Diagnostic kasp marker for detecting wheat stem rust resistance gene sr43 and application thereof

Abstract

The application discloses a diagnostic KASP marker for detecting a wheat stem rust resistance gene Sr43 and an application thereof, and belongs to the technical field of wheat molecular breeding. The diagnostic KASP marker can be used to know the presence of the Sr43 gene in advance, predict the resistance of wheat to stem rust, and accurately screen a wheat line carrying the wheat stem rust resistance gene Sr43 for wheat breeding according to the fluorescence type of the marker detection, the molecular marker can be directly used for production practice, improve the breeding efficiency of the wheat stem rust resistance gene Sr43, accelerate the breeding process, and promote the application of the gene in wheat molecular breeding.

Description

Technical Field

[0001] This invention relates to the field of wheat molecular breeding technology, specifically to a diagnostic KASP marker for detecting the wheat stem rust resistance gene Sr43 and its application. Background Technology

[0002] Wheat stem rust is a disease caused by the fungus *Puccinia graminis* f.sp. *Tritici*. Infected wheat stems and leaves develop numerous brick-shaped spores, leading to reduced grain weight and, in severe cases, lodging, resulting in yield loss. Since the 1970s, the widespread application of the resistance gene Sr31 has effectively controlled wheat stem rust globally. However, with the discovery of the highly pathogenic strain Ug99 (later named TTKSK), stem rust has re-emerged on a large scale. Ug99 mutates rapidly and is extremely virulent, causing several resistance genes for stem rust, including Sr31, to lose their resistance. Therefore, discovering new antigens is one of the key tasks in combating Ug99 and its variants.

[0003] The Sr43 gene from *Thinopyrum elongatum* is a novel wheat stem rust resistance gene with a unique resistance mechanism and a broad resistance spectrum, exhibiting high resistance to various currently prevalent stem rust physiological races, including Ug99 and its derivatives. The existence of this gene provides a new genetic resource for breeding durable, broad-spectrum resistant wheat varieties, and holds promise for effectively addressing the yield and quality losses caused by stem rust in current wheat production. However, traditional breeding methods are time-consuming, labor-intensive, lack focus, and have low breeding efficiency. Molecular marker-assisted selection breeding can effectively solve this problem. However, the lack of diagnostic molecular markers for this gene currently severely restricts its application in wheat breeding. Summary of the Invention

[0004] In view of the above-mentioned prior art, the purpose of this invention is to provide a diagnostic KASP marker for detecting the wheat stem rust resistance gene Sr43 and its application.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] In a first aspect, the present invention provides an SNP molecular marker associated with stem rust resistance, the nucleotide sequence of which is shown in SEQ ID No. 1, wherein the 33rd base from the 5' end of the sequence shown in SEQ ID No. 1 is the SNP site, and the base is A or T.

[0007] The specific nucleotide sequences of the SNP molecular markers are as follows:

[0008] gtgga aaagcttgtt gatatcgtca gttttctygataaacaaatc cgggatgcatttggtgaag.

[0009] Note: The nucleotides in bold shaded areas in the sequence are SNP sites, and the nucleotide polymorphism is A / T, which is represented by "y" in the sequence listing.

[0010] This invention discovered a SNP site associated with resistance to stem rust in the Sr43 gene (Gene ID: ON237711.1; database link: https: / / www.ncbi.nlm.nih.gov / nucleotide / ON237711.1?report=genbank&log$=nuclalign&blast_rank=1&RID=NMENZ7DJ016). The SNP site is located at the 9178th base in the nucleotide sequence of the Sr43 gene and exhibits a specific A / T polymorphism with homologous genes in the wheat D chromosome set.

[0011] In a second aspect, the present invention provides the application of the above-mentioned SNP molecular marker in any one of the following (1)-(3):

[0012] (1) Develop diagnostic markers for the stem rust resistance gene Sr43;

[0013] (2) Identify the resistance of plant resources to stem rust;

[0014] (3) Molecular marker-assisted breeding of wheat resistant to stem rust.

[0015] A third aspect of the present invention provides a KASP molecular marker primer combination for the specific detection of the stem rust resistance gene Sr43, comprising the primers shown in SEQ ID No. 2, SEQ ID No. 3, and SEQ ID No. 4; specifically as follows:

[0016] Sr43-KASP-FAM:

[0017] 5'-GAAGGTGACCAAGTTCATGCTGCTTGTTTGATATCGTCAGTTTTCTA-3'; (SEQ ID No. 2)

[0018] Sr43-KASP-HEX:

[0019] 5'-GAAGGTCGGAGTCAACGGATTGCTTGTTGATATCGTCAGTTTTCTT-3'; (SEQ ID No. 3)

[0020] Sr43-KASP-R:

[0021] 5'-AATGCATCCCGGATTTGTTT-3'. (SEQ ID No.4)

[0022] Of the primers mentioned above, Sr43-KASP-FAM and Sr43-KASP-HEX are upstream genotyping primers, and Sr43-KASP-R is a downstream universal primer. Sr43-KASP-FAM, Sr43-KASP-HEX, and Sr43-KASP-R are dissolved in TE (pH 8.0) or sterile ultrapure water to a final concentration of 100 μM, and then mixed at a volume ratio of 2:2:5 for later use.

[0023] Based on the SNP molecular markers related to stem rust resistance of this invention, this invention designed a KASP molecular marker primer combination specifically for detecting the stem rust resistance gene Sr43. This combination can perform genotypic analysis on the SNP differences at position 9178 of the Sr43 gene. The A / A genotype is a Sr43 resistance haplotype, which indicates resistance to wheat stem rust; the T / T genotype is a Sr43 susceptibility haplotype, which indicates susceptibility to wheat stem rust; and the A / T genotype is a Sr43 gene heterozygote.

[0024] In a fourth aspect, the present invention provides the application of the above-described KASP molecular marker primer combination in the following (1) or (2):

[0025] (1) Identify the resistance of plant resources to stem rust;

[0026] (2) Molecular marker-assisted breeding of wheat resistant to stem rust.

[0027] A fifth aspect of the present invention provides a method for identifying or assisting in the identification of wheat resistance to stem rust, comprising the following steps:

[0028] The genotyping of wheat samples is performed based on specific SNP loci, and the resistance to stem rust is determined according to the genotyping: wheat with haplotype AA is resistant to stem rust; wheat with haplotype TT is susceptible to stem rust.

[0029] The specific SNP site is nucleotide 9178 of the Sr43 gene (Gene ID: ON237711.1), which exhibits A / T polymorphism.

[0030] Preferably, the above-mentioned KASP molecular marker primer combination is used to detect the genotyping of wheat based on specific SNP sites. Specifically:

[0031] Using the genomic DNA of the wheat to be tested as a template, PCR amplification was performed using a combination of KASP molecular marker primers. After centrifugation of the amplification products, fluorescence data were collected, and genotyping was performed based on the fluorescence data.

[0032] Furthermore, the PCR reaction system consisted of: 2 μL DNA template, 1.94 μL 2×KASP Master Mix, and 0.06 μL primer mixture.

[0033] The PCR reaction conditions were as follows: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 sec, 60-55℃ annealing extension for 60 sec, 10 cycles, with the annealing extension temperature decreasing by 0.5℃ per cycle; 94℃ annealing for 20 sec, 55℃ annealing extension for 60 sec, 30 cycles.

[0034] After centrifugation, the PCR products were used to acquire fluorescence data using a FLUOstar Omega microplate reader, and Klustercaller software was used for data analysis, genotyping, and visualization.

[0035] The beneficial effects of this invention are:

[0036] The diagnostic KASP marker of this invention can be used to determine the presence of the Sr43 gene in advance, predict wheat resistance to stem rust, and perform genotyping based on the fluorescence type detected by the marker. This allows for the accurate screening of lines carrying the wheat stem rust resistance gene Sr43 for wheat breeding. This molecular marker can directly serve production practices, improve the breeding efficiency of the wheat stem rust resistance gene Sr43, accelerate the breeding process, and promote the application of this gene in wheat molecular breeding. Attached Figure Description

[0037] Figure 1 Development and sequence information of the molecular marker Sr43-KASP.

[0038] Figure 2 Genotypic and phenotypic data of the molecular marker Sr43-KASP in wheat-long spike lycine short fragment translocation lines; "+" indicates carrying the Sr43 gene, and "-" indicates not carrying the Sr43 gene.

[0039] Figure 3 Molecular marker Sr43-KASP in the backcross BC2F of RJimai22 and the US wheat variety Jagger 2:3 The genotyping of the population. “A / A” indicates a homozygous Sr43 resistant haplotype, “A / T” indicates a heterozygous Sr43 resistant haplotype, and “T / T” indicates a homozygous Sr43 susceptible haplotype. Detailed Implementation

[0040] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0041] As mentioned earlier, the highly pathogenic fungus Ug99 of wheat stem rust causes the loss of resistance to multiple stem rust resistance genes, including Sr31, posing a significant threat to wheat production. The Sr43 gene Ug99 from *Thinopyrum elongatum* and its derived races exhibit high resistance and are of significant research value.

[0042] However, since the Sr43 gene originates from wheat's close relative, *Thinopyrum longicornis*, only some homologous sequences can be found in wheat, and there are significant differences between these sequences. It is difficult to find suitable sequences for editing and development, which brings great difficulties to marker development. Currently, there are no reports of diagnostic molecular markers for this gene.

[0043] In view of this, this invention, by comparing the relatively conserved gene coding regions of 50 homologous genes from 18 common wheat varieties with the Sr43 gene sequence, ultimately discovered that only the 9178th base in the Sr43 nucleotide sequence exhibits a specific polymorphism with the wheat chromosome D set, thus avoiding amplification of the marker on the wheat chromosomes A and B. Figure 1 Furthermore, the number of SNPs near this site is relatively small, so developing markers in this region can ensure the amplification efficiency of primers.

[0044] To enable those skilled in the art to better understand the technical solution of this application, the technical solution of this application will be described in detail below with reference to specific embodiments.

[0045] The test materials used in the embodiments of this invention are all conventional test materials in the art and can be purchased through commercial channels. Experimental methods without specified detailed conditions are performed according to conventional test methods or the supplier's recommended operating instructions.

[0046] Example 1: Development of a diagnostic KASP marker for specific detection of wheat stem rust resistance gene Sr43

[0047] Using the sequence information of the Sr43 gene (Gene ID: ON237711.1) in the NCBI database, wheat homologous sequences of Sr43 were screened in the WheatOmics database (http: / / 202.194.139.32 / ) using the BLAST sequence alignment tool. After finding homologous sequences, DNAMAN software was used for proportion analysis to explore SNP differences among resistance and susceptibility homologous genes.

[0048] A SNP difference was found at the 9178th base in the Sr43 gene sequence, which is A in the Sr43 resistance haplotype and T in the disease-susceptible haplotype. This difference can be used for the development of diagnostic markers for Sr43.

[0049] Based on this SNP, this invention further developed and designed a diagnostic KASP marker specifically for detecting the wheat stem rust resistance gene Sr43, specifically as follows:

[0050] Using Primer3 v4.1.0 online primer design software ( https: / / bioinfo.ut.ee / primer3- 0.4.0 / Primer design was carried out.

[0051] The KASP-labeled primer sequence combination is as follows:

[0052] Sr43-KASP-FAM: The underlined part is the FAM fluorescent tag sequence.

[0053] 5'- GAAGGTGACCAAGTTCATGCT GCTTGTTGATATCGTCAGTTTTCTA-3'; (SEQ ID No. 2)

[0054] Sr43-KASP-HEX: The underlined part is the HEX fluorescent tag sequence.

[0055] 5'- GAAGGTCGGAGTCAACGGATT GCTTGTTGATATCGTCAGTTTTCTT-3'; (SEQ ID No. 3)

[0056] Sr43-KASP-R: 5'-AATGCATCCCGGATTTGTTT-3'. (SEQ ID No.4)

[0057] The primers were dissolved in sterile ultrapure water to 100 μM, and then mixed in a volume ratio of upstream genotyping primer Sr43-KASP-FAM: upstream genotyping primer Sr43-KASP-HEX: downstream universal primer Sr43-KASP-R = 2:2:5. The mixture was stored at -20℃ for later use.

[0058] Example 2: Genotypic and phenotypic identification of resistance to stem rust in different wheat materials

[0059] 1. Test method:

[0060] Four wheat materials were selected: K2620, RJimai22, K11463, and SN2-16. Among them, K2620 carries the Sr43 gene in the genetic background of the wheat variety 'Marquis'; K11463 does not carry the Sr43 gene in the genetic background of the wheat variety 'Thatcher'; Rjimai22 carries the Sr43 gene in the genetic background of Jimai 22; and SN2-16 carries a short fragment of wheatgrass in the genetic background of the wheat variety Chinese Spring, but does not carry the Sr43 gene.

[0061] (1) Genotyping:

[0062] DNA was extracted from wheat materials K2620, RJimai22, K11463, and SN2-16, and genotyping was performed using the Sr43-KASP marker primer combination (SEQ ID No. 2-SEQ ID No. 4) developed in Example 1. Details are as follows:

[0063] 1) Genomic DNA was extracted from the samples using the CTAB method;

[0064] The specific steps for extracting DNA from wheat samples using the CTAB method are as follows:

[0065] For the materials used above, wheat leaves of 2-3 cm were cut at the 2-leaf stage and placed in 2 mL centrifuge tubes. After being frozen in liquid nitrogen, the leaves were quickly ground into powder. 650 μL of preheated CTAB extraction buffer (65°C) was added, and the mixture was incubated at 65°C for 45 min. Then, 300 μL of chloroform:isoamyl alcohol (24:1, V:V) was added, and the mixture was slowly mixed and allowed to stand for 15 min, with 2-3 slow mixing cycles. After centrifugation at 12000 rpm for 10 min, 450 μL of the supernatant was extracted. An equal volume of ice-cold isopropanol was added, and the mixture was incubated at 4°C for 30 min or overnight. Subsequently, the mixture was centrifuged at 12000 rpm for 45 min, the supernatant was discarded, and the precipitate was genomic DNA. After washing twice with 500 μL of 70% ethanol and drying, the precipitate was dissolved in TE buffer or sterile water and diluted to a concentration of 20 ng / μL. The precipitate was then stored at low temperature for later use.

[0066] 2) PCR amplification;

[0067] The PCR reaction system used was as follows: 2 μL DNA template, 1.94 μL 2×KASP Master Mix, and 0.06 μL primer mixture.

[0068] The PCR reaction conditions used were: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 sec, 60-55℃ annealing extension for 60 sec, 10 cycles, with the annealing extension temperature decreasing by 0.5℃ per cycle; 94℃ annealing for 20 sec, 55℃ annealing extension for 60 sec, 30 cycles.

[0069] PCR products can be stored at room temperature, but need to be protected from light.

[0070] 3) KASP tagging result analysis.

[0071] After centrifugation, the PCR products were used to acquire fluorescence data using a FLUOstar Omega microplate reader, and Klustercaller software was used for data analysis, genotyping, and visualization.

[0072] (2) Phenotypic identification:

[0073] Spores of the wheat stem rust fungus (TPMKC (isolate 74MN1409)) were preserved at -80℃. Before use, they were removed and heat-shocked in a 42℃ water bath for 6 minutes, then suspended in Soltrol 170 mineral oil for inoculation. Wheat was inoculated at the two-leaf stage. After inoculation, the spores were placed outdoors for 30 minutes to allow the mineral oil to evaporate completely, then transferred to a 100% humidity incubator and incubated in the dark at 24℃ for 16 hours. Following this, they were treated with light for 4 hours and then transferred to a plant culture incubator at 21±4℃. Phenotypic identification was performed 12-14 days post-inoculation. The susceptible wheat variety Morocco was used as a susceptible control.

[0074] 2. Test Results:

[0075] The results of genotypic and phenotypic identification of wheat materials are as follows: Figure 2 As shown, the results indicate that the genotype detection results of the molecular marker Sr43-KASP are consistent with the situation of wheat materials carrying the Sr43 gene; the identification results of genotype and stem rust resistance phenotype are also consistent.

[0076] Example 3: Detection of Sr43 gene and identification of stem rust resistance in wheat backcross populations

[0077] 1. Test method:

[0078] The Sr43-KASP marker primer combination (SEQ ID No. 2-SEQ ID No. 4) developed in Example 1 was used to backcross BC2F of RJimai22 and the American wheat variety Jagger. 2:3 The Sr43 gene was detected and stem rust resistance was identified in 94 individual plants from the population. The detection and identification methods were the same as in Example 2.

[0079] 2. Test Results:

[0080] The results are shown in Table 1 and... Figure 3 .

[0081] Table 1: BC2F of RJimai22 and Jagger 2:3 Molecular marker Sr43-KASP genotype and stem rust resistance phenotype in the population

[0082]

[0083]

[0084]

[0085] Note: In the table, genotype R represents the homozygous resistant genotype of Sr43 (A / A); H represents the heterozygous resistant genotype of Sr43 (A / T); S represents the homozygous susceptible genotype of Sr43 (T / T); NTC represents the negative water control, without PCR amplification.

[0086] RJimai22 x Jagger crossover BC2F 2:3 Population testing results showed that both the homozygous (A / A) and heterozygous (A / T) types of Sr43 exhibited good resistance to wheat stem rust, while the susceptible (T / T) type showed high susceptibility to wheat stem rust. Therefore, the KASP marker of this invention can accurately diagnose the Sr43 gene.

[0087] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.

Claims

1. A SNP molecular marker associated with resistance to wheat stem rust, characterized in that, The nucleotide sequence of the SNP molecular marker is shown in SEQ ID No.

1. The 33rd base from the 5' end of the sequence shown in SEQ ID No. 1 is the SNP site, and its base is A or T.

2. The use of the reagent for detecting the SNP molecular marker of claim 1 in either (1) or (2) below: (1) To identify wheat resistance to stem rust; (2) Molecular marker-assisted breeding of wheat resistant to stem rust.

3. A KASP molecular marker primer combination for specifically detecting anti-stem rust genes Sr43 characterized in that include: The primers shown in SEQ ID No. 2, SEQ ID No. 3 and SEQ ID No.

4.

4. The use of the KASP molecular marker primer combination according to claim 3 in either (1) or (2) below: (1) To identify wheat resistance to stem rust; (2) Molecular marker-assisted breeding of wheat resistant to stem rust.

5. A method of identifying or assisting in the identification of wheat for resistance to stem rust, characterized in that, Includes the following steps: Genotyping of wheat samples based on specific SNP loci was performed, and the wheat's resistance to stem rust was determined according to the genotyping: haplotype was... AA Wheat is resistant to stem rust; haplotype is TT The wheat was susceptible to stem rust. The specific SNP site is the 33rd base from the 5' end of the sequence shown in SEQ ID No. 1, which is either A or T.

6. The method according to claim 5, characterized in that, The KASP molecular marker primer combination described in claim 3 was used to detect the genotyping of wheat based on specific SNP sites, as follows: Using the genomic DNA of the wheat to be tested as a template, PCR amplification was performed using a combination of KASP molecular marker primers. After centrifugation of the amplification products, fluorescence data were collected, and genotyping was performed based on the fluorescence data.

7. The method of claim 6, wherein, The PCR reaction system consisted of: 2 μL DNA template, 1.94 μL 2 × KASPMaster Mix, and 0.06 μL primer mixture as shown in SEQ ID No. 2, SEQ ID No. 3, and SEQ ID No.

4.

8. The method of claim 6, wherein, The PCR reaction conditions were as follows: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 sec, 60-55℃ annealing extension for 60 sec, 10 cycles, with the annealing extension temperature decreasing by 0.5℃ per cycle; 94℃ annealing for 20 sec, 55℃ annealing extension for 60 sec, 30 cycles.

Images