Cold-tolerant negative regulation gene osbhlh090 of rice and application thereof

Abstract

The application belongs to the technical field of plant genetic engineering, and particularly relates to a cold tolerance negative regulation gene OsbHLH090 of rice and application thereof. The nucleotide sequence of the gene is shown in the sequence table SEQ ID NO:1, and the amino acid sequence encoded is shown in the sequence table SEQ ID NO:2. The application uses CRISPR-Cas9 gene editing technology to edit the rice OsbHLH090 gene, and obtains a cold-sensitive rice mutant by knocking out the gene. The OsbHLH090 CDS is cloned into a pC1390U vector to construct an overexpression vector. Under cold stress, the survival rate of the mutant is higher than that of the wild type, and the survival rate of the overexpression transgenic rice is lower than that of the wild type, indicating that the OsbHLH090 gene is an important negative regulation factor in the cold tolerance pathway of rice. The application provides a new resource for plant and rice cold resistance breeding.

Description

Technical Field

[0001] This invention relates to the fields of plant transgenic technology and crop genetic breeding, specifically to the rice cold tolerance negative regulatory gene OsbHLH090 and its applications. Technical Background

[0002] Rice is a vital food crop globally, particularly important in Asia and Africa, but its growth is susceptible to chilling injury. With global climate change and the increasing frequency of extreme weather events, the threat of chilling injury to rice production is growing, especially during frosts and cold waves in spring and autumn. Low temperatures not only slow rice growth but can also lead to pollination failure, panicle damage, and even crop loss. Therefore, improving the cold tolerance of rice is crucial. This not only reduces losses from chilling injury but also enhances the stability of rice production under harsh climates, expands rice-growing areas, and ensures food security. Furthermore, the breeding of cold-resistant rice varieties can improve agricultural productivity, helping farmers cope with low-temperature losses and increase their income. In recent years, with advancements in molecular biology and genomics technologies, scientists have discovered several genes related to rice cold tolerance. Using gene editing and other technologies, it is possible to breed rice varieties with stronger cold tolerance, providing a precise solution for improving rice's cold resistance.

[0003] The bHLH (basic helix-loop-helix) transcription factor family is one of the important transcription factors in plants, widely involved in various biological processes such as plant growth and development, photosynthesis, and stress response. In rice, bHLH transcription factors play an important regulatory role in cold tolerance, disease resistance, and plant development. With the development of molecular biology techniques, significant progress has been made in recent years in the study of rice bHLH transcription factors, especially in the area of ​​rice cold tolerance, revealing the key role of bHLH transcription factors in regulating rice's cold resistance response.

[0004] bHLH transcription factors, named for their unique structure, are primarily composed of a conserved basic region and a helix-loop-helix domain. They regulate the transcriptional expression of downstream genes by binding to the E-box (CANNTG) sequence in DNA. Based on functional and sequence differences, bHLH transcription factors can be divided into several subclasses, some of which are closely related to plant growth, development, and stress responses. In rice cold tolerance studies, bHLH transcription factors participate in the mechanism of rice adaptation to low-temperature stress by regulating a series of genes associated with cold stress responses.

[0005] Specifically, bHLH transcription factors are closely related to multiple biological pathways, including cold receptors, antioxidant enzyme systems, and hormone signaling, thereby enhancing rice's adaptability to low temperatures. For example, the OsbHLH148 transcription factor in rice is upregulated under low-temperature stress, which enhances rice's cold resistance. By regulating the expression of cold-response genes, such as antioxidant enzyme genes and stress-response genes, OsbHLH148 helps rice scavenge reactive oxygen species (ROS) generated by low-temperature stress, thus protecting cells from low-temperature damage. In addition, bHLH transcription factors also synergistically work with plant hormone signaling pathways (such as ABA and JA) to jointly regulate the cold resistance response of rice.

[0006] Although existing research has revealed the important role of bHLH transcription factors in rice cold tolerance, many questions remain to be answered. Future research can further explore the mechanism of action of bHLH transcription factors, especially how they interact with other cold tolerance genes, plant hormone signaling pathways, and environmental factors under low-temperature stress. Furthermore, gene editing technologies (such as CRISPR-Cas9) provide new means for precisely regulating the expression of bHLH transcription factors and their downstream genes, opening up new research directions for breeding more cold-resistant rice varieties. Summary of the Invention

[0007] This invention, through high-throughput genomics analysis and functional genomics research, identified the gene OsbHLH090, which is associated with cold tolerance in rice. This gene is located on chromosome 1, with the MSU_Locus number LOC_Os01g68700. Its full-length genome sequence is 3120 bp, with a coding region of 1455 bp, encoding a protein of 484 amino acid residues. Through gene knockout and overexpression, we verified the function of the OsbHLH090 gene under low-temperature stress. Knockout of this gene significantly enhanced the cold tolerance of rice seedlings and reduced mortality; while overexpression of this gene significantly increased the mortality rate of rice seedlings under low temperatures, indicating that the OsbHLH090 gene acts as a negative regulator in the rice cold tolerance pathway.

[0008] The technical solution adopted by this invention to solve its technical problem is:

[0009] In a first aspect, the present invention protects a protein, said protein being any of the following:

[0010] A1) A protein with the amino acid sequence shown in SEQ ID NO: 2;

[0011] A2) A protein obtained by substituting and / or deleting and / or adding amino acid residues of the protein in A1) has more than 80% identity with the protein shown in A1) and has negative regulation of rice cold resistance.

[0012] A3) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of A1) or A2).

[0013] The protein in A1 above is named OsbHLH090.

[0014] To facilitate the purification or detection of the protein in A1), a tag protein can be attached to the amino or carboxyl terminus of the protein, which consists of the amino acid sequence shown in SEQ ID No. 2 in the sequence listing.

[0015] The proteins mentioned above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0016] The tagged proteins include, but are not limited to: GST (glutathione thiotransferase) tagged protein, His6 tagged protein (His-tag), MBP (maltose-binding protein) tagged protein, Flag tagged protein, SUMO tagged protein, HA tagged protein, Myc tagged protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomer red fluorescent protein), or AviTag tagged protein, etc.

[0017] In a specific implementation plan, the protein is derived from rice.

[0018] Secondly, the present invention also protects biological materials related to the proteins described above, wherein the biological materials are any of the following:

[0019] B1) Nucleic acid molecules that encode the proteins described above;

[0020] B2) A recombinant vector containing the nucleic acid molecules described in B1);

[0021] B3) Recombinant microorganisms containing the nucleic acid molecules described in B1) or recombinant microorganisms containing the recombinant vector shown in B2);

[0022] B4) A transgenic plant cell line containing the nucleic acid molecule described in B1) or a transgenic plant cell line containing the recombinant vector described in B3).

[0023] In a specific implementation scheme, the nucleotide sequence of the nucleic acid molecule described in B1) is as shown in SEQ ID NO: 1.

[0024] In a specific implementation, the nucleotide sequence (OsbHLH090 gene) shown in SEQ ID NO: 1 encodes the protein OsbHLH090 with the amino acid sequence shown in SEQ ID NO: 2.

[0025] The vectors described herein are well-known to those skilled in the art and include, but are not limited to: plasmids, bacteriophages (such as λ phage or M13 filamentous phage), granules (i.e., Cosmids), Ti plasmids, or viral vectors. Specifically, they may be pC1390U vectors or TKC vectors.

[0026] Thirdly, the present invention also protects the application of the proteins or biological materials described above in the negative regulation of cold resistance in rice.

[0027] Fourthly, the present invention also protects the application of the proteins or biomaterials described above in the preparation of negatively regulated cold resistance in rice.

[0028] Fifthly, the present invention also protects the use of the proteins or biological materials described above in the cultivation of cold-resistant rice.

[0029] Sixthly, the present invention also protects a method for negatively regulating the cold resistance of rice, wherein the method obtains cold-resistant rice by inhibiting or reducing or silencing the expression level of the coding gene of the protein described above in the target rice, or by inhibiting or reducing or silencing the activity and / or content of the protein described above.

[0030] In a seventh aspect, the present invention also protects a method for cultivating cold-resistant rice, which obtains cold-resistant rice by inhibiting, reducing or silencing the expression level of the coding gene of the protein described above in the target rice, or by inhibiting, reducing or silencing the activity and / or content of the protein described above.

[0031] Beneficial effects

[0032] This invention proposes a strategy to improve the cold tolerance of rice by regulating the expression of the OsbHLH090 gene. This technology can effectively improve the growth adaptability of rice in cold environments, providing new ideas for rice breeding. Furthermore, the cold-tolerant gene and its application technology provided by this invention not only enhance the resistance of rice to low-temperature conditions but also provide a reference for improving the cold tolerance of other crops. With global climate change leading to increasingly severe low-temperature environments, this technology has broad application prospects and can help agricultural production better cope with the challenges posed by cold weather. Attached Figure Description

[0033] Figure 1 This is the vector map of the pC1390U vector;

[0034] Figure 2 This is a map of the TKC vector used in CRISPR-Cas9;

[0035] Figure 3 This is a diagram of CRISPR-Cas9 knockout targets and mutation sites;

[0036] Figure 4 The graph shows the cold tolerance phenotypes and quantification results of wild-type (WT), mutant (bhlh090), and overexpression (90OE) plants. Detailed Implementation

[0037] The following examples are provided to better understand the present invention, but are not intended to limit the invention. Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were purchased from conventional biochemical reagent stores.

[0038] The rice variety Zhonghua 11 was preserved in the laboratory. The overexpression vector pC1390U used in this invention is shown in the image. Figure 1 The sequence is shown in SEQ ID NO: 3.

[0039] Example 1: Cloning of the rice cold tolerance gene OsbHLH090

[0040] (1) Rice RNA extraction

[0041] 0.2 g of young rice leaves were used to extract total RNA using the Trizol method. The purity of RNA was assessed by measuring its concentration and A260 / A280 ratio; the integrity of RNA was verified by agarose gel electrophoresis.

[0042] (2) Obtaining rice cDNA by reverse transcription

[0043] Residual genomic DNA was removed from the RNA and cDNA was obtained by reverse transcription, following the procedure described in TaKaRa's PrimeScript. TM Follow the instructions in the RT reagent kit with gDNA eraser (Perfect Real Time).

[0044] The reaction conditions were: incubation at 42°C for 30 min in a PCR instrument, followed by heating at 85°C for 5 sec to inactivate Prime Script RT Enzyme Mix and gDNA Eraser.

[0045] (3) Obtaining the OsbHLH090 gene

[0046] Primers were designed using Primer3 Plus software, controlling the GC content between 40% and 60%. Cloning primers OsbHLH090-F and OsbHLH090-R were designed for PCR amplification to obtain the full-length coding region of OsbHLH090. The primer sequences are: OsbHLH090-F: 5'GCTGCTTCTGCTTGCGATTG 3'; OsbHLH090-R: 5'GACTACCGTACATGGTGCGT 3'. Based on the pC1390U vector (vector map see...),... Figure 1 Based on the restriction enzyme sites on the OsbHLH090 gene (as shown in SEQ ID NO: 3), primers OsbHLH090-KpnI-F and OsbHLH090-BamHI-R were designed. PCR amplification was used to introduce the flanking sequences of the OsbHLH090 gene into the KpnI and BamHI restriction sites. The success of the amplification was verified using 1% agarose gel electrophoresis. Finally, sequencing results showed that the sequence of the OsbHLH090 gene coding region was consistent with the OsbHLH090 coding region sequence annotated in the rice genome data.

[0047] Example 2: Construction of OsbHLH090 gene overexpression vector

[0048] Gene fragment recovery: The OsbHLH090 gene coding region fragment obtained from Example 1 was recovered by agarose gel electrophoresis. Vector double digestion: The pC1390U vector was double-digested with KpnI and BamHI. The vector fragment was recovered after digestion. Ligation reaction: The OsbHLH090 gene coding region fragment was ligated to the vector fragment using Exnase II ligase (Novizan). The ligation conditions were: 37°C, 30 minutes. Reaction system: Exnase II ligase (2 μL), 5×CE Buffer (4 μL), OsbHLH090 gene fragment (2 μL, 100 ng), linearized pC1390U vector (2 μL, 50 ng), sterile water (10 μL). Transformation: 10 μL of the ligation product was used to transform *E. coli* DH5α cells using the heat shock method. After transformation, the bacteria were plated onto LB agar containing kanamycin. Culture and Screening: The cells were cultured overnight at 37℃. Ten single clones were selected for plasmid extraction and PCR identification. PCR Identification and Sequencing: Two positive clones were selected for sequencing. Sequencing results showed that the inserted PCR product sequence was SEQ ID NO.1, with a length of 1455 bp. The protein encoded by this sequence consists of 484 amino acid residues, with the sequence SEQ ID NO.2. Construction of Recombinant Expression Vector: Through the above steps, an overexpression vector containing the OsbHLH090 gene was obtained, named pC1390U-OsbHLH090.

[0049] Example 3: Construction of OsbHLH090 gene knockout vector

[0050] The CRISPR website (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR / CRISPR) was used to screen for highly specific exon sequences of the OsbHLH090 gene as targets. The target sequences were then cloned into the TKC vector (vector map can be found here). Figure 2 In this study, the OsbHLH090 knockout vector was identified through sequencing. The process is as follows:

[0051] (1) Primers were synthesized based on the target sequence. The sequence information is as follows:

[0052] Primer1: 5'CAGATGATCCGTGGCAGCATCTCCCGTCTTGGCTCCGTTTTAGAGCTAGAA 3'; Primer2: 5'TTCTAGCTCTAAAACGGAGCCAAGACGGGAGATGCTGCCACGGATCATCTG3'.

[0053] (2) Dissolve the above primer sequences in 1×TE to prepare a 100μM stock solution. Use primer1 and primer2 as the front and back primers respectively, and add 1μL of each to 98μL of 0.5×TE solution to mix and dilute to 1μM.

[0054] (3) Hold at 95℃ for 3 minutes, then move to room temperature to cool and complete the annealing.

[0055] (4) The enzyme digestion and ligation system (Thermo Scientific) is as follows:

[0056]

[0057]

[0058] The reaction program was as follows: incubation at 37℃ for 5 min, followed by incubation at 20℃ for 5 min. These two conditions were maintained for 10 cycles. The amplification reaction was performed using a BIO-RAD T100 thermal cycler. The product was transformed into *E. coli* DH5α competent cells (Beijing Tiangen CB101), and positive clones were selected for sequencing. Sequencing results showed that the obtained fragment was an OsbHLH090 knockout vector containing the target sequence, named pTKC-OsbHLH090.

[0059] Example 4: Genetic transformation of rice

[0060] All rice transformations were performed using Agrobacterium-mediated genetic transformation (Agb. EHA105). The specific steps of the Agrobacterium-mediated genetic transformation method are as follows:

[0061] (1) Obtaining recombinant Agrobacterium

[0062] pC1390U-OsbHLH090 and pTKC-OsbHLH090 were transformed into Agrobacterium tumefaciens strain EHA105 (purchased from Ingenium Biotech, USA) using the freeze-thaw method to obtain recombinant strains. Plasmids were extracted and identified by PCR. The correctly identified recombinant strains were named EH-pC1390U-OsbHLH090 and EH-pTKC-OsbHLH090, respectively.

[0063] (2) Transformation of Agrobacterium

[0064] Seed treatment: Select mature and plump rice seeds, remove the husks, disinfect with 75% alcohol for 1-2 minutes, and discard the alcohol; add 0.15% mercuric chloride (containing 0.1% Tween 20) for 10 minutes and then discard the mercuric chloride; rinse 6 times with sterile distilled water. Inoculate the seeds into callus induction medium and culture at 28℃ under light for 20 days.

[0065] Agrobacterium preparation: Agrobacterium EHA105 transformed with pC1390U-OsbHLH090 and pTKC-OsbHLH090 vectors were streaked onto LB plates containing 20 mg / L Rif and 50 mg / L Kan, respectively, and incubated at 28°C for 2 days; single colonies were picked and cultured in LB liquid medium at 28°C and 200 rpm for 2 days; before infection, the bacterial culture was scraped into suspension medium and shaken at 28°C and 180 rpm for 3-3.5 h to adjust OD600 to 0.1-0.15.

[0066] Callus infection: Rice callus with a diameter of 2-4 mm was immersed in bacterial solution for 20 min, the surface bacterial solution was blotted dry and covered with sterile filter paper, dried in a clean bench for 30 min, and then transferred to co-culture medium covered with sterile filter paper. It was incubated in the dark at 20℃ overnight, and then incubated in the dark at 25℃ for 2 days.

[0067] Cleaning and screening: After co-culturing, the callus was washed 7-8 times with sterile distilled water, and finally soaked in sterile water containing 500 mg / L carbenicillin for 30 min. The solution was discarded, and the surface moisture was blotted dry. The callus was then dried in a clean bench for 1 h. The cleaned callus was placed in a screening medium containing hygromycin and cultured at 32°C under light for 14 days.

[0068] (3) Differentiation and regeneration of callus tissue

[0069] After 14 days of selection, the resistant callus was transferred to differentiation medium and cultured at 28°C (photoperiod of 14h light / 10h dark). When the resistant callus formed 3-4cm tall regenerated seedlings on the differentiation medium, it was transferred to rooting medium and cultured until complete transgenic rice plants were formed.

[0070] Example 5: Identification of cold tolerance in wild-type, OsbHLH090 gene mutants and overexpressing plants

[0071] Wild-type, OsbHLH090 mutant, and overexpressing rice seeds were disinfected in a 2.5% sodium hypochlorite solution for 20 minutes (do not over-sterilize), followed by rinsing six times with sterile deionized water. After rinsing, the seeds were evenly spread on filter paper, an appropriate amount of sterile water was added, and the seeds were placed in an incubator at 28°C for germination. Three days later, the germinated seeds were transferred to 96-well hydroponic boxes, with 40 seeds of each variety (wild-type, osbhlh90 mutant, and overexpressing plants) planted, and three biological replicates were set up. The growth conditions were: 13 hours of light, 11 hours of darkness, light intensity of 40,000 LUX, temperature of 28°C during light, temperature of 25°C during darkness, and relative humidity of 75%.

[0072] Two weeks after the seedlings reached maturity, they were transferred to an artificial climate chamber for cold tolerance testing. The cold treatment conditions were: 13 hours of light followed by 11 hours of darkness, light intensity of 40,000 LUX, temperature of 4°C during light exposure and 4°C during darkness, and relative humidity of 70%. After four days of cold treatment, the seedlings were removed and restored to normal growth conditions: 13 hours of light followed by 11 hours of darkness, light intensity of 40,000 LUX, temperature of 28°C during light exposure and 25°C during darkness, and relative humidity of 70%. Seven days after resuscitation, the survival rate was calculated by the ratio of surviving seedlings to the total number of seedlings, and the ion leakage rate was determined (approximately 0.3 g of seedling leaf sample treated at 4℃ was placed in a 15 mL centrifuge tube containing 5 mL of deionized water, and shaken at 200 rpm for 1 hour at room temperature; the conductivity of the solution was measured and recorded as S1. Subsequently, the centrifuge tube was heated in boiling water for 20 minutes, and then shaken at room temperature for another 1 hour; the total conductivity was measured and recorded as S2. The conductivity of the deionized water was recorded as S0. The relative ion leakage rate was calculated according to the formula: Ion leakage rate (%) = (S1 - S0) / (S2 - S0).

[0073] The results are as follows Figure 4 As shown: Figure 4A showed that under normal growth conditions, wild-type, osbhlh90 mutant, and overexpression plants exhibited similar growth characteristics and similar plant heights. After 4 days of cold stress treatment, all three materials suffered varying degrees of damage. Compared to the wild type, the osbhlh90 mutant showed milder damage, while the OsbHLH090 overexpression rice suffered more severe damage. Specifically, the survival rate of the osbhlh90 mutant (79.3%) was significantly higher than that of the wild type (51.0%), while the survival rate of the OsbHLH090 overexpression rice (28.3%) was significantly lower than that of the wild type (28.3%). Figure 4 B). In addition, we measured the ion leakage rate of each material under cold stress, and the results are as follows: Figure 4 As shown in Figure C, after cold stress treatment, the ion leakage rate of the osbhlh90 mutant was 19.5%, significantly lower than the wild type's 39.3%; while the ion leakage rate of the overexpressing rice was 70.7%, significantly higher than the wild type. These results indicate that the OsbHLH090 gene plays an important role in regulating cold tolerance in rice.

[0074] The cold-resistant gene and its application method provided by this invention can significantly improve the adaptability and resistance of rice in low-temperature environments. Through gene editing technology, precision breeding can be achieved, reducing reliance on traditional breeding methods and further ensuring food security.

[0075] The present invention has been described in detail above with general descriptions and specific embodiments. However, modifications or improvements can be made to the present invention, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention are within the scope of protection claimed by the present invention.

[0076] SEQ ID NO: 1

[0077] CDS

[0078] >LOC_Os01g68700.1

[0079]

[0080] GCTACAATGGTAGGATCGTTGCAAACAGTCCACATGAAAATGGAGCTTTGACATGA

[0081] Protein

[0082] >LOC_Os01g68700.1

[0083] Met Asn Cys Gly Pro Pro Asp Gln Leu Pro Pro Ala Thr Ala Pro Ser CysPhe Leu Asn Leu AsnTrp Asp Gln Ser Met Asp Ala Ala Ala Gly Gly His Leu AspPro Ala Leu Ser Ser Met Val Ser Ser ProAla Ser Asn Ser Thr Gly Ala Leu HisGly Ile Ser Pro Gln Pro His Tyr Gly Gly Gly Thr Pro Leu SerSer Pro Pro LysLeu Asn Leu Ser Met Met Gly Gln Phe His His Tyr Ala Ala Pro Pro Gln Val GlyGlyGly Gly Gly Gly Gly Gly Gly Leu Pro Ile Leu Glu Asn Leu Met Pro Met GlyHis Leu Asp Gln PheLeu Ala Asp Pro Gly Phe Ala Glu Arg Ala Ala Arg Leu SerGly Phe Asp Ala Arg Gly Gly Gly GlyGly Gly Gly Tyr Gly Gly Ala Gly Pro AlaGln Phe Gly Leu Pro Asp Ala Gly Ala Ala Gly Ala SerLys Glu Met Glu Leu GlyAsn Thr Arg Asp Glu Ser Ser Val Ser Asp Pro Ala Pro Gly Gly Ala Glu IleProPro Lys Gly Ala Ser Asp Gly Asn Ala Arg Lys Arg Lys Ala Ser Gly Lys Gly LysGly Lys Asp SerPro Met Ser Thr Ser Ala Ala Lys Glu Asp Ser Ser Gly Lys ArgCys Lys Ser Thr Glu Glu Ser Asn AlaAla Ala Glu Glu Asn Ser Gly Lys Gly LysAla Ala Gln Ser Asn Ser Glu Asn Gly Gly GlyLys LysGln Gly Lys Asp Ser SerSer Lys Pro Pro Glu Pro Pro Lys Asp Tyr Ile His Val Arg Ala Arg Arg GlyGluAla Thr Asp Ser His Ser Leu Ala Glu Arg Val Arg Arg Glu Lys Ile Ser Gln ArgMet Lys Leu LeuGln Asp Leu Val Pro Gly Cys Asn Lys Val Val Gly Lys Ala ValMet Leu Asp Glu Ile Ile Asn Tyr ValGln Ser Leu Gln Arg Gln Val Glu Phe LeuSer Met Lys Leu Ala Thr Val Asn Pro Gln Leu Asp PheAsn Asn Leu Pro Asn LeuLeu Ala Lys Asp Met His Gln Ser Cys Ser Pro Leu Gln Ser Ser His PhePro LeuGlu Thr Ser Gly Ala Pro Leu Pro Tyr Ile Asn Gln Pro Gln Gln Gly Asn Pro LeuGly Cys GlyLeu Thr Asn Gly Met Asp Asn Gln Gly Ser Met His Pro Leu Asp ProAla Phe Cys Arg Pro Met GlySer His His Pro Phe Leu Asn Gly Val Ser Asp AlaAla Ser Gln Val Gly Ala Phe Trp Gln Asp Asp LeuGln Ser Val Val Gln Met AspMet Gly Gln Ser Gln Glu Ile Ala Thr Ser Ser Asn Ser Tyr Asn Gly ArgIle ValAla Asn Ser Pro His Glu Asn Gly Ala Leu Thr*

Claims

1. At least one application of the knockout of the nucleotide sequence of a nucleic acid molecule as shown in SEQ ID NO: 1 in improving the cold resistance of rice and in the cultivation of cold-resistant rice.

2. The application of reducing the content of the protein encoded by the nucleotide sequence described in claim 1 in improving the cold resistance of rice and cultivating cold-resistant rice.

3. A method for improving the cold resistance of rice, characterized in that, The cold resistance of rice can be improved by knocking out the nucleic acid molecules described in claim 1 in the target rice, or by reducing the content of the protein described in claim 2 in the target rice.

4. A method for cultivating cold-resistant rice, characterized in that, Cold-resistant rice is obtained by knocking out the nucleic acid molecule described in claim 1 in the target rice.

Images