutations or changes in pathogenic gene domains have been discovered. Therefore, there is an urgent clinical need to construct precise point mutation cell and animal models corresponding to diseases in order to deeply study the mechanisms of disease development and treatment. However, highly efficient and accurate gene editing technologies still face significant challenges. This invention establishes a method for endogenous direct editing of the BRCA1 gene based on the classic CRISPR / Cas9 system, optimizes its process, and improves the BRCA1 gene mutation rate. Simultaneously, it combines an exogenous point mutation plasmid reporter system to verify the function of novel BRCA1 gene mutation sites, thus providing a theoretical and experimental basis for its application in the diagnosis, treatment, and prognostic assessment of ovarian cancer. This technology can not only mutate wild-type to pathogenic types for research on pathogenic mechanisms and clinical phenotypic verification, but also correct pathogenic types back to wild-type for disease treatment. With continuous optimization of the CRISPR / Cas9 gene editing system in applications, it not only provides a theoretical and experimental basis for the application of precision diagnosis and prognostic assessment of ovarian cancer, but also helps to solve more similar clinical problems, showing broad prospects. Attached Figure Description
[0023] Figure 1 This application describes the CRISPR / Cas9 element transfection efficacy (A. the working principle of the CRISPR / Cas9 gene editing tool using ssODN for homology damage repair; B. qRT-PCR verification results of gRNA and Cas9 plasmid transfection in SKOV3 and HEK293T cell lines. *P<0.05, *P<0.05, **P<0.01, ***P<0.001);
[0024] Figure 2 This is the Sanger sequencing image of the BRCA1 mutation site gRNA recombinant vector (lentiGuide-Puro-gRNA) of this application (gRNAs (gRNA 1-1 and gRNA 1-2) targeting the two sites of BRCA1 c.5091T>A and c.5521del, respectively; the sequence of the original lentiGuide-Puro vector is above the sequencing peaks, and the sequence of the recombinant vector composed of the vector and gRNA is below).
[0025] Figure 3This is a diagram showing the editing effects of the combination of gRNA, Cas9 and ssODN applied in this application at different sites (where A. the mutation status of c.5091T>A in SKOV3 and HEK293T cells; B. the mutation status of c.5521del in SKOV3 and HEK293T cells; the target sites are indicated by red boxes).
[0026] Figure 4 This application describes the off-target effects of gRNA1-1 and gRNA1-2 (the off-target genes predicted by COMSID were detected by qRT-PCR, and the results showed that the off-target effects were small).
[0027] Figure 5 This application shows the optimization of the number of transfections of ssODN (A. Flowchart of ssODN transfection; B. Sequencing results of ssODN transfection with different numbers of transfections c.5091T>A in SKOV3 and HEK293T cells, with the peak quantification graph below; C. Sequencing results of ssODN transfection with different numbers of transfections c.5521del in SKOV3 and HEK293T cells).
[0028] Figure 6 This application describes gene editing following interference with the MMR pathway MLH1 (A. Expression levels of MLH1 mRNA in SKOV3 and HEK293T cells; B. SKOV3 cells were transfected with si-MLH1-2 and 1-3 to study the effects of siRNAs targeting different sites on MLH1 mRNA transcription levels; C. In SKOV3 cells, after transfection with si-NC, si-MLH1-2, and si-MLH1-3 for 48 hours, ssODN was transfected, and Sanger sequencing was performed; D. Quantitative analysis of the sequencing data was performed. The sequencing peak diagram of the bases is shown above, and the types of bases at the site and their relative proportions are listed below, showing a significant increase in mutation rate (51% and 27%, respectively)).
[0029] Figure 7 This application describes the construction of exogenous point mutation / domain deletion plasmids and cell lines (AB. the specific location of BRCA1 involved in the point mutation and domain deletion plasmids; C. after transfection with empty vector plasmid (PLVX), point mutation plasmid (MUT-1 / MUT-2), and domain deletion plasmid (domain-del 1 / domain-del 2), qRT-PCR results showed the mRNA expression level of the BRCA1 gene in SKOV3 and HEK293T cells. P<0.05);
[0030] Figure 8This application includes the following experiments on carboplatin inhibition after BRAC1 point mutation (including the difference in sensitivity of ovarian cancer SKOV3BRAC1 c.5091T>A c.5521del endogenous point mutation cell lines to carboplatin detected by AB.CCK-8 assay and the control group; and the carboplatin inhibition experiment on CD.SKOV3BRAC1 exogenous point mutation and domain deletion cell lines).
[0031] Figure 9 This application focuses on the differential mRNA expression of the carboplatin-sensitive gene, a carboplatin-sensitive marker in ovarian cancer, in SKOV3 mutant and non-mutated cells.
[0032] Figure 10 This is the result of the genomic instability detection in this application (AB. Whole exome sequencing to assess the genomic instability of point mutant cells and control cells; A is the number of unstable genomic segments; B is the range of unstable genomic segments).
[0033] Figure 11 This application describes the NMD phenomenon caused by point mutation (the result of UPF1 knockdown in AB.c.5091T>A / c.5521del cells, and the expression of BRCA1 after knockdown. 1:1 and 1:2 represent different transfection ratios of siRNA and Lipo3000).
[0034] Figure 12 This is the experimental flowchart of this application. Detailed Implementation
[0035] Part 1: Constructing an Endogenous Point Mutation Ovarian Cancer Cell Model Using Classic CRISPR / Cas9 Tools
[0036] I. Construction of stable lenti-Cas9 cell lines
[0037] 1. Cell Culture
[0038] After thawing and resuscitating human ovarian cancer cell line (SKOV3) and human embryonic kidney cell line (HEK293T), 1 ml of pre-prepared complete culture medium was added, and the cells were centrifuged at 1000 rpm for 5 min. The supernatant was discarded, and the cells were cultured in complete culture medium. Before the experiment, the cultured (SKOV3, HEK293T) cells were seeded into 6-well plates, ensuring complete cell adhesion and a cell density of approximately 70%.
[0039] 2. Lentiviral packaging
[0040] 1) Preparation of viral solution: HEK293T cells were seeded in 6cm culture dishes. After 12 hours, the cells were starved for 4-6 hours. Cell transfection was then performed according to the target plasmid (lenti-Cas9; Addgene 52962):psPAX2:pMD2.G = 4:3:1. Two EP tubes were filled with 300μl of Opti-MEM medium. One tube contained 8μg of the above-mentioned mixed plasmid, and the other contained 24μl of PEI. The mixture was gently tapped to mix, and the solution from the plasmid tube was added to the transfection reagent tube. The tube was inverted to mix, and incubated at room temperature for 10-13 minutes. The original medium in the 6cm culture dish was discarded and replaced with medium containing only 10% FBS. The plasmid transfection reagent mixture was then added dropwise to the cells. The medium was changed after 6 hours.
[0041] 2) Collecting the viral fluid: Collect the culture medium of HEK293T transfected with the above plasmid into a 50ml centrifuge tube and centrifuge at 2000rpm for 5min. Aspirate the supernatant with a syringe and filter it through a 0.45μm filter membrane.
[0042] 3) Infect target cells: Take healthy SKOV3 / HEK293T cells and seed them in 6-well plates. After 12 hours, starve the cells for 4-6 hours. Discard the original culture medium and add culture medium containing polybrene (0.02%-0.08%), adding 1 ml of virus solution evenly to each well. After 8 hours, replace with fresh complete culture medium. After 48 hours, perform drug screening based on the drug resistance tag (Blasticidin) on the target plasmid (SKOV3 (10 μg / ml), HEK293T (7 μg / ml)). After the control cells have completely died, reduce the drug concentration for maintenance culture.
[0043] 3. RNA extraction
[0044] Add 500 μl of Trizol reagent to a 6 cm dish and incubate on ice for 3-5 min. Transfer to a 1.5 ml enzyme-free EP tube. The ratio of Trizol to nucleic acid extraction reagent (chloroform) is 5:1. Invert and mix well, then incubate on ice for 5 min. Centrifuge at 12000 rpm for 15 min at 4°C. Take 150 μl of the upper clear phase, add isopropanol and mix well, then incubate on ice for 15 min. Centrifuge at 12000 rpm for 10 min at 4°C, discard the supernatant, add 75% ethanol solution and wash the precipitate. Centrifuge at 12000 rpm for 5 min at 4°C, discard the liquid, and wash again with 75% ethanol solution, discarding the liquid. Incubate at room temperature for 5 min. Add 20 μl of enzyme-free water, gently swirl to mix, and store at -80°C.
[0045] 4. RNA reverse transcription and qRT-PCR
[0046] Each reaction system consists of 20 μl. Take 800 ng RNA for reverse reaction, add 4 μl of 4×gDNAwiper mix, and make up to 16 μl with ddH2O. Mix well, incubate briefly at 42℃ for 2 min, then add 4 μl of 5×qRT SuperMixⅡ, mix well, and place in a PCR instrument: 50℃ for 15 min, 80℃ for 2 min.
[0047] Prepare an 18.0 μL reaction mixture, with three replicates per sample. The mixture includes: 10.0 μL 2×ChamQ Universal SYBRqPCR, 0.4 μL Primer-F (10 μM), 0.4 μL Primer-R (10 μM), and 7.2 μL ddH2O. Mix well, briefly centrifuge, and aliquot into 200 μL PCR tubes. Add 2 μL cDNA template at the end. PCR program: 95℃ for 30 s, (95℃ for 10 s, 60℃ for 30 s, 95℃ for 15 s) × 40 cycles, 60℃ for 60 s, 95℃ for 15 s. Data calculation: Relative expression level = 2. -△△Ct目的基因 ; △△Ct target gene = experimental group △Ct目的基因 -Control group △Ct目的基因 ; △Ct target gene = Ct(target gene) - Ct(internal reference gene of the same sample).
[0048] Detection primers:
[0049] Cas9-mRNA F: AGAATGAAGCGGATCGAAGA (SEQ ID NO.1)
[0050] Cas9-mRNA R: GCCATTCTGCAGGTAGTACA (SEQ ID NO.2)
[0051] GAPDH(H)-mRNA F:GAAATCCCATCACCATCTTCCAGG(SEQ ID NO.3)
[0052] GAPDH(H)-mRNA R:GAGCCCCAGCCTTCTCCATG(SEQ ID NO.4)
[0053] Results: Cas9 was stably expressed in both SKOV3 and HEK293T cells (*P<0.05). Figure 1 B (right).
[0054] II. Construction of the lentiGuide-Puro-gRNA recombinant vector
[0055] 1. Design gRNA
[0056] Whole-exome sequencing was performed on postoperative tissues from patients with high-grade serous ovarian cancer. Pathogenicity rating identified two potential pathogenic mutation sites on BRCA1: c.5091T>A and c.5521de. gRNAs 1-1 and 1-2 targeting these two sites were designed using the CRISPOR database (http: / / crispor.gi.ucsc.edu / ).
[0057] gRNA 1-1:ATGCTGAGTTTGTGTGTGAA (SEQ ID NO.5)
[0058] gRNA 1-2: GCAGATGTGTGAGGCACCTG (SEQ ID NO. 6).
[0059] 2. Plasmid Construction
[0060] 1) Linearization of the vector plasmid by enzyme digestion: The 20 μl reaction system included: 3 μg lentiGuide-Puro (addgene#52963), 1 μl BsmBI, 3.1-2.5 μl NEB Buffer, and ddH2O to make up the difference. The control group used ddH2O instead of enzyme. After mixing, the mixture was briefly centrifuged at 55℃ for 2 h.
[0061] 2) Prepare agarose gel (0.8%), add DNA marker, lentiGuide-Puro original plasmid, and enzyme-digested linearized lentiGuide-Puro fragment to different sample wells. Electrophoresis at 100V for 40 min, followed by gel imaging.
[0062] 3) Gel cutting and recovery: When using Buffer GW reagent for the first time, add 80 ml of anhydrous ethanol and store at room temperature. Incubate Buffer GDP at 37°C. Place the gel under a UV lamp, cut off the gel of the target band, place it in a 1.5 ml EP tube, calculate the gel weight, and add GDP buffer at a ratio of gel mass (mg):Buffer GDP = 1:1. Incubate at 55°C for 5 min. Add the mixture to the adsorption column, centrifuge at 12000 rpm for 1 min, discard the waste liquid, add 300 μl of Buffer GDP, let stand at room temperature for 1 min, centrifuge at 12000 rpm for 1 min, and discard the waste liquid again. Add 700 μl of GW buffer to the adsorption column, invert several times, and centrifuge at 12000 rpm for 1 min. Repeat once, finally discard the waste liquid, centrifuge at 12000 rpm for 2 min, and let stand at room temperature for 5 min to allow Buffer GW to evaporate completely. Preheat Buffer EB for 5-10 minutes, place the adsorption column on a 1.5 ml EP tube, add 50 μl of Buffer EB to the adsorption column, let stand at room temperature for 3 minutes, centrifuge at 12000 rpm for 2 minutes, add the liquid from the EP tube back into the adsorption column, centrifuge again, and store at -20℃.
[0063] 4) Oligo annealing: 10 μl reaction mixture includes gRNA primers
[0064] gRNA1-1-F: ACACCGATGCTGAGTTTGTGTGTGAAG (SEQ ID NO.7);
[0065] gRNA1-1-R:AAAACTTCACACACAAACTCAGCATCG (SEQ ID NO.8);
[0066] gRNA1-2-F: ACACCGACCCACTCTCGGGTCACCAC G (SEQ ID NO.9);
[0067] gRNA1-2-R:AAAACGTGGGTGACCCGAGAGTGGGT CG (SEQ ID NO. 10).
[0068] The following PCR reaction was performed: 1 μl gRNA-F (100 μM), 1 μl gRNA-R (100 μM), 1 μl 10×T4PNK Buffer, 0.5 μl T4PNK, 6.5 μl ddH2O, and 2 μl sample. PCR reaction conditions: 37℃ for 30 min, 95℃ for 5 min, then slowly lowered from 95℃ to 25℃, gently tapped to mix, briefly incubated, and loaded onto the PCR machine. The reaction product was then diluted 1:199.
[0069] 5) Ligation: 10 μl reaction mixture, 50 ng linear vector, 1 μl Oligo annealing product, 1 μl 10×T4 Ligase Buffer, 1 μl T4 DNA Ligase, and ddH2O to make up the difference. Set the PCR reaction program to 16℃ for 12-16 h (overnight incubation). After short-term incubation, store at -20℃.
[0070] Results: Sanger sequencing showed that all gRNAs were successfully ligated into the lentiGuide-Puro vector. Figure 2 ).
[0071] 6) Plasmid transformation and amplification:
[0072] Prepare LB solid medium. Transform approximately 5 μl of the PCR product (plasmid ligation product). Remove competent cells (Stable3 / DH5α) from -80℃, aliquot 20 μl into each 1.5 ml EP tube, add 5 μl of plasmid to each tube, gently tap to mix, and incubate on ice for 30 min. Place the EP tubes on a floating plate and incubate in a 42℃ water bath for 60 s. Quickly transfer the EP tubes to ice and incubate for 3-5 min. Add 300-500 μl of LB liquid medium to each EP tube and incubate at 37℃, 220 rpm for 2 h. Inoculate onto plates and incubate at 37℃ for 12-14 h. Add single colonies to LB liquid medium containing 100 μg / ml ampicillin antibiotic and incubate at 37℃, 220 rpm for 8-10 h. Extract plasmids using a kit (Kangwei Century, Jiangsu).
[0073] 3. Transfect gRNA into lenti-Cas9 stable cell lines for construction and validation.
[0074] The lenti-Cas9-stabilized SKOV3 and HEK293T cell lines were transfected with gRNA (the procedure was the same as the Cas9 transfection in the lenti-Cas9 stable cell line construction). After transfection, cells were selected using puromycin (Puro) at concentrations of 1 μg / ml for SKOV3 and 1 μg / ml for HEK293T. qRT-PCR was performed according to the experimental method (see step 5 in the lenti-Cas9 stable cell line construction procedure), using the following primers for amplification:
[0075] gRNA-mRNA F: TTCTTGGGTAGTTTGCAGTT (SEQ ID NO.11)
[0076] gRNA-mRNA R: AGCCAAGAAATCGAAATACT (SEQ ID NO. 12).
[0077] Results: gRNA was stably expressed in cells (*P<0.05) Figure 1 B (left), followed by ssODN transfection.
[0078] III. Transfecting ssODN into gRNA and Cas9-stabilized ovarian cancer cells
[0079] Target cells (SKOV3, HEK293T) were seeded in 6-well plates, with cells adhering completely to the plates at a density of approximately 70%. The supernatant was discarded, and the cells were cultured in DMEM medium for 4 hours. Two 1.5 ml EP tubes were prepared, each containing 250 μl of Opti-MEM medium. In the tube transfecting ssODN, 8 μl of P3000 and 4 μg of ssODN were added, and the mixture was gently tapped to mix. In the transfection reagent tube, 12 μl of Lipo3000 was added, and the mixture was inverted to mix, resulting in a Lipo3000:P3000:ssODN ratio of 3:2:1. The solution from the plasmid tube was then transferred to the transfection reagent tube, and the mixture was incubated at room temperature for 10-15 minutes. The medium was discarded, and the cells were replaced with serum-containing medium. The mixture was then added dropwise to the cells. After 6-10 hours of transfection, the medium was replaced with fresh complete medium. Cells were collected after 48 or 72 hours, and nucleic acids were extracted.
[0080] The ssODN sequence information is as follows:
[0081] ssODN1-1:
[0082] CTTTGAGTGTTTTTCATTCTGCAGATGCTGAGTTTGTGTG A GAACGGACACTGAAATATTTTCTAGGAATTGCGGGAGGAA (SEQ ID NO. 13);
[0083] Note: Underlined and bolded bases are substituted bases.
[0084] ssODN1-2:
[0085] GTGTGAGGCACCTGTGGTGACCCGAGAGTGGGTGTTGGAC Y GTGTAGCACTCTACCAGTGCCAGGAGCTGGACACCTACCT) (SEQ ID NO. 14).
[0086] Note: Underlined and bolded Y characters indicate the locations where bases were deleted.
[0087] IV. Verification of point mutations
[0088] 1. DNA extraction
[0089] Prepare the cell lysis mix: 500 μl TNE solution, 5 μl 20 mg / ml proteinase K, and 50 μl 10% SDS. Resuspend cells in 550 μl of lysis buffer in each sample, incubate overnight in a water bath, then add 186 μl saturated sodium chloride solution and shake vigorously for 10-15 seconds. Add 736 μl nucleic acid extraction buffer (24:1) and incubate in a four-dimensional mixer for 60 minutes to extract nucleic acids to the supernatant. Centrifuge at 12000 rpm for 15 minutes at 4°C, and transfer 400-600 μl of supernatant to a new 1.5 ml EP tube. Add 736 μl isopropanol and incubate at -20°C for 2 hours, then transfer to 4°C 10 minutes beforehand. Centrifuge at 15000 rpm for 15 minutes at 4°C, discard the supernatant, and wash with 200 μl 70% ethanol. Centrifuge at 15000 rpm for 5 min at 4℃, discard the liquid, and let stand at room temperature for 10 min. Add 20 μl of TE buffer.
[0090] 2. DNA fragment amplification
[0091] Specific primers targeting the DNA levels of the target sites (c.5091T>A and c.5521del) were designed using the NCBI-BLAST database. A 50.0 μl PCR Mix solution was prepared, including: 10.0 μl of 5×Q5 Relation Buffer, 1.0 μl of dNTPs (10 mM), 2.5 μl of Primer-F (10 μM), 2.5 μl of Primer-R (10 μM), 1.0 μg of Template DNA, 0.5 μl of Q5 ultra-fidelity DNA polymerase, and up to 50.0 μl of ddH2O. The PCR reaction program was: (98℃ 30 s, 98℃ 10 s, 60℃ 30 s) × 35 cycles - 72℃ 30 s. Add 1×loading buffer to the PCR product, add DNA marker and sample to the sample well in sequence, and then run the gel at 100V for 40 minutes on a 1.5% agarose gel. Observe the electrophoresis results using a gel imaging system.
[0092] Specific primers targeting DNA levels at the target sites (c.5091T>A and c.5521del):
[0093] BRCA1-1-F CTTTGAGTGTTTTCATTCTGC (SEQ ID NO. 15);
[0094] BRCA1-1-R CAATTCTGAGGTGTTAAAGGG (SEQ ID NO. 16);
[0095] BRCA1-2-F GAGGCACCTGTGGTGA (SEQ ID NO. 17);
[0096] BRCA1-2-R GTAAGCTCATTCTTGGGGTC (SEQ ID NO. 18).
[0097] Results: Sanger sequencing after ssODN transfection (Shanghai Sangon Biotech, China) is shown in the figure. Figure 3 This indicates that although no significant point mutations were generated at the two mutation sites in the BRCA1 gene after one transfection with ssODN, Figure 3 A shows that the target site exhibits a trace amount of red edit-replacement "T" peaks. Figure 3 B shows the expected sequence misalignment peaks due to a small amount of "T" deletion.
[0098] V. Detection of off-target effects of BRAC1 gRNA1-1 and gRNA1-2
[0099] 1. DNA-level verification of off-target effects
[0100] The top three potential off-target sites for CRISPR / Cas9 gene editing tools, predicted based on the CRISPOR database (Table 1), mostly occur at introns or gene-to-gene junctions, and the PAM sequences are different, so they do not cause Cas9 cleavage.
[0101] Table 1 Top 3 Miss Positions
[0102]
[0103]
[0104] The underlined bases in the above list represent mismatched base positions that do not perfectly match the gRNA.
[0105] 2. RNA-level verification of off-target effects
[0106] Based on the prediction results from the COMSID website (https: / / crispr.bme.gatech.edu / ), potential off-target genes for gRNA1-1 and gRNA1-2 were further validated. For gRNA1-1, the top 5 genes selected for validation were RAB41, DFNA5, ARPCA, MUC16, and LRRC75A; for gRNA1-2, the top 5 genes selected were CRTAC1, LAMB2, ARHGEF1, HMCN2, and SOCS2. qRT-PCR was performed in the SKOV3 mutant cell line using primers (Table 2) according to the experimental method (see step 3 of the Lenti-Cas9 stable cell line construction procedure).
[0107] Table 2 Primers for predicting off-target genes.
[0108]
[0109] Results: No significant difference was observed in the expression levels of off-target genes in SKOV3 ovarian cancer cells before and after gRNA transfection (p>0.05), indicating no off-target effect. Figure 4 ).
[0110] 3. Detection of off-target effects at the whole genome level: Further whole-exome sequencing was performed on SKOV3 cells that successfully underwent the BRCA1c.5091T>A mutation. The results showed that no mutations of the above-mentioned potential off-target genes were found in either the control group or the experimental group cells, confirming that the selected gRNA had no off-target effects.
[0111] Part Two: An Optimized Model for the CRISPR / Cas9 System for Efficient Editing of the BRCA1 Gene
[0112] I. Optimize SSODN transfection time
[0113] according to Figure 5 A workflow was used to investigate the effect of multiple transfections on the efficiency of ssODN integration in cells. SKOV3 and HEK293T cells containing gRNA and Cas9 were transfected with ssODN at different numbers using the transfection method described in step three of Part I. DNA was then extracted according to experimental procedures, and the cellular DNA was subjected to Sanger sequencing (Shanghai Sangon Biotech, China). Figure 5 BC). Figure 5 The sequencing peak diagram above B is entered into the EditR website (http: / / baseeditr.com / ) to obtain... Figure 5 The result below B.
[0114] Results: The results showed that for gRNA1-1 targeting sites, three transfections with ssODN yielded the best results in both SKOV3 and HEK293T cells, with an editing efficiency of up to 29%. The fourth transfection did not further increase the peak value of the target site, which was 13% and 11%, respectively. For gRNA1-2 targeting sites, two transfections with ssODN yielded the best results.
[0115] II. MLH1 molecules that interfere with the MMR pathway
[0116] When homologous repair-related genes are interfered with, the role of non-homologous repair (MMR, mismatch repair) will dominate in DNA repair, with MLH1 being a key molecule in this pathway. Therefore, editing of homologous recombination repair can be promoted by interfering with MLH1 molecules.
[0117] 1. Following step 3 in the construction of the lenti-Cas9 stable cell line, the expression level of MLH1 mRNA in SKOV3 and HEK293T cells was detected using MLH1 primers.
[0118] MLH1 primers
[0119] MLH1-mRNA-F CTCTTCATCAACCATCGTCTGG (SEQ ID NO.45)
[0120] MLH1-mRNA R GCAAATAGGCTGCATACACTGTT (SEQ ID NO.46)
[0121] Results: The expression level of this gene was high in SKOV3 ovarian cancer cells. Figure 6 A).
[0122] 2. siRNA interference with MLH1 molecules: SKOV3 adherent cells were seeded in 6-well plates. Two 1.5ml EP tubes were prepared, each containing 250μl of Opti-MEM. The plasmid tube contained 7.5μl (20μM) of siRNA. The SKOV3 adherent cells were removed from the incubator, the supernatant was discarded, and 1.5ml of medium containing 10% FBS was added. 500μl of plasmid transfection reagent mixture was then added dropwise to the cell supernatant and mixed thoroughly. After incubation for 6-10 hours, the medium was changed.
[0123] siRNA of MLH1 molecule:
[0124] Si-MLH1-1AUGAUUGAGAACUGUUUAGTT (SEQ ID NO. 47);
[0125] Si-MLH1-2AUGAAUGGUUACAUAUCCATT (SEQ ID NO. 48);
[0126] Si-MLH1-3UGGAAAUGGUGGAAGAUGATT (SEQ ID NO. 49).
[0127] result: Figure 6 B shows the different knockdown effects of si-MLH1. Cells from the si-MLH1-2 and si-MLH1-3 groups, which showed better knockdown effects, were selected for subsequent experiments. Cell DNA was extracted 48 hours after BRCA1 gene editing for PCR amplification and Sanger sequencing. Figure 6 C).
[0128] Will Figure 6Sequencing peak diagrams of si-MLH1-2Cas9gRNA1-1ssODN and si-MLH1-3Cas9gRNA1-1ssODN transfected in cell C were input into the EditR website to obtain... Figure 6 The result of D.
[0129] Results: Quantitative analysis of the peak diagram showed that the cell mutation efficiency of the si-MLH1-3 group was higher (51% > 27%).
[0130] Part III. Construction of Exogenous BRCA1 Point Mutation Ovarian Cancer Cell Lines
[0131] To further verify the functional mechanism of BRCA1 endogenous point mutations constructed using CRISPR / Cas9, a BRCA1 mutant exogenous plasmid reporter system was designed and constructed. Figure 7 A). Because the point mutation is located in the BRCT domain of BRCA1, a plasmid containing the deletion of the domain of the point mutation was also constructed.
[0132] I. Design and Construction of BRCA1 Expression Plasmid
[0133] 1. For the BRCA1 gene, the NM_007294 transcript was selected for overexpression plasmid construction. qRT-PCR primers were designed using the NCBI-BLAST database to detect the mRNA expression level of BRCA1 in ovarian cancer cells. HEK293T cells with high expression levels were selected for amplification of the target fragment.
[0134] 2. gDNA removal was performed using a kit (Novizan, Nanjing). A 10 μl reaction mixture included 2 μg RNA, 2 μl 5×gDNA wiper mix, and ddH2O to make up the difference. The mixture was gently mixed by pipetting. The solution was incubated at 42℃ for 2 min.
[0135] 3. Synthesis of long cDNA fragments: A 10 μl reaction mixture includes: 10 μl of the mixture from the previous step, 2 μl of 10×RT Mix, 2 μl of HiScript III Enzyme Mix, 1 μl of Oligo(dT)20VN, and 5 μl of ddH2O. Gently mix with a pipette. Incubate at 37℃ for 45 min, then at 85℃ for 5 s.
[0136] 4. Amplify the CDS region fragment of BRCA1.
[0137] The reaction mixture (50.0 μl) included: 25.0 μl of 2×PhantaMax Buffer, 0.5–2.0 μl of template cDNA, 1.0 μl of dNTP Mix (10 mM), 2.0 μl of Primer-F (10 μM), 2.0 μl of Primer-R (10 μM), 1.0 μl of PhantaMax Super-Fidelity DNA Polymerase, and ddH2O to make up the difference. Because the CDS region of BRCA1 is relatively long, it was amplified in two parts. After inverting and mixing, the mixture was placed in a PCR instrument. The amplification program was: 95℃ 180°C, 95℃ 15°C, 55–65℃ 15°C, 72℃ 120×35°C, 72℃ 300°C ∝. The target fragment was recovered following the fragment recovery steps in step 2 of the gRNA recombinant vector construction procedure.
[0138] 5. Enzyme digestion of vector plasmids
[0139] Linearization plasmid reaction system: A 50 μl mixture consisted of 2 μg PLVX-CMV, 1 μl XhoI, 2.15 μl 10×Buffer, and ddH2O to be added. After thorough mixing, the mixture was run on an instrument at 37℃ for 2 hours. After the reaction, BstbI restriction endonuclease was added to the mixture, and after thorough mixing, it was run at 65℃ for 2 hours. Finally, agarose gel electrophoresis was performed for verification.
[0140] 6. Connection of the target fragment to the linearized vector
[0141] The BRCA1 expression plasmid was constructed using the PLVX vector plasmid, which was digested with XhoI and BstBI enzymes, and then the following two fragments were inserted.
[0142] The first half of the cDNA sequence expressing insert fragment 1BRCA1 (gene sequence 1nt-4357nt) (SEQ ID NO. 50)
[0143]
[0144] The latter half of the cDNA sequence expressing the insert fragment 2BRCA1 (gene sequence 4358nt-5592nt) (SEQ ID NO. 51)
[0145]
[0146] The forward amplification primer sequence for insert fragment 1 is as follows:
[0147] The reverse amplification primer sequence for insert fragment 1-BRCA-F: 5'-ctaccggactcagatctcgagATGGATTTATCTGCTCTTCGCG-3' (SEQ ID NO. 52) is as follows:
[0148] CSovBRCA-R: 5'-tactgCTTTTTCTGATGTGCTTTGTTCTGG-3' (SEQ ID NO.53)
[0149] The forward amplification primer sequences for insert fragment 2 are as follows:
[0150] CSovBRCA-F: 5'-gcacatcagaaaaagCAGTATTAACTTCACAGAAAAGTAGTGAATAC-3'(SEQID NO.54)
[0151] The reverse amplification primer sequence for insert fragment 2 is as follows:
[0152] 2-BRCA-R: 5'-ccgtcgactgcagaattcgaaTCAGTAGTGGCTGTGGGGGA-3' (SEQ IDNO.55)
[0153] II. Construction of BRCA1 point mutation and domain deletion plasmids
[0154] 1. Using a seamless cloning approach, three pairs of upstream and downstream primers were designed for amplification of point mutations, and two pairs of upstream and downstream primers were designed for amplification of domain deletions.
[0155] 2. Using the BRCA1 expression plasmid constructed above (the plasmid constructed in step one) as an amplification template, amplification and ligation were performed directly using primers with point mutations and domain deletions.
[0156] (1) Point mutation
[0157] ① 1-1 mutant plasmid (1c.5091T>A; MUT-1)
[0158] The following three fragments were inserted into the PLVX vector plasmid after digestion with XhoI and BstBI enzymes.
[0159] The three inserted segments
[0160] The inserted fragment 1 is the same as fragment 1 (1nt-4357nt) used in the BRCA1 expression plasmid construction described above.
[0161] Insert fragment 2 is a partial sequence (4358nt-5090nt) of fragment 2 in the BRCA1 expression plasmid construction described above.
[0162] Insertion fragment 3 introduces a mutant BRCA1 expression plasmid (5091nt-5592nt) (SEQ ID NO.56).
[0163] 5091nt -A GAACGGACACTGAAATATTTTCTAGGAATTGCGGGAGGAAAATGGGTAGTTAGC TATTTCTGGGTGACCCAGTCTATTAAAGAAAGAAAAATGCTGAATGAGCATGATTTTGAAGTCAGAGGAGATGTGGTCAATGGAAGAAACCACCAAGGTCCAAAGCGAGCAAGAGAATCCCAGGACAGAAAGATCTTCAGGGGGCTAGAAATCTGTTGCTATGGGCCCTTCACCAACATGCCCACAGATCAACTGGAATGGATGGTACAGCTGTGTGGTGCTTCTGT GGTGAAGGAGCTTTCATCATTCACCCTTGGCACAGGTGTCCACCCAATTGTGGTTGTGCAGCCAGATGCCTGGACAGAGGACAATGGCTTCCATGCAATTGGGCAGATGTGTGAGGCACCTGTGGTGACCCGAGAGTGGTGTTGGACAGTGTAGCACTCTACCAGTGCCAGGAGCTGGACACCTACCTGATACCCCAGATCCCCCACAGCCACTACTGA-5592nt
[0164] Note: Mutations are indicated by bolded and underlined bases.
[0165] The primer sequence for forward amplification of insert fragment 1 is as follows:
[0166] 1-BRCA-F: 5'-ctaccggactcagatctcgagATGGATTTATCTGCTCTTCGCG-3' (SEQ IDNO.52)
[0167] The primer sequence for reverse amplification of insert fragment 1 is as follows:
[0168] CSovBRCA-R: 5'-tactgCTTTTTCTGATGTGCTTTGTTCTGG-3' (SEQ ID NO.53)
[0169] The primer sequences for forward amplification of insert fragment 2 are as follows:
[0170] CSovBRCA-F: 5'-gcacatcagaaaaagCAGTATTAACTTCACAGAAAAGTAGTGAATAC-3'(SEQID NO.54)
[0171] The primer sequences for reverse amplification of insert fragment 2 are as follows:
[0172] CSBRCA-11-F: 5'-gtgtccgttctCACACAAACTCAGCATCTGTTTTCA-3' (SEQ ID NO.57)
[0173] The primer sequences for forward amplification of insert fragment 3 are as follows:
[0174] CSBRCA-11-R: 5'-gtttgtgtgAGAACGGACACTGAAATATTTTCTAGG-3' (SEQ ID NO.58)
[0175] The primer sequence for reverse amplification of insert fragment 3 is as follows:
[0176] 2-BRCA-R: 5'-ccgtcgactgcagaattcgaaTCAGTAGTGGCTGTGGGGGA-3' (SEQ IDNO.55)
[0177] ② 1-2 mutant plasmid (c.5521del; MUT-2)
[0178] The following three fragments were inserted into the PLVX vector plasmid after digestion with XhoI and BstBI enzymes.
[0179] The three inserted segments
[0180] Insert fragment 1 (same as fragment 1 in the BRCA1 plasmid construction above) 1nt-4357nt
[0181] Insert fragment 2 (part of fragment 2 in the above BRCA1 plasmid construction) 4358nt-5520nt
[0182] Insertion fragment 3 (part of fragment 2 in the above BRCA1 plasmid construction) 5522nt-5592nt (SEQ ID NO. 59)
[0183] 5522nt -YGTGTAGCACTCTACCAGTGCCAGGAGCTGGACACCTACCTGATACCCCAGATCCCCCACAGCCACTACTGA-5592nt
[0184] Note: The bold underlined Y indicates the position where a base was deleted.
[0185] The primer sequence for forward amplification of insert fragment 1 is as follows:
[0186] 1-BRCA-F: 5'-ctaccggactcagatctcgagATGGATTTATCTGCTCTTCGCG-3' (SEQ IDNO.52)
[0187] The primer sequence for reverse amplification of insert fragment 1 is as follows:
[0188] CSovBRCA-R: 5'-tactgCTTTTTCTGATGTGCTTTGTTCTGG-3' (SEQ ID NO.53)
[0189] The primer sequences for forward amplification of insert fragment 2 are as follows:
[0190] CSovBRCA-F: 5'-gcacatcagaaaaagCAGTATTAACTTCACAGAAAAGTAGTGAATAC-3'(SEQID NO.54)
[0191] The primer sequences for reverse amplification of insert fragment 2 are as follows:
[0192] CSBRCA-12-F: 5'-agagtgctacacGTCCAACACCCACTCTCGGG-3' (SEQ ID NO.60)
[0193] The primer sequences for forward amplification of insert fragment 3 are as follows:
[0194] CSBRCA-12-R: 5'-tgttggacGTGTAGCACTCTACCAGTGCCAGG-3' (SEQ ID NO.61)
[0195] The primer sequence for reverse amplification of insert fragment 3 is as follows:
[0196] 2-BRCA-R: 5'-ccgtcgactgcagaattcgaaTCAGTAGTGGCTGTGGGGGA-3' (SEQ IDNO.55)
[0197] (2) Missing domain
[0198] ① Domain-deleted plasmid (domain-del 1, missing two BRCT domains)
[0199] The following two fragments were inserted into the PLVX vector plasmid after digestion with XhoI and BstBI enzymes.
[0200] Two inserted fragments
[0201] Insert fragment 1 is the same as fragment 1 (1nt-4357nt) used in the BRCA1 plasmid construction described above.
[0202] Insert fragment 2: A partial sequence of fragment 2 (4358 nt - 4929 nt) from the above BRCA1 plasmid construction.
[0203] The primer sequence for forward amplification of insert fragment 1 is as follows:
[0204] 1-BRCA-F: 5'-ctaccggactcagatctcgagATGGATTTATCTGCTCTTCGCG-3' (SEQ IDNO.52)
[0205] The primer sequence for reverse amplification of insert fragment 1 is as follows:
[0206] CSovBRCA-R: 5'-tactgCTTTTTCTGATGTGCTTTGTTCTGG-3' (SEQ ID NO.53)
[0207] The primer sequences for forward amplification of insert fragment 2 are as follows:
[0208] CSovBRCA-F: 5'-gcacatcagaaaaagCAGTATTAACTTCACAGAAAAGTAGTGAATAC-3'(SEQID NO.54)
[0209] The primer sequences for reverse amplification of insert fragment 2 are as follows:
[0210] CSJGY-BRCA-1F: 5'-ccgtcgactgcagaattcgaaTGTTGAAGCTGTCAATTCTGGC-3' (SEQ ID NO.62) ② Domain 2 deletion plasmid (domain-del 2; one BRCT domain is missing)
[0211] The following two fragments were inserted into the PLVX vector plasmid after digestion with XhoI and BstBI enzymes.
[0212] Two inserted fragments
[0213] Insert fragment 1 is the same as fragment 1 (1nt-4357nt) used in the BRCA1 plasmid construction described above.
[0214] Insert fragment 2: A partial sequence of fragment 2 (4358 nt - 5271 nt) from the above BRCA1 plasmid construction.
[0215] The primer sequence for forward amplification of insert fragment 1 is as follows:
[0216] 1-BRCA-F: 5'-ctaccggactcagatctcgagATGGATTTATCTGCTCTTCGCG-3' (SEQ IDNO.52)
[0217] The primer sequence for reverse amplification of insert fragment 1 is as follows:
[0218] CSovBRCA-R: 5'-tactgCTTTTTCTGATGTGCTTTGTTCTGG-3' (SEQ ID NO.53)
[0219] The primer sequences for forward amplification of insert fragment 2 are as follows:
[0220] CSovBRCA-F: 5'-gcacatcagaaaaagCAGTATTAACTTCACAGAAAAGTAGTGAATAC-3'(SEQID NO.54)
[0221] The primer sequences for reverse amplification of insert fragment 2 are as follows:
[0222] CSJGY-BRCA-1R: 5'-ccgtcgactgcagaattcgaaGTCCTGGGATTCTCTTGCTCG-3' (SEQ IDNO.63)
[0223] III. Lentiviral Packaging and Construction of Stable Cell Lines with BRCA1 Point Mutations and Domain Deletions
[0224] The exogenous plasmid constructed above was transfected into SKOV3 and HEK293T cells according to the lentivirus packaging steps in Part I. Primers (BRCA1-mRNA F: GAAACCGTGCCAAAAGACTTC (SEQ ID NO. 64); BRCA1-mRNA) were used.
[0225] R:CCAAGGTTAGAGAGTTGGACAC(SEQ ID NO.65) was detected by qRT-PCR.
[0226] Results: Point mutations and domain deletion plasmids were successfully transfected into ovarian cancer SKOV3 and normal control HEK293T cell lines. Figure 7 C)(P<0.05).
[0227] Part IV. Functional Validation of BRCA1 Point Mutations
[0228] I. Carboplatin Inhibition Experiment
[0229] Wild-type cells and mutant cells in good growth condition were diluted to 4 × 10⁻⁶. 4 Cells / ml were inoculated into 96-well plates. After 12 hours, carboplatin was added for culture. 100 μl of a CCK-8 mixed solution with the culture medium was added to each well, and the plates were incubated at 37°C for 2 hours. The plates were shaken on a plate for 10 minutes, and the absorbance values at 450 nm and 490 nm were measured using a microplate reader. The results were collected and analyzed.
[0230] 1. BRCA1 endogenous point mutant cells:
[0231] The SKOV3 cell line SKOV3BRAC1c.5091T>A / c.5521del, constructed endogenously, was subjected to carboplatin inhibition assays.
[0232] Results: Compared with the control group Cas9+gRNA1-1, the BRAC1c.5091T>A mutant group showed increased carboplatin sensitivity of Cas9+gRNA1-1+ssODN (IC50 33.76 μg / ml vs. 29.73 μg / ml, **P<0.01). Figure 8 A). Compared to the control group Cas9+gRNA1-2, the BRAC1c.5521del mutant group also showed increased carboplatin sensitivity to Cas9+gRNA1-2+ssODN (IC50 34.32 μg / ml vs. 28.67 μg / ml, ***P=0.0001). Figure 8 B).
[0233] 2. BRCA1 exogenous point mutant cells:
[0234] Results: The results showed that point mutations and corresponding domain deletions produced the same effect, consistent with the results of endogenous point mutations. All mutant groups showed increased sensitivity to carboplatin (see results below). Figure 8C). In SKOV3 cells, compared to the control group (PLVX, IC50 = 36.18 μg / ml), the point mutant (BRAC1c.5091T>A) cell line (MUT-1, IC50 = 28.65 μg / ml) and the domain-deleted cell line (domain-del1, IC50 = 31.6 μg / ml) showed increased sensitivity to carboplatin. At another site (c.5521del), compared to the control group (PLVX, IC50 = 36.45 μg / ml), the point mutant cell line (MUT-2, IC50 = 30.47 μg / ml) and the domain-deleted cell line (domain-del 2, IC50 = 30.25 μg / ml) also showed increased sensitivity to carboplatin.
[0235] In normal HEK293T cells, compared with the control group (PLVX, IC50 = 45.70 μg / ml), the point mutant cell line (MUT-1, IC50 = 34.17 μg / ml) and the domain-deleted cell line (domain-del 1, IC50 = 39.13 μg / ml) showed increased sensitivity to carboplatin. Figure 8 D). At another site, compared to the control group (PLVX, IC50 = 47.83 μg / ml), the point mutant cell line (MUT-2, IC50 = 33.11 μg / ml) and the domain-deleted cell line (domain-del 2, IC50 = 37.11 μg / ml) also showed increased sensitivity to carboplatin.
[0236] II. Validation of Carboplatin-Sensitivity Related Gene Expression Levels
[0237] The drug resistance database DRESIS (http: / / dresis.idrblab.net / ) was used to search for carboplatin-sensitive genes in ovarian cancer patients. The results showed that TP53 and TIMP1 expression was upregulated in carboplatin-sensitive patients, while AREG, CCND1, MAPK1, GRB2, and RPS6KA3 expression was downregulated. Therefore, mRNA was extracted from SKOV3 wild-type and mutant cells, and the above seven genes were detected by qRT-PCR (Table 3). The experimental results were consistent with the database predictions. Figure 9 ).
[0238] Table 3 Primers for amplifying carboplatin resistance genes
[0239]
[0240]
[0241] III. Genomic Instability Assay
[0242] In SKOV3 cells, whole exon sequencing was performed on control cells (Cas9+gRNA1-1, NC), 72h experimental group cells (Cas9+gRNA1-1+ssODN+carboplatin treatment for 72h), and 96h experimental group cells (Cas9+gRNA1-1+ssODN+carboplatin treatment for 96h) targeting the c.5091T>A site.
[0243] Results: Point mutations showed an increase in the number and extent of unstable genomic segments. Figure 10 ).
[0244] IV. NMD phenomenon caused by BRCA1 point mutations
[0245] Based on bioinformatics predictions, the BRCA1c.5091T>A mutation produces NMD, while the BRCA1c.5521del mutation does not. Accordingly, an siRNA interference targeting the key NMD pathway factor UPF1 (GGGCCUUAACAAGAAGAGATT SEQID NO.80) was designed. Following step three in Part I, the siRNA was transfected into 293T c.5091T>A / c.5521del cells. Two gradients were designed based on the ratio of transfection reagent to si-UPF, namely si-UPF 11:1 and 1:2. The results showed that it successfully knocked down si-UPF1 (…). Figure 11 A). Due to decreased UPF1, BRCA1 mRNA expression was increased in the mutant (c.5091T>A) cell line, indicating that UPF1 is involved in regulating BRCA1 mRNA expression. Therefore, it is inferred that the decreased BRCA1 expression caused by c.5091T>A is due to a UPF1-mediated NMD effect. However, a similar result was not observed in the c.5521del mutant cell line. Figure 11 B).
[0246] The embodiments described in this specific implementation are preferred embodiments of this application and are not intended to limit the scope of protection of this application. Therefore, all equivalent changes made in accordance with the structure, shape and principle of this application should be covered within the scope of protection of this application.
Claims
1. A method for constructing a CRISPR / Cas9-based BRCA1 mutant cell model of ovarian cancer, characterized in that: Includes the following steps: S1. Constructing a stable lenti-Cas9 ovarian cancer cell line; S2. Construct the lentiGuide-Puro-gRNA recombinant vector: containing a gRNA sequence with a BRCA1 c.5091 T >A point mutation, as shown in SEQ ID NO.5; S3. Transfect the lentiGuide-Puro-gRNA recombinant vector into the lenti-Cas9 stable ovarian cancer cell line; S4. Transfect ssODN into gRNA and Cas9 stable ovarian cancer cells: the ssODN sequence is shown in SEQ ID NO.13; The efficiency of CRISPR / Cas9 editing of the BRCA1 gene was improved by interfering with MLH1, a key factor in the mismatch repair pathway. The siRNA sequence of the MLH1 molecule is shown in SEQ ID NO.
49.
2. The application of an ovarian cancer BRCA1 mutant cell model prepared by the method of claim 1 in the preparation of products for evaluating the sensitivity of chemotherapeutic drugs, characterized in that: The chemotherapy drug is carboplatin.