A rapid PCR primer, kit, and detection method for identifying whether sugarcane contains chromosome 4 of Imperata cylindrica.

By using PCR primers and kits, we can rapidly identify whether sugarcane contains chromosome 4 of Imperata cylindrica, solving the problems of complex and time-consuming traditional methods and achieving efficient and low-cost sugarcane breeding identification.

CN119639955BActive Publication Date: 2026-07-31FUJIAN AGRI & FORESTRY UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
FUJIAN AGRI & FORESTRY UNIV
Filing Date
2025-01-22
Publication Date
2026-07-31

AI Technical Summary

Technical Problem

Existing technologies make it difficult to quickly and accurately identify whether sugarcane contains chromosome 4 of Imperata cylindrica. Traditional methods are complex and time-consuming, which affects the efficiency of sugarcane breeding.

Method used

Using specific PCR primers (TaChr04-F and TaChr04-R) and kits, the genomic DNA of sugarcane materials was detected by conventional PCR reaction procedures, and the presence of chromosome 4 of Imperata cylindrica was identified by agarose gel electrophoresis analysis.

Benefits of technology

This method enables rapid, stable, simple, and low-cost chromosome identification of the sugarcane material *Pseudolarix amabilis* 4, improving the efficiency and accuracy of sugarcane breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119639955B_ABST
    Figure CN119639955B_ABST
Patent Text Reader

Abstract

This invention discloses a rapid PCR primer, kit, and detection method for identifying whether sugarcane contains chromosome 4 of Imperata cylindrica. The PCR primer is TaChr04-F / R, and its nucleotide sequence is shown in SEQ ID NO:1~2. Using this PCR primer, the presence of chromosome 4 in sugarcane material can be rapidly detected using only ordinary PCR technology. The detection method of this invention is highly efficient, stable, and easy to operate, possessing strong practicality and applicability.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to a PCR primer, kit, and detection method for rapidly identifying whether sugarcane contains chromosome 4 of Imperata cylindrica. Background Technology

[0002] Sugarcane is an important sugar crop and energy crop, and its yield and quality are of great significance to the global sugar industry and bioenergy production. *Imperata cylindrica*, a closely related wild germplasm resource of sugarcane, possesses advantages such as high biomass, wide adaptability, drought resistance, disease and pest resistance, vigorous growth, and good ratooning ability, and is considered an important germplasm resource for creating new sugarcane germplasm and breeding breakthrough sugarcane varieties. However, the precise composition and chromosome inheritance of *Imperata cylindrica* chromosomes in the offspring of sugarcane-*Imperata cylindrica* hybrids remain unclear. In the process of hybridization breeding of sugarcane and *Imperata cylindrica*, *Imperata cylindrica* chromosomes cannot completely pair with sugarcane chromosomes, resulting in chromosome loss. With the increase of backcross generations, the number of *Imperata cylindrica* chromosomes gradually decreases. Therefore, establishing a rapid and efficient method for identifying the genetic material of *Imperata cylindrica* has important application value in sugarcane-*Imperata cylindrica* hybridization breeding.

[0003] Traditional chromosome identification methods, such as cytogenetics, while providing detailed chromosome structural information, are complex, time-consuming, and require specialized equipment and personnel. In recent years, with the rapid development of molecular biology techniques, polymerase chain reaction (PCR) technology has gradually become the preferred method for identifying specific chromosomes or genes due to its high sensitivity, specificity, and speed. However, a PCR method for identifying whether sugarcane contains chromosome 4 of the 'Pissula' genera has not yet been developed. Therefore, developing a rapid, accurate, and easy-to-use PCR primer, kit, and detection method is of significant theoretical and practical importance for improving sugarcane breeding efficiency and accelerating the selection of superior varieties. Summary of the Invention

[0004] The purpose of this invention is to provide a rapid PCR primer, kit, and detection method for identifying whether sugarcane contains chromosome 4 of Imperata cylindrica. This invention can reliably detect the presence of chromosome 4 of Imperata cylindrica in sugarcane using conventional PCR procedures, with significant results.

[0005] To achieve the above objectives, the present invention adopts the following technical solution: This invention provides a rapid PCR primer for identifying whether sugarcane contains chromosome 4 of Imperata cylindrica. The sequence of the PCR primer is as follows: TaChr04-F: CTGCACCAGAATTTGAGATACAG; TaChr04-R:CTAATCCAACTGGGGACTATACTG.

[0006] The present invention also provides a rapid kit for identifying whether sugarcane contains chromosome 4 of Imperata cylindrica, the kit comprising the above-mentioned PCR primers.

[0007] The present invention also provides the application of the above-mentioned PCR primers and kits in the rapid identification of whether sugarcane contains chromosome 4 of Imperata cylindrica.

[0008] The present invention also provides the application of the above-mentioned PCR primers and kits in sugarcane breeding.

[0009] A rapid method for identifying whether sugarcane contains chromosome 4 of Imperata cylindrica includes the following steps: (1) Genomic DNA was extracted from sugarcane leaves using the CTAB method; (2) PCR amplification: Using the genomic DNA obtained in step (1) as a template, PCR amplification was performed using primers TaChr04-F and TaChr04-R. The results of agar gel electrophoresis were used to identify whether the sugarcane contained chromosome 4 of Imperata cylindrica.

[0010] Furthermore, the PCR amplification reaction system consists of 12.5 μL of 2×PCR Mix, 2 μL of TaChr04-F, 2 μL of TaChr04-R, 2 μL of 100 ng / μL genomic DNA, and 6.5 μL of ddH2O.

[0011] Furthermore, the PCR amplification reaction program is as follows: 95°C pre-denaturation for 5 min; 95°C denaturation for 30 s, 55°C annealing for 30 s, 72°C extension for 2 min, cycled 35 times; 72°C final extension for 3 min, stored at 4°C.

[0012] Furthermore, if the agarose gel electrophoresis result shows a 1270bp band, it indicates that the sugarcane contains chromosome 4 of Imperata cylindrica. If the agarose gel electrophoresis result does not show a 1270bp band, it indicates that the sugarcane does not contain chromosome 4 of Imperata cylindrica.

[0013] The beneficial effects of this invention are as follows: (1) High efficiency: The method of this invention only requires extracting DNA from seedling leaves to quickly detect whether sugarcane material contains chromosome 4 of Imperata cylindrica.

[0014] (2) Good stability: With the use of Imperata cylindrica in sugarcane breeding, no stable molecular markers have been found to identify the authenticity of the hybrid offspring of sugarcane and Imperata cylindrica in higher generations. However, the method of this invention can reliably detect whether sugarcane materials contain chromosome 4 of Imperata cylindrica after previous experiments.

[0015] (3) Low cost and easy operation: The sugarcane material can be tested for whether it contains chromosome 4 of Imperata cylindrica using ordinary PCR technology. In the early stage, it is only necessary to extract genomic DNA and then detect it by ordinary PCR amplification. It is highly practical and easy to promote. Attached Figure Description

[0016] Figure 1 The results of chromosome identification of the offspring 1849-10 of *Imperata cylindrica* using GISH and Oligo-FISH; where a: red Chr1 and green Chr2; b: red Chr3 and green Chr4; c: red Chr5 and green Chr6; d: red Chr7 and green Chr8; e: red Chr9 and green Chr10; f: *Imperata cylindrica* and *Imperata cylindrica*, scale bar size 5 μm.

[0017] Figure 2 The results are for TaChr04-F / R specificity detection; where 1~10 correspond to different templates, M: 2000bp Marker; 1: 1723-13; 2: 1849-10; 3: 1849-14; 4: 1891-27; 5: 1891-67; 6: Hainan 92-77; 7: Yunnan 82-114; 8: Badila; 9: ROC22; 10: ddH2O.

[0018] Figure 3 For the stability assay of TaChr04-F / R primers, primers 1-24 correspond to different templates: M: 2000bp Marker; 1: 1723-02; 2: 1723-05; 3: 1723-13; 4: 1723-28; 5: 1723-42; 6: 1849-09; 7: 1849-10; 8: 1849-14; 9: 1849-32; 10: 1849-54. 11: 1891-06; 12: 1891-12; 13: 1891-16; 14: 1891-27; 15: 1891-71; 16: Hainan 92-77; 17: Hainan 92-105; 18: Yunnan 82-114; 19: Yunnan 82-110; 20: Badila; 21: Black Car Liben; 22: ROC22; 23: Liucheng 05-136; 24: ddH2O. Detailed Implementation

[0019] To facilitate understanding of the present invention, the technical solutions described below are further illustrated with specific embodiments. These embodiments are intended to illustrate the invention and are not intended to limit the invention in any way.

[0020] Example 1 1. Testing materials Table 1 shows nine sugarcane materials, including the original species of Imperata cylindrica, tropical species, large-stemmed wild species, small-stemmed wild species, and sugarcane-related materials, used to detect the specificity of primer TaChr04-F / R in Imperata cylindrica and sugarcane materials.

[0021] Table 2 lists 23 sugarcane materials, including the original species of Imperata cylindrica, tropical species, large-stemmed wild species, small-stemmed wild species, and sugarcane-related materials, used to test the stability of primer TaChr04-F / R in Imperata cylindrica and sugarcane materials.

[0022] The results of previous GISH and Oligo-FISH tests have been used to determine whether the offspring of the Imperata cylindrica hybrid possess chromosome 4. Taking 1849-10 as an example, the specific detection techniques are as follows: Figure 1 As shown.

[0023] Table 1 Specific Detection Materials Table 2. Materials for stability testing 2. Testing Procedures (1) gDNA extraction from sugarcane materials: Genomic DNA was extracted from sugarcane leaves in Tables 1 and 2 using the CTAB method. The extracted genomic DNA was tested by an enzyme-linked immunosorbent assay (ELISA) reader, and the OD260 / OD280 ratio should be between 1.8 and 2.0. The extracted DNA was then stored at -20°C for later use.

[0024] (2) PCR amplification and detection: The sequences of the PCR primers are as follows: TaChr04-F: CTGCACCAGAATTTGAGATACAG (SEQ ID NO: 1); TaChr04-R: CTAATCCAACTGGGGACTATACTG (SEQ ID NO: 2).

[0025] PCR amplification was performed using the primers described above. The total PCR amplification reaction volume was 25 μl. The specific reaction mixture consisted of: 12.5 μL of 2×PCRMix, 2 μL of TaChr04-F, 2 μL of TaChr04-R, 2 μL of 100 ng / μL genomic DNA, and 6.5 μL of ddH2O. The reaction mixture was prepared on ice. The PCR reaction procedure was as follows: Pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 2 min, repeated 35 times; final extension at 72°C for 3 min, stored at 4°C. Detection was performed using 1.5% agarose gel electrophoresis, and images were taken using a gel imaging system for analysis. Samples capable of amplifying the target fragment contained chromosome 4 of the 'Pistacia chinensis' genera.

[0026] (3) Analysis of gel electrophoresis results Table 1 shows the PCR amplification results of the nine sugarcane materials. Figure 2 As shown, TaChr04-F / R was found to be specific, with a distinct target band (TaChr04, SEQ ID NO:3) appearing at 1270 bp in materials possessing chromosome 4 of the sclerotium.

[0027] Table 2 shows the PCR amplification results of 23 sugarcane materials and water samples. Figure 3 As shown, the results indicate that the specific fragment (SEQ ID NO:3) was amplified in *Imperata cylindrica*, but not in *Suaeda salsa* materials without *Imperata cylindrica* lineage. This suggests that the *Imperata cylindrica*-specific molecular marker TaChr04-F / R has good specificity and can be used as a *Imperata cylindrica*-specific molecular marker to determine whether sugarcane materials contain *Imperata cylindrica* chromosome 4.

[0028] The nucleotide sequence of TaChr04 is as follows:

[0029] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made within the scope of the claims of the present invention should be included in the scope of the present invention.

Claims

1. A PCR primer for rapid identification of whether sugarcane contains chromosome 4 of Imperata cylindrica, characterized in that: The sequences of the PCR primers are as follows: TaChr04-F: CTGCACCAGAATTTGAGATACAG; TaChr04-R: CTAATCCAACTGGGGACTATACTG; The sequence of its amplified product is shown in SEQ ID NO:

3.

2. A kit for rapid identification of the presence of Chromosome 4 of Erianthus arundinaceus in sugar cane, characterized in that: The kit contains the primers as described in claim 1.

3. The application of the PCR primers as described in claim 1 or the kit as described in claim 2 in the rapid identification of whether sugarcane contains chromosome 4 of Imperata cylindrica.

4. The application of the PCR primers as described in claim 1 or the kit as described in claim 2 in sugarcane breeding.

5. A method for rapidly identifying whether a sugar cane plant contains Chromosome 4 of Eremochloa ophiuroides, characterized by: Includes the following steps: (1) Genomic DNA was extracted from sugarcane leaves using the CTAB method; (2) PCR amplification: Using the genomic DNA obtained in step (1) as a template, PCR amplification was performed using primers TaChr04-F and TaChr04-R. The results of agar gel electrophoresis were used to identify whether the sugarcane contained chromosome 4 of Imperata cylindrica. The sequences of the primers TaChr04-F and TaChr04-R are as follows: TaChr04-F: CTGCACCAGAATTTGAGATACAG; TaChr04-R: CTAATCCAACTGGGGACTATACTG; When the agarose gel electrophoresis result shows a 1270bp band, it indicates that the sugarcane contains chromosome 4 of Imperata cylindrica. If the agarose gel electrophoresis result does not show a 1270bp band, it indicates that the sugarcane does not contain chromosome 4 of Imperata cylindrica.

6. The method for rapid identification of sugarcane plants containing Chromosome 4 of E. arundinacea according to claim 5, characterized by the fact that: The PCR amplification reaction system consisted of 12.5 μL of 2×PCR Mix, 2 μL of TaChr04-F, 2 μL of TaChr04-R, 2 μL of 100 ng / μL genomic DNA, and 6.5 μL of ddH2O.

7. The method for rapid identification of sugarcane plants containing Chromosome 4 of E. arundinacea according to claim 5, characterized by the fact that: The PCR amplification reaction program is as follows: 95°C pre-denaturation for 5 min; 95°C denaturation for 30 s, 55°C annealing for 30 s, 72°C extension for 2 min, cycled 35 times; 72°C final extension for 3 min, stored at 4°C.