Use of dapansutrile and medicaments

Abstract

The application discloses application of dapansutrile and a medicine. Specifically, the application discloses application of dapansutrile in preparation of a medicine for treating and / or preventing metabolic-related fatty liver disease, and a medicine for treating and / or preventing metabolic-related fatty liver disease, wherein the active ingredient of the medicine comprises dapansutrile, and further comprises a pharmaceutically acceptable excipient, carrier and / or diluent. In the application, the dapansutrile can target NLRP3 inflammasome, maintain mitochondrial homeostasis in liver cells, reduce lipid deposition in liver cells and the liver, and improve glucose metabolism and lipid metabolism.

Description

Technical Field

[0001] This invention relates to the field of biomedicine, specifically to the application and drug of dapoxetine. Background Technology

[0002] Metabolic associated fatty liver disease (MAFLD) is one of the most common chronic liver diseases worldwide. Currently, no drugs are approved by the FDA or EMA for MAFLD. Some marketed drugs have shown efficacy in clinical trials for MAFLD, such as pioglitazone, GLP-1RAs, SGLT-2 inhibitors, vitamin E, and pentoxifylline; however, these drugs have varying degrees of side effects. Pioglitazone can improve liver histology, but it carries risks of edema, weight gain, bladder cancer, and decreased bone mineral density, thus limiting its clinical application. GLP-1RAs improve liver histology but have gastrointestinal adverse reactions. SGLT-2 inhibitors can reduce fat content and improve liver histology, but their effects on liver fibrosis require further investigation. Vitamin E effectively improves liver histology but may increase the risk of prostate cancer. Pentoxifylline can improve lobular inflammation and NAS scores, but it does not improve steatosis, ballooning degeneration, or fibrosis.

[0003] Dapansutrile (OLT1177) is a small molecule β-ketonitrile compound with the following molecular structure:

[0004]

[0005] There are existing studies on dapoxetine for diseases such as knee osteoarthritis and gout, but its role in metabolism-related fatty liver disease is still unclear. Summary of the Invention

[0006] In order to overcome the problems existing in the prior art, the present invention provides an application and drug of dapoxetine.

[0007] The present invention adopts the following technical solution:

[0008] I. An application of dapoxetine.

[0009] Dapanthion is used in the preparation of drugs for the treatment and / or prevention of metabolic-related fatty liver disease.

[0010] Specifically, the dapanthenol is used to reduce lipid deposition in mammalian hepatocytes and liver, thereby achieving the treatment and / or prevention of metabolic-related fatty liver disease.

[0011] The mammals referred to are humans or mice.

[0012] II. A drug for the treatment and / or prevention of metabolic-related fatty liver disease.

[0013] The active ingredient of the drug includes dapoxetine.

[0014] Optionally, the sole active ingredient of the drug is dapoxetine.

[0015] Furthermore, the drug also contains pharmaceutically acceptable excipients, carriers, and / or diluents.

[0016] Furthermore, the drug is an oral tablet, capsule, oral liquid, granule, or injection.

[0017] Preferably, the drug is an injectable preparation.

[0018] The beneficial effects of this invention are:

[0019] 1. In the application of this invention, dapoxetine or drugs containing dapoxetine can improve lipid deposition in hepatocytes by targeting NLRP3-Caspase1 (NLRP3 inflammasome).

[0020] 2. In the application of this invention, dapoxetine or a drug containing dapoxetine can improve hepatocyte function by regulating mitochondrial oxidative stress in hepatocytes.

[0021] 3. In the application of this invention, dapoxetine or drugs containing dapoxetine can improve liver function by improving glucose metabolism and lipid metabolism.

[0022] 4. Current clinical trial results show that dapoxetine has good safety, high tolerability, and no obvious adverse reactions. Attached Figure Description

[0023] Figure 1 This is a schematic diagram illustrating the effect of dapanthion in improving glucose metabolism in the HFD+STZ mouse model (n=5 mice per group); (A) is the weight monitoring result, (B) is the blood glucose level, (C) is the insulin level, (D) is the result of the glucose tolerance test, (E) is the AUC value of the glucose tolerance test result, (F) is the result of the insulin tolerance test result, and (G) is the AUC value of the insulin tolerance test result.

[0024] Figure 2This is a schematic diagram illustrating the effect of dapanthenol on improving glucose metabolism in the db / db mouse model (n=5 mice per group); (A) is the weight monitoring result, (B) is the blood glucose level, (C) is the insulin level, (D) is the glucose tolerance test result, (E) is the AUC value of the glucose tolerance test result, (F) is the liver index (liver weight / body weight), (G) is the total cholesterol in the liver, (H) is the liver triglycerides, (I) is the serum AST, and (J) is the serum ALT.

[0025] Figure 3 This is a schematic diagram of the effect of dapanthenol on improving lipid metabolism in this invention; (A) is a liver morphology diagram, and (B) is a representative diagram of liver tissue H&E staining (top) and Oil Red O staining (bottom);

[0026] Figure 4 The diagram shows the effect of dapanthion in improving mitochondrial dynamics in this invention (n=3); (A) is a representative image of Oil Red O staining, (B) is the measurement of reactive oxygen species level in HepG2 cell mitochondria, (C) is the deep red color of HepG2 cell mitochondria, (D) is the JC-1 staining of HepG2 cell mitochondria, (E) is the oxygen consumption rate (OCR) analysis of HepG2 cells, and (F) is the oxygen consumption rate (OCR) analysis of HepG2 cells.

[0027] Figure 5 The following diagrams show the molecular experimental results of dapoxetine improving mitochondrial dynamics in this invention: (A) is a comparison diagram of the relative mRNA of Nlrp3 protein; (B) is a comparison diagram of the relative mRNA of Asc protein; (C) is a comparison diagram of the relative mRNA of Caspase-1 protein; (D) is a comparison diagram of the relative mRNA of Dsdmd protein; (E) is a diagram of Western blot results; (F) is a comparison diagram of IL-1β protein expression levels; and (G) is a comparison diagram of IL-18 protein expression levels. Detailed Implementation

[0028] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments.

[0029] This invention provides the use of dapoxetine in the preparation of a medicament for the treatment and / or prevention of metabolic-associated fatty liver disease. The potential mechanism of dapoxetine for the treatment and / or prevention of metabolic-associated fatty liver disease is as follows: dapoxetine targets the NLRP3 inflammasome, protecting mitochondrial homeostasis and reducing hepatocyte damage by targeting the NLRP3-Caspase1 signaling axis, thereby improving metabolic-associated fatty liver disease.

[0030] Specifically, this invention provides an application of dapoxetine to maintain mitochondrial homeostasis in unknown hepatocytes by targeting the NLRP3 inflammasome, thereby treating and / or preventing metabolic-related fatty liver disease. Maintaining mitochondrial homeostasis in hepatocytes specifically means that after using dapoxetine, the level of reactive oxygen species is significantly reduced and the downward trend of mitochondrial potential decreases in diseased cells.

[0031] Specifically, this invention provides an application of dapoxetine (Dapoxetine) in treating and / or preventing metabolic-related fatty liver disease by regulating lipid metabolism in hepatocytes. Regulating lipid metabolism in hepatocytes specifically refers to reducing lipid deposition in hepatocytes.

[0032] Specifically, the present invention provides an application of dapoxetine to treat and / or prevent metabolic-related fatty liver disease by reducing lipid deposition in the liver of mammals.

[0033] Specifically, this invention provides an application of dapoxetine (Dapoxetine) to treat and / or prevent metabolic-related fatty liver disease by improving glucose and lipid metabolism in mammals. The mammals are humans or mice. Improving glucose and lipid metabolism specifically refers to: lowering blood glucose, enhancing blood glucose regulation, improving insulin resistance, and reducing liver indices, serum triglycerides, and cholesterol.

[0034] Furthermore, the present invention also provides a medicament for treating and / or preventing metabolic-related fatty liver disease, wherein the active ingredient of the medicament comprises dapoxetine.

[0035] Furthermore, the drug also contains pharmaceutically acceptable excipients, carriers, and / or diluents.

[0036] Optionally, dapanthenil is the sole active ingredient of the drug.

[0037] Alternatively, the drug may be an oral tablet, capsule, oral liquid, granule or injection.

[0038] Preferably, the drug is an injectable form.

[0039] In this invention, the results of molecular, cellular, and animal experiments have successively confirmed that dapanthenol protects mitochondrial homeostasis and reduces hepatocyte damage by targeting the NLRP3-Caspase1 signaling axis, reduces mitochondrial oxidative stress and function, regulates hepatocyte lipid metabolism, and improves glucose and lipid metabolism in mammals. Therefore, dapanthenol can effectively treat and / or prevent metabolic-related fatty liver disease.

[0040] Specific embodiments of the present invention are as follows:

[0041] Example 1

[0042] This embodiment utilizes a mouse model of metabolic-associated fatty liver disease induced by a high-fat diet (HFD) + streptozotocin (STZ) and a db / db mouse model of metabolic-associated fatty liver disease to verify the effect of dapoxetine on improving glucose and lipid metabolism in mice.

[0043] 1. Construction and grouping of animal models

[0044] Male C57BL / 6 mice, db / db mice, and db / m mice (5 weeks old) were purchased from Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd. All animal procedures were performed in accordance with protocols approved by the Institutional Animal Care and Use Committee of Zhejiang University and in compliance with institutional guidelines for laboratory animal care (ethics approval number: ZJU20230454).

[0045] HFD+STZ mouse model: Mice were randomly divided into a control group (CTR, normal diet) and an HFD group (60% kcal% fat, D12492). After 30 days of feeding, HFD mice were administered 30 mg / kg STZ (freshly dissolved in 0.1 mol / L sodium citrate buffer, pH 4.2) intraperitoneally for one day, while the control group was given the same volume of physiological saline. Each group consisted of 5 mice. Mice were considered successfully modeled when their fasting blood glucose level was ≥11.1 mmol / L twice.

[0046] db / db mouse model: Fasting blood glucose levels in db / db mice were monitored weekly until 8 weeks of age. Each group consisted of 5 mice, and fasting blood glucose levels in the db / db mouse model were measured twice when they were ≥11.1 mmol / L.

[0047] Both mouse models were divided into two groups: the model group and the DAPA group. The DAPA group was injected intraperitoneally with dapoxetine at a dose of 200 mg / kg (dissolved in physiological saline) daily, while the model group was injected intraperitoneally with physiological saline daily.

[0048] After 8 weeks of treatment with dapoxetine in HFD+STZ mouse models and db / db mice, the mice were sacrificed and their tissues were harvested.

[0049] 2. Test methods

[0050] 2.1 Glucose Tolerance Test (GTT) and Insulin Tolerance Test (ITT)

[0051] Glucose tolerance test (GTT): Mice were fasted overnight (approximately 16 hours). Tail vein blood samples were collected at 0, 15, 30, 60, and 120 minutes after oral administration of 1 g / kg body weight of glucose. Blood glucose levels were measured 0 to 120 minutes after the glucose challenge using a glucometer (ACCU, Roche) to determine the area under the curve (AUC) of blood glucose over time.

[0052] Insulin tolerance test (ITT): Mice were fasted for 4 hours and then injected intraperitoneally with insulin saline solution (1 U / kg body weight). Blood glucose levels were measured by tail clipping at 0, 15, 30, 60, and 120 minutes after injection.

[0053] 2.2 Analysis of hematoxylin and eosin staining (H&E) and Oil Red O staining

[0054] Hematoxylin and eosin (H&E) staining: Liver tissue sections were fixed with 4% paraformaldehyde (w / v), embedded in paraffin, cut into 5 μm thick sections, and placed on glass slides. The sections were stained with hematoxylin and eosin (H&E) to evaluate liver histology.

[0055] Oil Red O staining analysis: Frozen liver tissue for Oil Red O (ORO) staining was embedded and cut into 5 μm thick sections, then stained using an Oil Red O kit (Nanjing Jiancheng Bioengineering Institute). Images were acquired under a microscope (Zeiss).

[0056] 2.3 Serum and Liver Biochemical Parameters

[0057] Serum alanine aminotransferase (ALT), aspartate aminotransferase (AST), liver triglycerides (TG), and total cholesterol (TC) levels were measured using a commercially available test kit (Nanjing Jiancheng Bioengineering Institute) according to the manufacturer's protocol.

[0058] 3. Test Results

[0059] 3.1. Dapanthion improves glucose and lipid metabolism in a mouse model of metabolism-related fatty liver disease.

[0060] A schematic diagram illustrating the effect of dapoxetine on improving glucose metabolism in an HFD+STZ mouse model is shown below. Figure 1 . Figure 1 In this study, data are expressed as mean ± SEM and analyzed using one-way or two-way ANOVA. *P<0.05, **P<0.01, ***P<0.001. Figure 1 In the table, CTR represents the control group mice on a normal diet, HFD+STZ represents the model group HFD+STZ mice that are injected with saline solution daily, and DAPA represents the DAPA group HFD+STZ mouse model that is injected with dapoxetine daily.

[0061] Depend on Figure 1 As shown in (A), there was no significant difference in body weight among the three groups of mice (P>0.05), indicating that dapoxetine had no effect on mouse body weight. Figure 1 As can be seen in (B), 8 weeks after injection of dapoxetine, compared with the model group ( Figure 1 Compared to HFD+STZ-induced diabetic mice, those injected with dapoxetine showed significantly lower fasting blood glucose levels (P<0.001). Figure 1 As shown in (C), injection of dapoxetine increased plasma insulin levels in the mouse model (P<0.05). Figure 1 (D) and Figure 1 As can be seen from (F), the results of the glucose tolerance test and insulin tolerance test show that the model group ( Figure 1 In patients with HFD+STZ, glucose tolerance and insulin sensitivity deteriorate. Figure 1 (E) and Figure 1 As shown in (G), after injection of dapanthenol, the DAPA group mice not only significantly improved glucose tolerance and insulin sensitivity (P<0.001), but also significantly reduced AUC (P<0.05).

[0062] A schematic diagram illustrating the effect of dapoxetine on improving glucose metabolism in the db / db mouse model is shown below. Figure 2 . Figure 2 In the mean squares, *P<0.05, **P<0.01, and ***P<0.001. Figure 2 In this context, CTR represents the control group mice on a normal diet, db / db represents the model group db / db mice that receive daily injections of saline, and DAPA represents the DAPA group db / db mouse model that receives daily injections of dapoxetine.

[0063] Depend on Figure 2 (A) Figure 2 As shown in (E), injection of dapoxetine improved glucose and lipid metabolism in the db / db mouse model of metabolic-related fatty liver disease. Figure 2 (F) Figure 2 As can be seen from (J), after injection of dapanthenol, the liver index and serum triglycerides and cholesterol in the DAPA group were significantly lower than those in the model group (P<0.05).

[0064] In summary, dapanthenol can effectively improve glucose and lipid metabolism in a mouse model of metabolism-related fatty liver disease.

[0065] 3.2. Dapanthion can reduce lipid deposition in the liver.

[0066] A schematic diagram illustrating the effects of dapoxetine on improving lipid metabolism and reducing lipid deposition in the liver is shown below. Figure 3. Figure 3 In this context, CTR represents the control group mice on a normal diet, db / db represents the model group db / db mice that receive daily injections of saline, and DAPA represents the DAPA group db / db mouse model that receives daily injections of dapoxetine.

[0067] Depend on Figure 3 (A) and Figure 3 As shown in (B), ectopic lipid deposition was observed in hepatocyte sections of db / db mice in the model group, while this phenomenon was significantly improved in the DAPA group, with reduced lipid deposition in the liver.

[0068] Therefore, dapanthenol can reduce lipid deposition in the liver.

[0069] Example 2

[0070] This embodiment uses HepG2 cells as an example to support the effect of dapoxetine in regulating lipid metabolism in hepatocytes.

[0071] 1. Cell Culture

[0072] Cell culture: HepG2 is a human hepatocellular carcinoma cell line obtained from ATCC, cultured in DMEM medium (Invitrogen, Carlsbad, CA) supplemented with 10% fetal bovine serum (FBS) and 1×GlutaMax (Invitrogen). Cells were grown at a rate of 4 × 10⁶ cells per well. 5 Cells were seeded at a density of 1,000 cells per well in 6-well plates. After seeding, cells were treated alone with 0.5 mol / L free fatty acids (FFA), or with a combination of 0.5 mol / L FFA and 10 μmol / L dapoxetine for 24 hours.

[0073] Cell grouping: CTR group: PBS (control group); FFA group: 0.5 mol / L FFA stock solution; DAPA group: 0.5 mol / L FFA stock solution + 10 μmol / L dapanthion.

[0074] HepG2 cells were divided into a normal control group ( Figure 4 CTR in the model group Figure 4 FFA and DAPA groups (in the middle) Figure 4 The sample size for each group was 3. The normal control group was incubated with PBS buffer for 24 hours, the model group was incubated with 0.5 mmol / L free fatty acids (FFA) for 24 hours, and the DAPA group was incubated with 0.5 mmol / L free fatty acids (FFA) and 10 μmol / L dapanthion for 24 hours.

[0075] Preparation of FFA mother liquor:

[0076] a. Palmitic acid (PA): Dissolve 21.18 mg of palmitic acid in 0.4 mL of anhydrous ethanol; mix 0.4 mL of the above solution with 5 mL of 10% bovine serum albumin (BSA) solution to achieve a final concentration of palmitic acid of 15 mol / L.

[0077] b. Oleic acid (OA): Dissolve 50 mg of oleic acid in 0.8 mL of 0.1 mol / L NaOH solution; mix 0.8 mL of the above solution with 10 mL of 10% bovine serum albumin solution to achieve a final concentration of 15 mol / L for oleic acid.

[0078] c. FFA Mother Liquor: Using the PA solution obtained in step a and the OA solution obtained in step b, prepare an FFA mixed mother liquor with a molar ratio of OA:PA = 2:1.

[0079] 2. Test methods

[0080] Oil Red O staining: HepG2 cells were treated with either 0.5 mol / L FFA stock solution or 0.5 mol / L FFA and 10 μmol / L dapoxetine for 24 hours, followed by washing three times with PBS, fixing with 4% formaldehyde for 20 minutes, washing three times with PBS, staining with Oil Red O (Nanjing Institute of Biotechnology) for 15 minutes, counterstaining the nuclei for 1 minute, and washing three times with PBS. Cells were observed and photographed under an electron microscope.

[0081] 3. Results of Dapanthionine regulating lipid deposition in hepatocytes

[0082] Figure 4 This is a schematic diagram illustrating the effect of dapoxetine on improving mitochondrial dynamics in this invention (n=3). Figure 4 In this study, data are expressed as mean ± SEM. Data were analyzed using one-way ANOVA. *P<0.05, **P<0.01, ***P<0.001. Figure 4 In the table, CTR represents HepG2 cells in the normal control group, FFA represents HepG2 cells in the FFA group after incubation with free fatty acids, and DAPA represents HepG2 cells in the DAPA group after incubation with free fatty acids and dapoxetine.

[0083] Figure 4 (A) shows the Oil Red O staining results of HepG2 cells. It can be seen that, compared with normal cells (CTR group), incubation of cells with 0.5 mmol / L free fatty acids (FFA group) effectively induced ectopic lipid deposition in HepG2 cells, while incubation of cells with free fatty acids + dapanthionine effectively reduced ectopic lipid deposition in HepG2 cells (DAPA group).

[0084] This indicates that dapanthenol can significantly regulate lipid deposition in hepatocytes.

[0085] Example 3

[0086] This embodiment verifies that dapoxetine intervention can reduce mitochondrial oxidative stress and function.

[0087] 1. Cell culture: Same as in Example 2

[0088] 2. Test methods

[0089] 2.1 Detection using MitoTracker, ROS, and MMP

[0090] HepG2 cells were treated with either 0.5 mol / L FFA stock solution or 0.5 mol / L FFA and 10 μmol / L dapoxetine for 24 hours. They were then cultured for 30 minutes in a humidified incubator at 37°C, 5% CO2, and 50 nmol / L Mito Tracker Deepred (Beyotime Biotechnology Research Institute) solution. Hoechst staining was subsequently used to stain the cell nuclei. After three washes with PBS, cell morphology was observed using a Zeiss microscope at 640 nm excitation.

[0091] Cellular ROS levels were assessed using a assay kit provided by Beyotime Biotechnology Research Institute, according to the supplier's protocol. HepG2 cells were treated with diacetyl dichlorofluorescein (DCFH-DA) at 37°C in the dark for 30 minutes. After three washes with PBS, cell fluorescence intensity was detected using a fluorescence microscope (Zeiss) at 488 nm excitation, as per the supplier's instructions.

[0092] MMPs were detected using the JC-1 detection kit (Beyotime Biotechnology Research Institute). JC-1 was incubated with HepG2 cells at 37°C for 20 minutes. Accumulation of JC-1 was detected using fluorescence microscopy under excitation at 488 nm and 561 nm.

[0093] 2. Mitochondrial Respiration Analysis

[0094] Mitochondrial respiration was measured using the Seahorse XF96 analyzer (Agilent Seahorse Bioscience) and related consumables (plates, kits, and inhibitor kits) according to the manufacturer's instructions. In short, the assay medium was prepared by supplementing Seahorse XF-Base medium (pH=7.4) with a specific combination of 10 mol / L glucose (100X stock, Agilent), 1 mol / L pyruvate (100X stock, Agilent), and 2 mol / L L-glutamine (Sigma). First, cells were harvested and seeded into 80 μL of medium in a Seahorse 96-well XF cell culture microplate (20,000 cells / well). Cells were incubated for 24 hours in a pre-sterilized incubator at 37°C in a constant humidity environment containing 10% CO2 and 95%. Prior to running the XF assay, the Seahorse XF sensor cartridge was hydrated for 24 hours by filling each well of the XF utility plate with 200 μL of sterile water. On the day of the test, Seahorse XF calibration solution was used instead of sterile water. The hydration kit was incubated at 37°C for 24 hours without carbon dioxide to remove potentially interfering carbon dioxide from the culture medium by adjusting the pH. Mitochondrial respiration was measured using pre-prepared and optimized Seahorse-specific Mito stress test kits (all from Agilent). Subsequently, the concentrations of oligomycin, carbonyl cyanide 4-(trifluoromethoxy)phenylhydrazone (FCCP), and rotenone / antimycin were 1.0, 3.0, and 1.0 μmol / L, respectively. Seahorse controller software version 2.6.3 (Agilent Seahorse Bioscience) was used to operate and control the Seahorse XF96 analyzer. After the measurements were completed, the data were exported for processing and analysis.

[0095] 3. Test Results

[0096] Mito Tracker staining and fluorescence analysis were performed on each group of HepG2 cells in Example 2. The results are shown in [Figure 1]. Figure 4 (B) It can be seen that, compared with cells treated with FFA, cells in the DAPA group treated with dapanthenil maintained a uniform distribution of mitochondria, showing aggregation and fragmentation. This further confirms that dapanthenil can restore the dynamic balance between mitochondrial fusion and fragmentation.

[0097] Reactive oxygen species (ROS) staining and fluorescence analysis were performed on each group of HepG2 cells in Example 2. The results are shown in [Figure 1]. Figure 4 (C). It is evident that the reactive oxygen species (ROS) levels in the DAPA group treated with dapanthenil were significantly reduced compared to cells treated with FFA. This further confirms that dapanthenil can significantly reduce mitochondrial ROS levels, thereby protecting mitochondrial function.

[0098] Mitochondrial JC-1 staining and fluorescence analysis were performed on each group of HepG2 cells in Example 2. The results are shown in [Figure 1]. Figure 4 (D). It is evident that, compared to cells treated with FFA, cells in the DAPA group treated with dapanthenol showed a slower decline in mitochondrial membrane potential (MMP), indicating an improvement in mitochondrial membrane potential. This further confirms that dapanthenol protects mitochondrial function by slowing the decline in mitochondrial membrane potential.

[0099] Therefore, the results of this embodiment indicate that dapanthenol corrects the imbalance between mitochondrial fusion and division, while reducing the production of reactive oxygen species (ROS) in hepatocytes and slowing the decline in mitochondrial membrane potential (MMP), thus improving liver function.

[0100] The HepG2 cells in Example 2 were analyzed using a hippocampal energy metabolism analyzer. The results are shown below. Figure 4 (E) and Figure 4 (F). It can be seen that free fatty acid treatment inhibited basal and maximal respiration in HepG2 cells, and this phenomenon was improved after intervention with dapoxetine (P<0.05).

[0101] In summary, the results of this embodiment further demonstrate that dapanthenol intervention can reduce mitochondrial oxidative stress and improve mitochondrial function.

[0102] Example 4

[0103] This embodiment uses Western blot analysis to verify the molecular mechanism by which dapanthenol protects mitochondrial homeostasis and reduces hepatocyte damage through the NLRP3-Caspase1 signaling axis.

[0104] 1. Cell culture: Same as in Example 2

[0105] 2. Test methods

[0106] 2.1 Real-time quantitative PCR (qRT-PCR)

[0107] After treatment with 0.5 mol / L FFA stock solution and 10 μmol / L dapoxetine for 24 hours, RNA was isolated from cells using AG RNAex Pro reagent (Aikerui Biotechnology). RNA concentration was determined using a Nanodrop 2000C spectrophotometer. OD 260 / OD 280Samples with a ratio between 1.8 and 2.0 were used for experiments. RNA was reverse transcribed into cDNA using the Evo M-MLV RT Premix kit (Aikerui Biotechnology) following the supplier's guidelines. The cDNA was used as templates for quantitative real-time PCR using the LightCycler 480II system (Roche) and the SYBR Green Premix Pro Taq HS qPCR kit (Aikerui Biotechnology). Each sample was analyzed twice. Melting curves were generated during amplification to verify the presence of primer dimers or mispaired products. After correction, the comparison cycle threshold (…) was used… 2-△△ The relative mRNA expression level of the target gene was calculated using the CT method.

[0108]

[0109] 2.2 Protein Blotting

[0110] Cells were lysed after treatment with either 0.5 mol / L FFA stock solution or a mixture of 0.5 mol / L FFA and 10 μmol / L dapoxetine for 24 hours, followed by lysis buffer containing a mixture of protease inhibitors. Protein concentrations were estimated using a BCA protein assay kit (#P0012S, Beyotime) and adjusted to 4 μg / μL. Samples with the same protein concentration were boiled at 100°C for 8 minutes, and then 15 μL of each sample was loaded onto a 10% sodium dodecyl sulfate acrylamide gel. Protein molecules were separated at a constant voltage of 120 V and then transferred to a nylon membrane. After blocking with 5% skim milk, the membrane was incubated overnight at 4°C with primary antibodies against NLRP3 (1:1000, Abcam), ASC (1:1000, Abcam), Caspase-1 (1:11000, Abcam), P20 (1:1000, Cell Signaling Technology), GSDMD (Abcam), and β-actin (1:500, Abcam). The membrane was washed three times for 5 minutes with Tris-buffered saline containing 0.1% Tween-20 and incubated for 1 hour at room temperature with peroxidase-conjugated goat anti-rabbit or mouse IgG. After washing, the membrane was reacted with enhanced chemiluminescence solution (FdBio, Science) and imaged. Protein bands were quantified using ImageJ 2.0 software. The ratio of the target protein band intensity to the β-actin band intensity was calculated.

[0111] 2.3 Enzyme-linked immunosorbent assay (ELISA)

[0112] Cell cultures were treated with either 0.5 mol / L FFA stock solution or a mixture of 0.5 mol / L FFA and 10 μmol / L dapoxetine for 24 hours. The supernatant was collected, and IL-1β- and IL-18 concentrations were determined according to the manufacturer's (R&D, eBioscience) instructions. All samples were analyzed twice. A standard curve was generated during the assay by plotting the absorbance values ​​against the concentration gradient of standards provided in the kit. Positive and blank controls were analyzed simultaneously on the same plate.

[0113] 3. Test Results

[0114] In this embodiment, Western blot analysis was performed on each group of HepG2 cells from Example 2. The results are shown below. Figure 5 (A) Figure 5 (G). It can be seen that, compared with the FFA group, the expression levels of NLRP3, ASC, Caspase-1 and GSDMD mRNA and protein in the DAPA group were significantly reduced (P<0.0001). In addition, compared with the FFA group, the cell culture supernatant of the DAPA group had reduced IL-1β and IL-18.

[0115] Therefore, it can be seen that dapanthenol improves liver inflammation, oxidative stress and liver function by specifically targeting the NLRP3-Caspase-1 signaling axis.

[0116] In summary, the active ingredient of the drug can target NLRP3 and thereby regulate mitochondrial homeostasis in hepatocytes, thus improving hepatocyte function. After injecting dapoxetine into animal models, the hepatocyte function of the animal models was significantly improved. It can be seen that dapoxetine has significant pharmacological effects in the treatment or prevention of metabolic-related fatty liver disease.

[0117] The above specific embodiments are used to explain and illustrate the present invention, but not to limit the present invention. Any modifications and changes made to the present invention within the spirit and scope of the claims shall fall within the protection scope of the present invention.

[0118] The nucleotide sequence involved in this invention is as follows:

[0119] SEQ ID NO.1:

[0120] Name: F primer sequence for β-actin protein; Sequence type: DNA (other DNA)

[0121] Biological origin: synthetic construct

[0122] CGTAAAGACCTCTATGCCAACASEQ ID NO.2:

[0123] Name: R primer sequence for β-actin protein; Sequence type: DNA (other DNA)

[0124] Biological origin: synthetic construct

[0125] AGCCACCAATCCACACAGAG

[0126] SEQ ID NO.3:

[0127] Name: F primer sequence for Nlrp3 protein

[0128] Sequence type: DNA (other DNA)

[0129] Biological origin: synthetic construct

[0130] TCAGGATCTCGCATTGGTTCT

[0131] SEQ ID NO.4:

[0132] Name: R primer sequence for Nlrp3 protein; Sequence type: DNA (other DNA)

[0133] Biological origin: synthetic construct

[0134] GAGCAGCACAGTGAAGTAAGGSEQ ID NO.5:

[0135] Name: F primer sequence for Asc protein; Sequence type: DNA (other DNA)

[0136] Biological origin: synthetic construct

[0137] CCAACACAGGCAAGCACTC

[0138] SEQ ID NO.6:

[0139] Name: R primer sequence for Asc protein

[0140] Sequence type: DNA (other DNA)

[0141] Biological origin: synthetic construct

[0142] TGTCCTTCAGTCAGCACATTG

[0143] SEQ ID NO.7:

[0144] Name: F primer sequence for Caspase-1 protein; Sequence type: DNA (other DNA); Organism origin: synthetic construct; SEQ ID NO. 8: CTGGTCTTGTGACTTGGAGGA

[0145] Name: R primer sequence for Caspase-1 protein; Sequence type: DNA (other DNA); Organism origin: synthetic construct; SEQ ID NO. 9:

[0146] Name: F primer sequence of GSDMD protein; Sequence type: DNA (other DNA); Organism origin: synthetic construct; SEQ ID NO.10: CAACTTCCAAGTCTCCGATGTC

[0147] Name: R primer sequence of GSDMD protein. Sequence type: DNA (other DNA). Organism source: synthetic construct GAGTCACACGCAGCATACAC.

Claims

1. An application of dapoxetine, characterized in that: This drug is used to prepare a treatment and / or prevent metabolic-related fatty liver disease; the dapanthenol targets the NLRP3-Caspase1 signaling axis, maintains mitochondrial homeostasis and reduces hepatocyte damage, reduces mitochondrial oxidative stress and improves mitochondrial function, regulates abnormal lipid metabolism in hepatocytes and improves abnormal glucose and lipid metabolism in mammals.

2. The application according to claim 1, characterized in that: The dapanthion targets and regulates the expression and activity of the NLRP3-Caspase1 signaling axis in hepatocytes, specifically regulating downstream activation. Maintaining mitochondrial homeostasis involves reducing the level of reactive oxygen species in hepatocytes and slowing the decline in mitochondrial membrane potential.

3. The application according to claim 2, characterized in that: The mammals referred to are mice or db / db mouse models of metabolic-associated fatty liver disease induced by a high-fat diet combined with streptozotocin.

Images