An extra-circular DNA and its application in high metastatic triple-negative breast cancer

Abstract

The application belongs to the technical field of disease diagnosis and treatment, and particularly relates to an exocyclic DNA and application thereof in high-metastatic triple-negative breast cancer. circle The nucleotide sequence of the exocyclic DNA (GALNT3) provided in the application is shown as SEQ ID NO:1, is significantly up-regulated in high-metastatic triple-negative breast cancer cells, can be used as a diagnostic marker of high-metastatic triple-negative breast cancer, can distinguish high-metastatic triple-negative breast cancer from low-metastatic triple-negative breast cancer, has high specificity and sensitivity, can reduce the expression of the GALNT3 gene by destroying the exocyclic DNA, can inhibit the metastasis of high-metastatic triple-negative breast cancer, and can promote the metastasis of high-metastatic triple-negative breast cancer by overexpressing GALNT3 on the basis of destroying the exocyclic DNA, thereby providing a new target for the treatment of high-metastatic triple-negative breast cancer.

Description

Technical Field

[0001] This invention belongs to the field of disease diagnosis and treatment technology, specifically relating to an outer circular DNA and its application in highly metastatic triple-negative breast cancer. Background Technology

[0002] Triple-negative breast cancer (TNBC) is a particularly aggressive type of breast cancer, accounting for approximately 10–15% of all breast cancer cases. Its main characteristics include the lack of expression of estrogen receptor (ER), progesterone receptor (PR), and epidermal growth factor receptor 2 (HER2), along with poor differentiation and a high recurrence rate. Compared to hormone receptor-positive or HER2-positive breast cancer, TNBC has limited response to targeted therapy and immunotherapy, with a median survival of only 13 months. Therefore, innovative research methods are urgently needed to explore the underlying mechanisms of TNBC progression and develop more effective diagnostic and treatment strategies.

[0003] Circular extracellular DNA (eccDNAs) are circular DNA molecules derived from chromosomes, ranging in number from hundreds to thousands of base pairs. Once formed, they can function independently of chromosomal DNA. eccDNAs can carry complete genetic information, particularly oncogenes with high copy numbers and transcriptional levels. Upregulation of oncogenes via eccDNAs contributes to tumor growth. Pan-cancer analysis of ATAC sequencing libraries from 23 tumor types has identified over 18,000 eccDNAs, many carrying known oncogene drivers. Furthermore, studies have reported the presence of abundant eccDNAs in prostate cancer, which act as mobile transcription enhancers, promoting tumor progression. eccDNAs have also been widely found in 29 different types of cancer.

[0004] Although the relationship between eccDNAs and tumor progression has been studied to some extent, further research is needed on the relationship between eccDNAs and their clinical significance in breast cancer patients, especially those with highly metastatic triple-negative breast cancer. The predictive sensitivity and accuracy of eccDNAs markers associated with metastasis in highly metastatic triple-negative breast cancer need further improvement. Screening for suitable eccDNAs abnormally expressed in highly metastatic triple-negative breast cancer as prognostic and diagnostic molecular markers, and using them as diagnostic targets for highly metastatic triple-negative breast cancer, is an important direction in triple-negative breast cancer research. Summary of the Invention

[0005] The purpose of this invention is to provide an outer circular DNA and its application in highly metastatic triple-negative breast cancer, enabling the monitoring of the progression and prognosis of highly metastatic triple-negative breast cancer, distinguishing between highly metastatic triple-negative breast cancer and low-metastatic triple-negative breast cancer, specifically detecting highly metastatic triple-negative breast cancer, providing a new therapeutic target for highly metastatic triple-negative breast cancer, and effectively treating highly metastatic triple-negative breast cancer.

[0006] This invention provides an outer circular DNA, the name of which is GALNT3. circle The nucleotide sequence is shown in SEQ ID NO:1.

[0007] This invention also provides the application of the outer circular DNA described in the above technical solution in the preparation of products that regulate the expression level of the GALNT3 gene.

[0008] This invention also provides the application of substances for detecting the expression levels of the outer circular DNA or GALNT3 gene described in the above-mentioned technical solutions in the preparation of products for monitoring the progression and / or predicting the prognosis of highly metastatic triple-negative breast cancer.

[0009] Preferably, the expression level of the outer circular DNA or GALNT3 gene increases with the progression of highly metastatic triple-negative breast cancer stages;

[0010] The prognostic assessment includes one or more of the following: the clinical outcome of the prognostic subject, the treatment effect of the prognostic subject, and the survival of the prognostic subject.

[0011] This invention also provides the application of substances for detecting the expression levels of the outer circular DNA or GALNT3 gene described in the above-mentioned technical solutions in the preparation of products for diagnosing highly metastatic triple-negative breast cancer.

[0012] Preferably, the outer circular DNA or GALNT3 gene is significantly upregulated in patients with highly metastatic triple-negative breast cancer.

[0013] The present invention also provides the application of the substance for detecting the expression level of the outer circular DNA or GALNT3 gene described in the above technical solution in the preparation of products that distinguish between highly metastatic triple-negative breast cancer and low-metastatic triple-negative breast cancer.

[0014] This invention also provides the application of substances that inhibit the expression of the outer circular DNA or GALNT3 gene described in the above-mentioned technical solutions in the preparation of products for treating highly metastatic triple-negative breast cancer.

[0015] The present invention also provides shRNAs that inhibit the expression of the outer circular DNA or GALNT3 gene described in the above technical solutions, wherein the shRNAs include shLig3-1 and / or shLig3-2;

[0016] The target sequence of shLig3-1 is shown in SEQ ID NO:2;

[0017] The target sequence of shLig3-2 is shown in SEQ ID NO:3.

[0018] This invention also provides the application of the shRNA described in the above technical solution in the preparation of products for treating highly metastatic triple-negative breast cancer.

[0019] Beneficial effects:

[0020] This invention, through analysis of highly metastatic triple-negative breast cancer cells and low-metastatic triple-negative breast cancer cells, discovered a differentially expressed outer circular DNA (GALNT3). circle Compared to low-metastatic triple-negative breast cancer cells, the expression of this outer circular DNA is significantly upregulated in high-metastatic triple-negative breast cancer cells, and its nucleotide sequence is shown in SEQ ID NO:1. The outer circular DNA provided by this invention can serve as a diagnostic marker for high-metastatic triple-negative breast cancer, accurately distinguishing between high-metastatic and low-metastatic triple-negative breast cancer with high specificity and sensitivity. Furthermore, it provides a new therapeutic target for high-metastatic triple-negative breast cancer. The results of the embodiments show that by regulating the expression of the outer circular DNA, the expression of the GALNT3 gene can be regulated. Knocking down the outer circular DNA can reduce the GALNT3 gene expression level and inhibit the metastasis of high-metastatic triple-negative breast cancer, while overexpressing the outer circular DNA can increase the GALNT3 gene expression level and promote the metastasis of high-metastatic triple-negative breast cancer. Attached Figure Description

[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0022] Figure 1 The results of transwell assays for 231 and 231-H cells;

[0023] Figure 2 Results of tail vein lung metastasis of 231 and 231-H cells;

[0024] Figure 3 The image shows the results of eccDNA detection in 231-H cells;

[0025] Figure 4 This is a graph showing the transcriptome sequencing results of 231-H cells;

[0026] Figure 5 The intersection of 231-H cell eccDNA detection and transcriptome sequencing;

[0027] Figure 6 GALNT3 for 231-H cells circle Sanger sequencing and gel mapping results;

[0028] Figure 7 The expression levels of GALNT3 gene mRNA and the results of Western Blot analysis were obtained in 468, 231 and 231-H cells.

[0029] Figure 8 Results of fluorescence in situ hybridization detection for 231 and 231-H cells;

[0030] Figure 9 Knock down GALNT3 in 231-H cells circle Post-cell fluorescence in situ hybridization results;

[0031] Figure 10 Knock down GALNT3 in 231-H cells circle The expression level of GALNT3 gene mRNA and the results of Western Blot analysis;

[0032] Figure 11 Example 4 shows the expression level of GALNT3 gene mRNA in different cells and the results of Western Blot detection.

[0033] Figure 12 The results of transwell assays for different cells in Example 4;

[0034] Figure 13 The results of tail vein lung metastasis for different cells in Example 4;

[0035] Figure 14 GALNT3 in highly metastatic triple-negative breast cancer of different malignant grades circle The results of in situ fluorescence hybridization (A) and scoring (B) of the cells;

[0036] Figure 15 For GALNT3 circle ROC curves used for the diagnosis of highly metastatic triple-negative breast cancer;

[0037] Figure 16 The expression level of GALNT3 gene mRNA and the results of Western Blot analysis in EMT6 and 4T1 cells;

[0038] Figure 17 The results of transwell assays of EMT6 and 4T1 cells in mice;

[0039] Figure 18 Knock down GALNT3 in 4T1 cells circle After GALNT3circle The expression level of GALNT3 gene mRNA and the results of Western Blot analysis;

[0040] Figure 19 Knock down GALNT3 in 4T1 cells circle The results were then obtained from transwell assays in mice.

[0041] in, Figures 1-19 * indicates P < 0.05; *** indicates P < 0.001; **** indicates P < 0.0001. Detailed Implementation

[0042] This invention provides an outer circular DNA, the name of which is GALNT3. circle The nucleotide sequence is shown in SEQ ID NO:1.

[0043] This invention, through analysis of highly metastatic triple-negative breast cancer cells and low-metastatic triple-negative breast cancer cells, found that the aforementioned outer circular DNA was differentially expressed in both types of cells. In highly metastatic triple-negative breast cancer cells, its expression was upregulated. Furthermore, the outer circular DNA regulates the expression of the GALNT3 gene; knocking down the outer circular DNA reduces GALNT3 gene expression levels, while overexpression increases them. Therefore, the application of the outer circular DNA in the preparation of products regulating GALNT3 gene expression levels also falls within the scope of this invention. The GALNT3 gene described in this invention has the NCBI accession number NM_004482.4.

[0044] This invention also provides the application of substances for detecting the expression levels of the outer circular DNA or GALNT3 gene described in the above-mentioned technical solutions in the preparation of products for monitoring the progression and / or predicting the prognosis of highly metastatic triple-negative breast cancer. In one embodiment, the expression level of the outer circular DNA or GALNT3 gene shows an increasing trend with the progression of highly metastatic triple-negative breast cancer stages. In one embodiment, the prognostic assessment includes one or more of the following: the clinical outcome of the prognostic subject, the treatment effect of the prognostic subject, and the survival of the prognostic subject; in another embodiment, the prognostic assessment includes the clinical outcome of the prognostic subject, the treatment effect of the prognostic subject, and the survival of the prognostic subject.

[0045] This invention also provides the application of substances used to detect the expression levels of the outer circular DNA or GALNT3 gene described in the above-described technical solutions in the preparation of products for diagnosing highly metastatic triple-negative breast cancer. As one embodiment, the outer circular DNA or GALNT3 gene is significantly upregulated in patients with highly metastatic triple-negative breast cancer.

[0046] The present invention also provides the application of the substance for detecting the expression level of the outer circular DNA or GALNT3 gene described in the above technical solution in the preparation of products that distinguish between highly metastatic triple-negative breast cancer and low-metastatic triple-negative breast cancer.

[0047] This invention also provides the application of substances that inhibit the expression of the outer circular DNA or GALNT3 gene described in the above-mentioned technical solutions in the preparation of products for treating highly metastatic triple-negative breast cancer.

[0048] In one implementation, the product includes diagnostic reagents, reagent kits, chips, test strips, or well plates.

[0049] In this invention, as one embodiment, the substance that inhibits the expression of the outer circular DNA or GALNT3 gene includes shRNA; the shRNA includes shLig3-1 and / or shLig3-2, the target sequence of shLig3-1 is shown in SEQ ID NO:2, and the target sequence of shLig3-2 is shown in SEQ ID NO:3.

[0050] The present invention also provides shRNAs that inhibit the expression of the outer circular DNA or GALNT3 gene described in the above technical solutions, wherein the shRNAs include shLig3-1 and / or shLig3-2; the target sequence of shLig3-1 is shown in SEQ ID NO:2; and the target sequence of shLig3-2 is shown in SEQ ID NO:3.

[0051] This invention utilizes the ability of the shRNA to knock down the expression of outer circular DNA, thereby reducing the expression level of the GALNT3 gene and treating highly metastatic triple-negative breast cancer. Therefore, the application of the shRNA in the preparation of products for treating highly metastatic triple-negative breast cancer also falls within the scope of protection of this invention.

[0052] To further illustrate the present invention, the following description, in conjunction with the accompanying drawings and embodiments, describes an outer ring-shaped GALNT3 provided by the present invention. circle The invention describes in detail its application in triple-negative breast cancer, but this should not be construed as limiting the scope of protection of the invention.

[0053] Example 1

[0054] 1. Highly metastatic triple-negative breast cancer cells were prepared according to existing technology (Wu R, Li K, Yuan M, et al. Nerve growth factor receptor increases the tumor growth and metastatic potential of triple-negative breast cancer cells[J]. Oncogene, 2021, 40(12): 2165-2181.), and were designated as 231-H.

[0055] 2. Following the standard transwell assay procedure (Wu R, Li K, Yuan M, et al. Nerve growth factor receptor increases the tumor growth and metastatic potential of triple-negative breast cancer cells[J]. Oncogene, 2021, 40(12): 2165-2181), transwell migration experiments were performed on low-metastatic triple-negative breast cancer cells (MDA-MB-231, 231) and high-metastatic triple-negative breast cancer cells obtained in step 1 (231-H), respectively. Images were taken under a fluorescence microscope, and cell counting was performed using ImageJ. The results showed that 231-H had a stronger migration ability than 231. Figure 1 ).

[0056] 3. Following standard experimental procedures (Wu R, Li K, Yuan M, et al. Nerve growth factor receptor increases the tumor growth and metastatic potential of triple-negative breast cancer cells[J]. Oncogene, 2021, 40(12): 2165-2181.), tail vein lung metastasis experiments were performed on low-metastatic triple-negative breast cancer cells (MDA-MB-231, 231) and high-metastatic triple-negative breast cancer cells obtained in step 1 (231-H). After 28 days, images were taken under a fluorescence microscope to observe the metastasis formation in the lungs and calculate the fluorescence area. The results showed that 231-H had a stronger metastatic ability than 231. Figure 2 ).

[0057] 4. Referring to (Cen Y, Fang Y, et al. Global characterization of extrachromosomal circular DNAs in advanced high-grade serous ovarian cancer[J]. Cell death and disease, 2022, 13:342), eccDNA and transcriptome analyses were performed on low-metastatic triple-negative breast cancer cells (MDA-MB-231, 231) and high-metastatic triple-negative breast cancer cells (231-H) obtained in step 1, respectively. The intersection of eccDNA and transcriptome sequencing was taken, and the results are as follows: Figures 3-5 As shown.

[0058] according to Figures 3-5 It can be seen that, compared with 231 cells, 231-H cells have upregulated eccDNA expression.

[0059] 5. Referring to existing technology (Cen Y, Fang Y, et al. Global characterization of extrachromosomal circular DNAs in advanced high-grade serous ovarian cancer[J]. Cell Death and Disease, 2022, 13:342), the eccDNA of highly metastatic triple-negative breast cancer cells (231-H) from step 4 was amplified inward and outward, and the amplified products were subjected to agarose gel electrophoresis. The results are as follows. Figure 6 As shown; bands 1, 2, 3, and 4 represent enriched eccDNA, genomic DNA, a template-free control, and eccDNA after rolling circle amplification, respectively. The target band was excised from the agarose gel and recovered via gel extraction. The purified DNA was then eluted and sequenced using Sanger sequencing. The results showed that gene chr2:165775969-165777061 had a cleavage site AGCC after Sanger sequencing, and the sequence largely matched expectations, indicating it was the target circular fragment. The accurate location coordinates were verified to be chr2:165775969-165777062. The PCR product (i.e., the head-to-tail ligation of the target circular DNA fragment and the trans-cleavage site) sequence is as follows: GGTACCCGTCTTTCTAGACCCCACTAAATGCTACTAAAGAAATTTAAAA GAGGAATAAATTCATGAGGGAGAGGATAGTGGGAGAAGAGATATCCGAGA AG A CCATATGATAAAATTATTTATATACACATTTAAAAATACAAAGGTAAGCTAAAAGCTGGAAGATGACATTGGTCATGCATACACAGTTGTCCCTTGGTATGTGGGAGGGATTGGTTCCAGGACCCTCCATTGGATATCAAAACCATGGATGCAAAAAA (SEQ ID NO:1); where the underlined bases indicate the linking sites. Figure 6 ).

[0060] 6. Following existing techniques (Wu R, Li K, Yuan M, et al. Nerve growth factor recept or increase the tumor growth and metastatic potential of triple-negative breast cancer cells[J]. Oncogene, 2021, 40(12): 2165-2181.), low-metastatic triple-negative breast cancer cells (MDA-MB-468, 468), low-metastatic triple-negative breast cancer cells (MDA-MB-231, 231), and high-metastatic triple-negative breast cancer cells obtained in step 1 (231-H) were cultured. After 24 h of culture, the expression level of GALNT3 gene mRNA in the three types of triple-negative breast cancer cells was detected, and Western blot analysis was performed. The results showed that there was no significant difference in the expression level of GALNT3 gene mRNA between 468 and 231. Compared with 468 and 231, the expression levels of GALNT3 gene mRNA and protein in 231-H were significantly increased. Figure 7 ).

[0061] 7. Following the instructions of the FISH in situ hybridization kit, low-metastatic triple-negative breast cancer cells (MDA-MB-231, 231) and high-metastatic triple-negative breast cancer cells obtained in step 1 (231-H) were cultured. After 24 hours of culture, fluorescence in situ hybridization (FISH) was performed. The results showed that the outer ring-shaped GAL NT3 circle Upregulated expression in highly metastatic triple-negative breast cancer cells 231-H ( Figure 8 ).

[0062] Example 2

[0063] Interference or overexpression of viral packages

[0064] 1. Interfering with virus packets

[0065] (1) Referring to the target sequences of shLig3-1 and shLig3-2 in the existing technology (Jin W, Xu Z, Song Y and Chen F. Extrachromosomalcircular DNA promotes prostate cancer progression through the FAM848 / CDK N1B / MYC / WWP1 axis. Cellular & Molecular Biology Letters. 2024. 29: 103.), Wuhan Chuling Biotechnology Co., Ltd. was commissioned to design interference plasmids based on the target sequences. Among them, the nucleotide sequence of shLig3-1 targeting the GALNT3 gene is 5'-CCGGATCATGTTCTCAGAAAT-3' (SEQ ID NO: 2); the nucleotide sequence of shLig3-2 targeting the GALNT3 gene is 5'-GCCCACTTTAAGGACTACATT-3' (SEQ ID NO: 3); and the nucleotide sequence of the blank control shCtrl is 5'-CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG-3' (SEQ ID NO: 3). ID NO:4).

[0066] (2) Lentiviral packaging plasmids pMD2.G, pMDLg, pRSV and the interference plasmid obtained in step (1) were mixed in serum-free DMEM at a mass ratio of 1.5:2.5:1:4 to obtain plasmids for transfection.

[0067] (3) Culture 293T cells in 10cm culture dishes until they reach 70-80% confluency. Use Lipofectamine 3000 transfection reagent to transfect the 293T cells with the transfection plasmid used in step (2) according to the instructions. Continue culturing at 37℃ and 5% CO2 for 48-72 hours. Collect the culture supernatant to obtain the interfering virus solution.

[0068] 2. Overexpression of viral coating

[0069] (1) Wuhan Chuling Biotechnology Co., Ltd. was commissioned to obtain an overexpression plasmid from the gene sequence encoding GALNT3; the transcript ID of human GALNT3 in NCBI is NM_004482.4.

[0070] (2) Lentiviral packaging plasmids pMD2.G, pMDLg, pRSV and the overexpression plasmid obtained in step (1) were mixed in serum-free DMEM at a mass ratio of 1.5:2.5:1:4 to obtain plasmids for transfection.

[0071] (3) Culture 293T cells in 10cm culture dishes until they reach 70-80% confluence. Use Lipofectamine 3000 transfection reagent to transfect the 293T cells with the transfection plasmid used in step (2) according to the instructions. Continue culturing at 37℃ and 5% CO2 for 48-72 hours. Collect the culture supernatant to obtain the overexpressed lentivirus solution.

[0072] Example 3

[0073] 1. Cell Culture Preparation

[0074] 18–24 hours before transfection, the 231-H cells obtained in Example 1 were subjected to a 2 × 10⁻⁶ PCR reaction. 5 Cells were seeded at a density of 2 mL in 6-well plates. The cells were cultured overnight in a 5% CO2 incubator until 50% confluence was achieved.

[0075] 2. Preparation of stable mutant strains

[0076] Add 2 mL of the interfering virus solution obtained in Example 2 to the cells in step 1. After culturing for 24–48 h, remove the virus solution and replace it with fresh culture medium. After 24 h, add 2 μg / mL of puromycin and screen for cells that are resistant to antibiotics, which are the positive cells.

[0077] 3. Following the method described in Example 1, the obtained positive cells were subjected to fluorescence in situ hybridization (fish) to analyze GALNT3. circle The expression levels of the Lig3 gene mRNA and GALNT3 gene were measured and analyzed by Western blotting. The results showed that knocking down Lig3 reduced the expression levels of the Lig3 gene and GALNT3 mRNA. circle The water level decreased significantly. Figure 9 Furthermore, the expression levels of GALNT3 gene mRNA and protein were significantly downregulated, indicating that GALNT3... circle Regulating the transcriptional level of the GALNT3 gene ( Figure 10 ).

[0078] Example 4

[0079] 1. Cell Culture Preparation

[0080] 18–24 hours before transfection, the 231-H cells obtained in Example 1 were subjected to a 2 × 10⁻⁶ PCR reaction. 5 Cells were seeded at a density of 2 mL in 6-well plates. The cells were cultured overnight in a 5% CO2 incubator until 50% confluence was achieved.

[0081] 2. Preparation of stable mutant strains

[0082] (1) Add 2 mL of the interfering virus solution obtained by shLig3-1 or shCtrl in Example 2 to the cells in step 1. After culturing for 24-48 h, remove the virus solution and replace it with fresh culture medium. After 24 h, add 2 μg / mL of puromycin. Screen for cells that are resistant to antibiotics, which are positive cells, and record them as shLig3-1 and shCtrl respectively.

[0083] (2) The positive cells shLig3-1 were treated with 2×10 5 Cells were seeded at a density of 2 mL in 6-well plates. Cells were cultured overnight in a 5% CO2 incubator until 50% confluence was achieved. The overexpression virus solution obtained in Example 2 or the empty virus solution was then added. After culturing for 24–48 h, the virus solution was removed and replaced with fresh culture medium. 24 h later, 2 μg / mL of puromycin was added. Cells exhibiting antibiotic resistance were selected as positive cells and designated as shLig3-1+oeCtrl and shLig3-1+oeGALNT3, respectively.

[0084] 3. Following the method described in Example 1, positive cells shLig3-1, shCtrl, shLig3-1+oeCtrl, and shLig3-1+oeGALNT3 were cultured, and the mRNA expression level of the GALNT3 gene in different cells was detected and analyzed by Western blotting. The results showed that, compared to shCtrl, the mRNA expression level of the GALNT3 gene in shLig3-1 was significantly downregulated; there was no significant difference in the mRNA expression level of the GALNT3 gene between shLig3-1 and shLig3-1+oeCtrl; compared to shLig3-1, the mRNA expression level of the GALNT3 gene in shLig3-1+oeGALNT3 was lower, and there was no significant difference in the mRNA expression level of the GALNT3 gene between shLig3-1+oeGALNT3 and shCtrl. Figure 11 ).

[0085] 4. Following the procedure in Example 1, transwell migration experiments were performed on positive cells shCtrl, shLig3-1, shLig3-1+oeCtrl, and shLig3-1+oeGALNT3, respectively. Images were taken under a fluorescence microscope, and cell counting was performed using ImageJ. The results showed that GALNT3 cells were disrupted. circle After a significant decrease in migration ability, overexpression of GALNT3 significantly increased migration ability. Figure 12 ).

[0086] 5. Following the method described in Example 1, tail vein lung metastasis experiments were performed on positive cells shLig3-1, shCtrl, shLig3-1+oeCtrl, and shLig3-1+oeGALNT3. After 28 days, images were taken under a fluorescence microscope to observe the metastasis formation in the lungs, and the proportion of fluorescent area to the total lung area was calculated. The results showed that GALNT3 cells were disrupted. circle The metastasis ability decreased significantly after GALNT3 expression, but the metastasis ability increased significantly after overexpression of GALNT3. Figure 13 ).

[0087] 6. Tissue microarrays purchased from Shanghai Chip-Super Biotechnology Co., Ltd. (HBreD180Bc01-2, containing adjacent normal tissue and stage I-III triple-negative breast cancer tissue) were subjected to fluorescence in situ hybridization (FISH) detection as described in Example 1. The results showed that the outer ring GALNT3... circle GALNT3 is specifically highly expressed in triple-negative breast cancer, and its high expression is positively correlated with the malignancy of this tumor. Knockdown of the outer ring GALNT3 circle Or overexpression of exocyclic GALNT3 circle It can effectively inhibit or promote tumor metastasis. Figure 14 ).

[0088] Example 5

[0089] Sensitivity and specificity detection

[0090] To evaluate the outer ring GALNT3 circle For predicting highly metastatic triple-negative breast cancer, the efficacy was assessed by performing FISH experiments according to the FISH in situ hybridization kit instructions, followed by establishing an outer ring GALNT3 structure using GraphPadPrism 8.0. circle The ROC curve was obtained. The results showed that the area under the curve was 0.918, the cutoff point was 1.5, the 95% confidence interval was 0.870–0.965, the sensitivity was 92.66%, the specificity was 97.56%, and the P-value was <0.0001. Figure 15 ).

[0091] Example 6

[0092] 1. Following existing techniques (Wu R, Li K, Yuan M, et al. Nerve growth factor receptor increases the tumor growth and metastatic potential of triple-negative breast cancer cells[J]. Oncogene, 2021, 40(12): 2165-2181.), mouse triple-negative breast cancer cells EMT6 (low-metastatic cells) and 4T1 (high-metastatic cells) were cultured, and the expression level of GALNT3 gene mRNA in the two types of mouse breast cancer cells was detected and analyzed by Western Blot. The results showed that there was a significant difference in the expression level of GALNT3 gene mRNA between the two types of mouse breast cancer cells, with 4T1 cells showing a significantly higher expression level than EMT6 cells. Figure 16 ).

[0093] 2. Referring to existing techniques (Wu R, Li K, Yuan M, et al. Nerve growth factor receptor increases the tumor growth and metastatic potential of triple-negative breast cancer cells[J]. Oncogene, 2021, 40(12): 2165-2181.), tail vein lung metastasis experiments were performed on mouse triple-negative breast cancer cells EMT6 (low-metastatic cells) and mouse triple-negative breast cancer cells 4T1 (high-metastatic cells), respectively. Images were taken under a fluorescence microscope, and photon flux (p / s / cm²) was calculated. 2 The results showed that the metastatic ability of mouse triple-negative breast cancer cells 4T1 was significantly higher than that of mouse triple-negative breast cancer cells EMT6 ( / sr). Figure 17 ).

[0094] Example 7

[0095] 1. Cell Culture Preparation

[0096] 18–24 hours before transfection, mouse triple-negative breast cancer cells 4T1 were infected at a dose of 2 × 10⁻⁶. 5 Cells were seeded at a density of 2 mL in 6-well plates. The cells were cultured overnight in a 5% CO2 incubator until 50% confluence was achieved.

[0097] 2. Preparation of stable mutant strains

[0098] (1) Wuhan Chuling Biotechnology Co., Ltd. was commissioned to design interference plasmids and blank plasmids based on the target sequence of the mouse GALNT3 gene; the nucleotide sequence of shLig3 targeting the mouse GALNT3 gene is 5'-CCACCGAACAGAAGCTCAATA-3' (SEQ ID NO:5);

[0099] (2) Interference virus solution and control virus solution for mice were prepared in accordance with the method of Example 2;

[0100] (3) Add 2 mL of the interference virus solution and control virus solution obtained in step (2) to the cells in step 1 respectively. After 24 to 48 hours, remove the virus solution and replace it with fresh culture medium. After 24 hours, add 2 μg / mL of puromycin. Screen for cells that are resistant to antibiotics, which are positive cells, and record them as shLig3 and shCtrl respectively.

[0101] (4) Following the steps in Example 4, based on the stable shLig3 cell line, a cell line overexpressing GALNT3 (the transcript ID encoding mouse GALNT3 in NCBI is accession number NM_015736.2) (denoted as shLig3+oeCtrl) and a cell line overexpressing empty vector (denoted as shLig3+oeGALNT3) were prepared.

[0102] 3. After culturing positive cells (shCtrl, shLig3, shLig3+oeCtrl, and shLig3+oeGALNT3) for 1 day, the mRNA expression level of the GALNT3 gene in different cells was detected according to the method in Example 6, and Western blotting analysis was performed. The results showed that, compared with shCtrl, the mRNA expression level of the GALNT3 gene was significantly downregulated in shLig3 after the eccDNA was destroyed. Figure 18 Knocking out the circular DNA in 4T1 cells led to an increase in GALNT3 expression after overexpression.

[0103] 4. Following the method described in Example 6, shCtrl, shLig3, shLig3+oeCtrl, and shLig3+oeGALNT3 were injected via tail vein into the lungs for transfer. The lungs were then photographed under a fluorescence microscope, and the photon flux (p / s / cm²) was calculated. 2 / sr). The results showed that the outer ring GALNT3 of mouse triple-negative breast cancer cells 4T1. circle The ability to metastasize is significantly reduced after the expression of the GALNT3 gene is suppressed. Figure 19 ).

[0104] As can be seen from the above, the outer circular DNA (GALNT3) provided by this invention circleIt can serve as a diagnostic marker for highly metastatic triple-negative breast cancer, distinguishing it from low-metastatic triple-negative breast cancer. It has high specificity and sensitivity, providing a new target for the treatment of highly metastatic triple-negative breast cancer.

[0105] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. The application of a reagent for detecting the expression level of outer circular DNA in the preparation of products for diagnosing highly metastatic triple-negative breast cancer, characterized in that, The name of the outer circular DNA is GALNT3. circle The nucleotide sequence is shown in SEQ ID NO:

1.

2. The application according to claim 1, characterized in that, The outer circular DNA was significantly upregulated in patients with highly metastatic triple-negative breast cancer.

3. The application of a reagent for detecting the expression level of outer circular DNA in the preparation of products that differentiate between highly metastatic triple-negative breast cancer and low-metastatic triple-negative breast cancer, characterized in that... The name of the outer circular DNA is GALNT3. circle The nucleotide sequence is shown in SEQ ID NO:1.

Images