Application of CD40LG in promoting cell production and / or exosome release

Abstract

The invention relates to the technical field of biology, and provides application of CD40LG in promotion of cell production and / or exosome release. According to the invention, a lentiviral vector of an overexpressed CD40LG gene is constructed and is transfected with tumor cells, so that the tumor cell strain capable of stably expressing CD40LG is finally obtained. Through extraction and detection, the cell strain obviously improves the yield of the exosome in unit cell and unit culture medium volume, the yield of the exosome is obviously improved, proliferation of cancer cells can be inhibited, and the cancer cells can be effectively immunized and killed.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular, relates to the use of CD40LG in promoting cells to produce and / or release exosomes. Background Art

[0002] Tumors have become the leading cause of mortality worldwide. Tumor treatments are mainly based on surgery and chemotherapy, which are prone to recurrence and anti-tumor drugs damage normal cells and produce side effects. Therefore, there is an urgent need to find new methods to accurately treat tumors. Currently, researchers have developed a variety of drug carriers including hydrogels, liposomes, micelles, etc., but there are problems such as low drug targeting, easy clearance by the immune system, and poor delivery efficiency. This limits clinical application.

[0003] Exosomes are extracellular vesicles with a size between 30 and 150 nanometers. They originate from endosomes formed during cellular endocytosis. Exosomes contain a variety of biological components, such as proteins, lipids, and nucleic acids. These characteristics give exosomes the advantages of good biocompatibility, high stability, and low immunogenicity. Exosomes can efficiently deliver drugs into cells or tissues across a variety of biological barriers, making them ideal drug delivery carriers. With the development of genetic engineering, engineered exosomes can take advantage of their unique nanoscale size, biodegradability, low immunogenicity, strong cargo-carrying capacity, and ability to cross biological barriers to achieve precise targeting and efficient delivery of tumor treatment. Through gene editing, surface modification and other technical means, engineered exosomes can be endowed with specific targeting capabilities and therapeutic functions, thereby achieving precise attacks on tumor cells.

[0004] CD40LG, also known as CD154 or TNFSF5, is a 39kDa type II transmembrane protein that is mainly expressed in activated T cells, activated B cells, activated natural killer (NK) cells, etc. It is the homologous ligand of CD40 and plays a key role in immune response. CD40LG activates antigen-presenting cells (such as dendritic cells and B cells) by binding to CD40 on the surface of these cells and promotes their maturation, differentiation, and cross-presentation of antigens. It enhances the body's ability to recognize and eliminate tumor cells. The activation of CD40LG can induce live immune cells and trigger a strong anti-tumor immune response. These immune cells can directly kill tumor cells or release cytokines to inhibit tumor growth.

[0005] Therefore, using genetic engineering to make exosomes overexpress CD40LG and activate immunity provides a new theoretical basis for exploring the use of exosomes to treat tumors, which is of great value. Summary of the invention

[0006] The present invention aims to solve at least one of the technical problems existing in the prior art to at least some extent. To this end, the present invention provides the use of CD40LG in promoting cells to produce and / or release exosomes.

[0007] The present invention is accomplished based on the following findings of the inventors:

[0008] At present, the number of exosomes produced and / or released in tumor cells is relatively small, and the effect of a small number of exosomes on tumor immunotherapy and immunoregulation is not significant. In order to overcome this problem, the present application surprisingly found that a lentiviral vector overexpressing the CD40LG gene was constructed and transfected into tumor cells, which can obtain a tumor cell line stably expressing CD40LG and increase the expression of exosomes in tumor cells, thereby improving the effect of tumor immunotherapy and immunoregulation.

[0009] In the first aspect of the present invention, the present invention proposes the use of CD40LG in promoting cells to produce and / or release exosomes. According to an embodiment of the present invention, stably expressing CD40LG in cells can increase the exosome yield per unit cell and per unit culture medium volume, and increase the yield of exosomes.

[0010] In the second aspect of the present invention, the present invention proposes the use of a reagent in preparing a kit. According to the use of an embodiment of the present invention, the reagent is used to regulate the expression or activity of CD40LG, and the kit is used to regulate the production and / or release of exosomes in cells. As mentioned above, stable expression of CD40LG in cells can increase the exosome yield per unit cell and per unit culture medium volume, and increase the production of exosomes. Therefore, the reagent that regulates the expression or activity of CD40LG can further regulate the production and / or release of exosomes in cells.

[0011] In the third aspect of the present invention, the present invention proposes the use of an agent in the preparation of a drug. According to the use of an embodiment of the present invention, the agent is used to promote the expression or activity of CD40LG in tumor cells, and the drug is used to treat or prevent cancer or to increase the immune killing effect on tumor cells.

[0012] In a fourth aspect of the present invention, the present invention provides a method for regulating the production and / or release of exosomes by cells. According to an embodiment of the present invention, the method comprises: contacting an agent with the cells to be treated, wherein the agent is used to regulate the expression or activity of CD40LG. According to the method of an embodiment of the present invention, the yield of exosomes produced and / or released by tumor cells can be increased.

[0013] Additional aspects and advantages of the present invention will be given in part in the following description and in part will be obvious from the following description, or will be learned through practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] The above and / or additional aspects and advantages of the present invention will become apparent and easily understood from the description of the embodiments in conjunction with the following drawings, in which:

[0015] Figure 1 The schematic diagram of the structure of the basic carrier LV3 in Example 1 of the present invention is shown;

[0016] Figure 2 The schematic diagram of the structure of the recombinant lentiviral vector in Example 1 of the present invention is shown;

[0017] Figure 3 shows a light microscopic image (10X) of mouse colon cancer cells in Example 2 of the present invention;

[0018] Figure 4 The flow fluorescence image of CT26 cells transfected with LV3 lentivirus in Example 2 of the present invention is shown;

[0019] Figure 5 A schematic diagram of the process of extracting exosomes in Example 3 of the present invention is shown;

[0020] Figure 6 The electron micrographs of CD40LG EVs in Example 3 of the present invention are shown, wherein Figure A shows exosomes extracted from common tumor cells, Figure B shows exosomes extracted from cells overexpressing CD40LG, and there is no significant difference between the exosomes extracted from cells overexpressing OVA and the control group, which is consistent with the structure of exosomes;

[0021] Figure 7 The figure shows the results of particle size analysis of CD40LG EVs in Example 3 of the present invention.

[0022] Figure 8 The result of the test of the number of exosome particles extracted in Example 3 of the present invention is shown, wherein:

[0023] Figure A shows the number of particles in the Control group after 10-fold dilution.

[0024] Panel B shows the number of particles in the CD40LG EVs group at 20-fold dilution;

[0025] Fig. 9 The Western blot result of the expression of CD40LG protein in exosomes in Example 3 of the present invention is shown;

[0026] Fig.10 The fluorescence detection results of mouse colon cancer cells taking up two types of exosomes in Example 3 of the present invention are shown;

[0027] Fig.11 The figure shows the result of two exosomes in Example 3 of the present invention inhibiting the proliferation of mouse colon cancer cells. DETAILED DESCRIPTION

[0028] The embodiments of the present invention are described in detail below. The embodiments described below are exemplary and are only used to explain the present invention, and should not be construed as limiting the present invention.

[0029] It should be noted that the terms "first" and "second" are used for descriptive purposes only and should not be understood as indicating or implying relative importance or implicitly indicating the number of the indicated technical features. Therefore, the features defined as "first" and "second" may explicitly or implicitly include one or more of the features. Further, in the description of the present invention, unless otherwise specified, the meaning of "plurality" is two or more.

[0030] In this document, the terms “contain”, “include” or “comprise” are open expressions, that is, they include the contents specified in the present invention but do not exclude other contents.

[0031] As used herein, the terms "optionally", "optional" or "optionally" generally mean that the subsequently described event or circumstance may but need not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.

[0032] The present invention proposes the use of CD40LG in promoting cells to produce and / or release exosomes, the use of the reagent in preparing a kit, the use of the reagent in preparing a drug, and a method for regulating cells to produce and / or release exosomes, which will be described in detail below.

[0033] Use of CD40LG in promoting cell production and / or release of exosomes

[0034] In the first aspect of the present invention, the present invention proposes the use of CD40LG in promoting cells to produce and / or release exosomes. According to an embodiment of the present invention, stably expressing CD40LG in cells can increase the exosome yield per unit cell and per unit culture medium volume, and increase the yield of exosomes.

[0035] According to an embodiment of the present invention, the nucleotide sequence of CD40LG is as shown in SEQ ID NO: 1 or a nucleotide sequence obtained by deleting, replacing, inserting, inverting or misplacing one or more bases in the sequence shown in SEQ ID NO: 1.

[0036] (SEQ ID NO:1)。

[0037] It should be noted that the "nucleic acid" described in the present application can be any polymer containing deoxyribonucleotides or ribonucleotides, including but not limited to modified or unmodified DNA and RNA, and its length is not subject to any special restrictions. For constructs used to construct recombinant cells, it is preferred that the nucleic acid is DNA, because DNA is more stable and easy to operate compared to RNA. The "nucleic acid" described in the present application actually includes any one or two of the complementary double strands. For convenience, in this specification and claims, although only one strand is given in most cases, the other strand complementary to it is actually disclosed. For example, mentioning SEQ ID NO: 1 actually includes its complementary sequence. Those skilled in the art can also understand that one strand can be used to detect another strand, and vice versa.

[0038] The "construct" described in the present application refers to a genetic vector that contains a specific nucleic acid sequence and can transfer the target nucleic acid sequence into a host cell to obtain a recombinant cell. The form of the construct is not particularly limited. According to an embodiment of the present invention, it can be at least one of a plasmid, a phage, an artificial chromosome, a cosmid, a virus, and a viral vector, preferably a virus or a viral vector, and those skilled in the art can select as needed.

[0039] According to an embodiment of the present invention, the cell is a tumor cell.

[0040] According to an embodiment of the present invention, the tumor cells include at least one of colon cancer cells, breast cancer cells, melanoma cells, liver cancer cells, prostate cancer cells, and bladder cancer cells.

[0041] According to an embodiment of the present invention, the breast cancer cells include luminal B-type breast cancer cells.

[0042] According to some specific embodiments of the present invention, the tumor cells are colon cancer cells.

[0043] Use of reagents in preparing kits

[0044] In the second aspect of the present invention, the present invention proposes the use of a reagent in preparing a kit. According to an embodiment of the present invention, the reagent is used to regulate the expression or activity of CD40LG, and the kit is used to regulate the production and / or release of exosomes in cells. As mentioned above, stable expression of CD40LG in cells can increase the exosome yield per unit cell and per unit culture medium volume, and increase the production of exosomes. Therefore, the reagent that regulates the expression or activity of CD40LG can further regulate the production and / or release of exosomes in cells.

[0045] According to an embodiment of the present invention, the reagent is used to promote the expression or activity of CD40LG, and the kit is used to promote the production and / or release of exosomes in cells.

[0046] According to an embodiment of the present invention, the reagent includes at least one of a viral vector and a virus for overexpressing CD40LG.

[0047] According to an embodiment of the present invention, the virus includes at least one of a lentivirus and an adenovirus.

[0048] According to an embodiment of the present invention, the viral vector includes retrovirus, lentivirus, adenovirus and other enveloped virus vectors.

[0049] According to an embodiment of the present invention, the viral vector is a lentiviral vector.

[0050] According to an embodiment of the present invention, the reagent is used to inhibit the expression or activity of CD40LG, and the kit is used to inhibit the production and / or release of exosomes in cells.

[0051] According to an embodiment of the present invention, the reagent includes siRNA for inhibiting the expression of CD40LG.

[0052] According to an embodiment of the present invention, the nucleotide sequence of the target site targeted by the siRNA is shown in SEQ ID NO:2.

[0053] ttgctgtgtatcttcatagaaga (SEQ ID NO: 2).

[0054] Use of reagents in the preparation of drugs

[0055] In the third aspect of the present invention, the present invention proposes the use of an agent in preparing a drug. According to an embodiment of the present invention, the agent is used to promote the expression or activity of CD40LG in tumor cells, and the drug is used to treat or prevent cancer or to increase the immune killing effect on tumor cells.

[0056] According to an embodiment of the present invention, the reagent includes at least one of a viral vector and a virus for overexpressing CD40LG.

[0057] Methods for regulating cell production and / or release of exosomes

[0058] In a fourth aspect of the present invention, the present invention provides a method for regulating the production and / or release of exosomes by cells. According to an embodiment of the present invention, the method comprises: contacting a reagent with the cells to be treated, wherein the reagent is used to regulate the expression or activity of CD40LG. According to the method of an embodiment of the present invention, the yield of exosomes produced and / or released by cells can be increased.

[0059] According to an embodiment of the present invention, the cell is a tumor cell.

[0060] According to an embodiment of the present invention, the tumor cells include at least one of colon cancer cells, breast cancer cells, melanoma cells, liver cancer cells, prostate cancer cells, and bladder cancer cells.

[0061] According to an embodiment of the present invention, the breast cancer cells include luminal B-type breast cancer cells.

[0062] According to some specific embodiments of the present invention, the tumor cells are colon cancer cells.

[0063] According to an embodiment of the present invention, the reagent is used to promote the expression or activity of CD40LG, and the reagent includes at least one of a viral vector and a virus for overexpressing CD40LG.

[0064] According to an embodiment of the present invention, the reagent is used to inhibit the expression or activity of CD40LG, and the reagent includes siRNA for inhibiting the expression of CD40LG.

[0065] According to an embodiment of the present invention, the nucleotide sequence of the target site targeted by the siRNA is shown in SEQ ID NO:2.

[0066] According to an embodiment of the present invention, the culture medium used to culture the cells is serum-free 1640 culture medium.

[0067] According to an embodiment of the present invention, the method for producing and / or releasing exosomes is as follows: selecting mouse colon cancer cells transfected with a recombinant lentiviral vector in the P3 generation logarithmic growth phase, and when the cell confluence is 70% to 80%, continuing to culture with serum-free 1640 medium, ultracentrifuging, and obtaining exosomes.

[0068] Herein, the "cell confluence" refers to the percentage of the surface area covered by the cell layer in the culture container during the cell culture process.

[0069] The present invention exemplarily uses the LV3 vector as the basic vector to construct a lentiviral vector that overexpresses the CD40LG gene, transfects tumor cells with it, and obtains a CD40LG cell line that stably expresses. Through exosome extraction and detection, the cell line significantly improves the exosome yield per unit cell and per unit culture medium volume, and the exosome production is improved. In addition, the present invention purifies and separates exosomes through the GFP tag carried by the lentivirus, which solves the defects of traditional methods to a certain extent and promotes the scientific research and clinical level of tumor cell exosomes.

[0070] Tumor cells

[0071] In a fifth aspect of the present invention, the present invention provides a tumor cell. According to an embodiment of the present invention, CD40LG is overexpressed in the tumor cell. According to the tumor cell of the embodiment of the present invention, the production of exosomes can be increased.

[0072] CD40LG is mainly expressed in activated T cells, activated B cells, activated natural killer (NK) cells, etc. It is the homologous ligand of CD40 and plays a key role in immune response. CD40LG activates these cells and promotes their maturation, differentiation and cross-presentation of antigens by binding to CD40 on the surface of antigen-presenting cells (such as dendritic cells and B cells). It enhances the body's ability to recognize and eliminate tumor cells. The activation of CD40LG can induce live immune cells and trigger a strong anti-tumor immune response. These immune cells can directly kill tumor cells or release cytokines to inhibit tumor growth.

[0073] Overexpression of CD40LG increases the production of exosomes, possibly due to its ability to activate intracellular signaling pathways and / or change cell metabolism. When CD40LG is overexpressed, it binds to CD40 more frequently and strongly, thereby activating more intracellular signaling pathways. These signaling pathways include NF-κB, MAPK, etc., which play a key role in the production and secretion of exosomes. Activated signaling pathways can promote the biosynthesis and secretion of exosomes, thereby increasing the production of exosomes. When CD40LG is overexpressed, it may affect cell metabolism and overreaction. Under such conditions, cells will initiate a series of protective mechanisms, thereby increasing the production of exosomes.

[0074] According to an embodiment of the present invention, the tumor cells are selected from at least one of colon cancer cells, breast cancer cells, melanoma cells, liver cancer cells, prostate cancer cells, and bladder cancer cells.

[0075] According to an embodiment of the present invention, the tumor cell is at least one of a colon cancer cell, a breast cancer cell, and a melanoma cell.

[0076] According to an embodiment of the present invention, the breast cancer cells include luminal B-type breast cancer cells.

[0077] According to an embodiment of the present invention, the tumor cells are colon cancer cells.

[0078] According to an embodiment of the present invention, the colon cancer cells overexpressing CD40LG are prepared by the following method: constructing a recombinant lentivirus overexpressing CD40LG and mouse colon cancer cells.

[0079] Specifically, the tumor cells overexpressing the CD40LG gene of the present invention are prepared by the following method:

[0080] Using pLV3 vector as the basic vector, a recombinant plasmid pLV3-CD40LG overexpressing the CD40LG gene was constructed. The recombinant lentivirus was packaged by transfecting 293T cell lines and named LV3-CD40LG. The recombinant lentivirus LV3-CD40LG was transfected into tumor cells to obtain a tumor cell line stably expressing CD40LG.

[0081] The present invention also provides a method for preparing the above-mentioned tumor cells overexpressing the CD40LG gene, which is prepared by the following method:

[0082] Using pLV3 vector as the basic vector, a recombinant plasmid pLV3-CD40LG overexpressing the CD40LG gene was constructed and transfected into 293T cell lines to obtain a recombinant lentivirus named LV3-CD40LG. The recombinant lentivirus LV3-CD40LG was transfected into tumor cells to obtain a cell line stably expressing CD40LG.

[0083] According to an embodiment of the present invention, the CD40LG gene is the nucleotide sequence shown in SEQ ID NO: 1, or a nucleotide sequence obtained by deleting, replacing, inserting, inverting and ectopic one or more bases of the sequence shown in SEQ ID NO: 1.

[0084] According to an embodiment of the present invention, the lentivirus is LV3.

[0085] In the present invention, the recombinant lentivirus overexpressing the CD40LG gene is constructed, named pLV3-CD40LG, and is transfected into tumor cells to screen and obtain tumor cell lines that highly express CD40LG.

[0086] The present invention uses pLV3 vector as a basic vector, constructs a recombinant plasmid of overexpressed CD40LG gene, pLV3-CD40LG, transfects 293T cell line to package to obtain recombinant lentivirus, named LV3-CD40LG, transfects the recombinant lentivirus LV3-CD40LG into tumor cells, and obtains a CD40LG cell line with stable expression. The cell line is tested to significantly increase the exosome yield per unit cell and per unit culture medium volume, and the exosome yield is significantly increased.

[0087] According to an embodiment of the present invention, the CD40LG overexpression is achieved by at least one of the following methods: viral / non-viral vector-mediated gene / mRNA transfection technology, transposase or recombinase-mediated gene integration, and CRISPR / CAS system-based gene editing or transcriptional activation.

[0088] According to an embodiment of the present invention, the gene / mRNA transfection technology is not particularly limited and is achieved by utilizing at least one of the following methods: liposome or LNP-mediated transfection, calcium phosphate-mediated transfection, cationic transfection agent-mediated transfection, virus-like particle VLP-mediated transfection, electroporation transfection, lentiviral vector for gene delivery, adeno-associated virus vector for gene delivery, adenoviral vector for gene delivery and Sendai virus vector for gene delivery.

[0089] The scheme of the present invention will be explained below in conjunction with the embodiments. It will be appreciated by those skilled in the art that the following embodiments are only used to illustrate the present invention and should not be considered as limiting the scope of the present invention. Where specific techniques or conditions are not indicated in the embodiments, the techniques or conditions described in the literature in this area or the product specifications are used. The reagents or instruments used are not indicated by the manufacturer and are all conventional products that can be obtained commercially.

[0090] Example 1: Construction of CD40LG lentivirus

[0091] The CD40LG gene shown in SEQ ID NO: 1 was cloned according to the NCBI (National Center for Biotechnology Information) CD40LG gene sequence information (Gene ID: 959) and the CD40LG gene was cloned as shown in SEQ ID NO: 1. Figure 1 The pLV3 shown in the figure was used as the basic vector to construct the recombinant vector pLV3-CD40LG containing the CD40LG gene, and the recombinant vector pLV3-CD40LG was packaged by transfecting 293T cell lines to generate the Figure 2 LV3-CD40LG lentivirus as indicated.

[0092] Example 2: Preparation of tumor cells stably expressing CD40LG

[0093] The lentivirus LV3-CD40LG constructed in Example 1 was transfected into mouse colon cancer cells (Biyuntian Biotechnology Co., Ltd., catalog number: C7295) (virus infection multiplicity MOI value: 20-100) to obtain tumor cells overexpressing the CD40LG gene, which were cultured in 1640 medium, the growth of tumor cells was observed, and the expression of CD40LG was detected by flow cytometry. The detection method is a routine operation in the art and will not be described here. The results are as follows Figure 3 and Figure 4 As shown, it is shown that the cell viability cultured in the present invention is higher than 90%, and the normal expression of CD40LG fluorescence is detected by flow cytometry.

[0094] Example 3: Extraction and identification of exosomes from tumor cells

[0095] 3.1 Extraction of exosomes from tumor cells:

[0096] Tumor cells in the logarithmic growth phase of P3 (Control group) and tumor cells overexpressing CD40LG constructed in Example 2 (CD40LG EVs group) were selected for culture and exosomes were extracted.

[0097] The specific method is as follows: Use 1640 complete medium to culture cells. When the cell confluence reaches 70% to 80%, wash the cells with PBS to remove exosomes in the serum. Use serum-free 1640 complete medium for 48 hours, and then separate and extract exosomes by ultracentrifugation. Take 100mL of cell culture supernatant and centrifuge at 300g for 10 minutes to remove cells, centrifuge at 2000g for 10 minutes to remove cell debris, and then centrifuge at 10000g for 30 minutes to remove apoptotic bodies. Finally, centrifuge at 100000g for 70 minutes to discard the supernatant, collect the precipitate and resuspend it with 1mL PBS, then centrifuge at 100000g for 70 minutes to discard the supernatant, and finally resuspend it with 200μL sterile PBS to obtain exosomes, and store them at -80℃ after aliquoting. The flow chart is as follows Figure 5 shown.

[0098] 3.2 Electron microscopy detection of tumor cell-derived exosomes

[0099] The extracted exosomes were resuspended in 20-30 μL PBS, 10 μm was added to the copper grid of transmission electron microscope for precipitation for 5 min, the floating liquid was aspirated with filter paper, 10 μm of phosphotungstic acid counterstaining solution was added to the copper grid of transmission electron microscope for precipitation for 5 min, the floating liquid was aspirated with filter paper, and the mixture was dried at room temperature and then observed by the microscope.

[0100] Figure 6 The electron microscopy image showed that the size of exosomes was about 50 to 150 nm, and the exosomes were spherical in shape, indicating that there was no significant difference between the overexpressed CD40LG exosomes and the control group, which was consistent with the structure of exosomes.

[0101] 3.3 Analysis of the particle size of tumor cell-derived exosomes

[0102] The extracted exosomes were resuspended in 2 mL of PBS and placed in a Nano ZS90 Plus (Malvern, UK) for exosome size analysis. Figure 7 As shown, the particle size of the exosomes detected is between 60-100 nm, which corresponds to the size of the exosomes detected by TEM and is consistent with the particle size range of the exosomes.

[0103] 3.4 Detection of exosome particle number from tumor cells

[0104] The extracted exosomes were resuspended in 2 mL of PBS, and the control and CD40LG EVs groups were diluted 10 and 20 times, respectively, for nanoflow cytometry testing. This test is a routine operation in the field and will not be described here. Figure 8 As shown in the figure, the number of particles in the Control group was 5.33E+11Particles / mL when diluted 10 times; the number of particles in the CD40LG EVs group could reach 5.45E+11Particles / mL when diluted 20 times. The results showed that the number of exosome particles extracted from tumor cells in the CD40LG EVs group was significantly higher than that in the Control group.

[0105] 3.5 Western blot detection of tumor cell-derived exosomes

[0106] Add protein lysis buffer to the extracted exosome precipitate and place on ice for 10-20 minutes, shaking 4-6 times, 20-30 seconds each time. Then centrifuge at 4°C and 11000 rpm for 3-5 minutes, transfer the supernatant to a new centrifuge tube, and perform Western blot to detect CD40LG protein expression. The results are as follows: Fig. 9 The results showed that the expression of CD40LG protein could be detected in the CD40LG EVs group extracted by ultracentrifugation.

[0107] 3.6 Cellular exosome uptake experiment

[0108] The exosome fluorescent material Cy5 (Xi'an Qiyue Biotechnology, Q-0345731) was prepared and mixed with the exosomes extracted above to connect the dye to the exosomes. Then, the excess dye was washed away. A small amount of exosomes containing Cy5 fluorescent dye were added to the cultured tumor cells. The culture was continued for 1 to 4 hours. The supernatant was aspirated and washed 2 to 3 times with PBS. The cells were placed under an inverted fluorescence microscope for detection. The results were as follows: Fig.10 As shown, obvious red fluorescence signals of Cy5 fluorescent dye can be observed in exosomes overexpressing CD40LG compared with the control group.

[0109] 3.7 Effects of exosomes on tumor cell proliferation

[0110] Control and CD40LG EVs were co-cultured with mouse colon cancer cells in 1640 medium at 37°C and 5% CO2 incubator. The proliferation of mouse colon cancer cells at 24, 48, 72, and 96 h of culture was detected by CCK8 (Biyuntian Biotechnology Co., Ltd., C0037). The detection steps were carried out according to the instructions of the kit. Fig.11As shown, CD40LG EVs have an inhibitory effect on cancer cells. After 96 hours of co-culture, the survival rate of cancer cells in the CD40LG EVs group was only about 60%.

[0111] In the description of this specification, the description with reference to the terms "one embodiment", "some embodiments", "example", "specific example", or "some examples" etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described may be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art may combine and combine the different embodiments or examples described in this specification and the features of the different embodiments or examples, without contradiction.

[0112] Although the embodiments of the present invention have been shown and described above, it is to be understood that the above embodiments are exemplary and are not to be construed as limitations of the present invention. A person skilled in the art may change, modify, replace and vary the above embodiments within the scope of the present invention.

Claims

1. Use of CD40LG in promoting cells to produce and / or release exosomes.

2. The use according to claim 1, characterized in that The nucleotide sequence of CD40LG is as shown in SEQ ID NO: 1 or a nucleotide sequence obtained by deleting, replacing, inserting, inverting or misplacing one or more bases in the sequence shown in SEQ ID NO: 1; Preferably, the cells are tumor cells.

3. Use of a reagent in preparing a kit, wherein the reagent is used to regulate the expression or activity of CD40LG, and the kit is used to regulate the production and / or release of exosomes in cells.

4. The use according to claim 3, wherein the reagent is used to promote the expression or activity of CD40LG, and the kit is used to promote the production and / or release of exosomes in cells; Optionally, the reagent comprises at least one of a viral vector and a virus for overexpressing CD40LG.

5. The use according to claim 3, wherein the reagent is used to inhibit the expression or activity of CD40LG, and the kit is used to inhibit the production and / or release of exosomes in cells; Optionally, the reagent includes siRNA for inhibiting CD40LG expression; Optionally, the nucleotide sequence of the target site directed by the siRNA is as shown in SEQ ID NO:

2.

6. Use of an agent in the preparation of a drug, wherein the agent is used to promote the expression or activity of CD40LG in tumor cells, and the drug is used to treat and / or prevent cancer, or to increase the immune killing effect on tumor cells; Optionally, the reagent comprises at least one of a viral vector and a virus for overexpressing CD40LG.

7. A method for regulating cell production and / or release of exosomes, characterized in that: include: contacting the cells to be treated with an agent for regulating the expression or activity of CD40LG; Optionally, the cell is a tumor cell. 8 . The method according to claim 7 , wherein the agent is used to promote the expression or activity of CD40LG, and the agent comprises at least one of a viral vector and a virus for overexpressing CD40LG.

9. The method according to claim 7, wherein the reagent is used to inhibit the expression or activity of CD40LG, and the reagent comprises siRNA for inhibiting the expression of CD40LG; Optionally, the nucleotide sequence of the target site directed by the siRNA is as shown in SEQ ID NO:2.

Images