A method for detecting miRNA-21 based on catalytic combination of CHA circuit and CpAgo protein

Abstract

The application provides a method for detecting miRNA-21 based on the catalytic combination of CHA circuit and CpAgo protein, which comprises two DNA hairpins H1 and H2, wherein the 5' end of H1 is modified with a FAM fluorescent group, and the middle is modified with a BHQ1 quenching group. The target microRNA specifically triggers the DNA-based CHA, initiates the DNA circulation circuit and outputs a large amount of dsDNA, and at the same time releases the microRNA for the next circulation circuit, the H1 and H2 form dsDNA which is recognized by two guide chains and the CpAgo protein, forms a CpAgo-guide-dsDNA ternary complex, so that the dsDNA is cut, the fluorescent group and the quenching group are separated, and the high-sensitivity detection of the microRNA is realized. Finally, one-step and rapid detection of microRNA is realized, and the problems of high detection cost, long time, low sensitivity and the like in the prior art are improved.

Description

Technical Field

[0001] This invention belongs to the field of biodetection technology, specifically providing a method for detecting miRNA-21 based on the catalytic binding of CHA circuit and CpAgo protein. Background Technology

[0002] miRNA-21 is upregulated in various cancers and is associated with tumor etiology, progression, and prognosis, including brain cancer, liver cancer, prostate cancer, and lung cancer. Detecting miRNA-21 expression levels during cancer treatment helps assess patient prognosis and detect recurrence or drug resistance early. This provides a basis for developing personalized treatment plans and promotes the advancement of cancer therapy.

[0003] miRNAs are a class of short non-coding RNAs, typically only about 22 nucleotides long, making them prone to loss during extraction and detection. Furthermore, due to their small size, they are easily degraded by various internal and external factors. Low-abundance miRNA samples may not provide sufficient information for tumor diagnosis, leading to decreased diagnostic accuracy. The low abundance of tumor miRNA samples poses a challenge to tumor research and clinical diagnosis.

[0004] Traditional standard methods, such as quantitative real-time PCR (qRT-PCR), have limitations in detecting miRNA-21. For example, the difficulty in designing primers and probes affects the sensitivity of the results. Specificity depends on primer and probe design and may result in non-specific amplification and false positives.

[0005] Microarray technology immobilizes a large number of DNA probes on a microchip, and these probes are complementary to specific miRNA sequences. RNA from a sample is hybridized to the microchip, and the expression level of miRNA-21 is quantified by detecting the hybridization signal. This method has limited accuracy and is difficult to achieve absolute quantification. It is also costly and requires specialized equipment and technicians.

[0006] Northern blotting hybridization involves isolating RNA from a sample and transferring it onto a nylon membrane, where it is then hybridized with a labeled DNA probe. The expression level of miRNA-21 is qualitatively or quantitatively determined by detecting the hybridization signal. This method is cumbersome and time-consuming. It also has low sensitivity and may be inaccurate for detecting low-abundance miRNA-21.

[0007] Photoelectrochemical (PEC) detection technology quantifies miRNA-21 expression levels by constructing biosensors with photoelectric responses and utilizing the hybridization reaction of miRNA-21 with a specific probe to trigger changes in photoelectric signals. While offering advantages such as low cost, wide detection range, and low detection limits, this technology is still under development and may face issues related to stability and reproducibility. Furthermore, it requires specialized equipment and technical personnel to construct and operate the biosensors.

[0008] RNA sequencing involves high-throughput sequencing of RNA in a sample and quantifying miRNA-21 expression levels by comparing the sequencing results with a database of known miRNA sequences. This method is costly, requires specialized sequencing equipment and technicians, and involves complex data processing and analysis. It may be inaccurate for detecting low-abundance miRNA-21 and can be affected by sequencing depth and coverage.

[0009] Therefore, it is very important to develop a method for detecting miRNA-21 that is accurate, sensitive, low-cost, easy to operate, and rapid. Summary of the Invention

[0010] This invention provides a method for detecting miRNA-21 based on the catalytic binding of a CHA circuit and CpAgo protein. The detection method provided by this invention achieves the femtomolar detection limit and solves the problems of complex operation, high cost, long processing time, and low sensitivity in existing technologies.

[0011] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0012] A method for detecting miRNA-21 based on the catalytic binding of a CHA circuit and CpAgo protein includes the following steps:

[0013] S1. Extraction of miRNA nucleic acid from the sample to be tested;

[0014] S2, CHA-CpAgo reaction system preparation: Mix H1, H2, gDNA1, gDNA2, CpAgo protein, and 10×reaction buffer to prepare the CHA-CpAgo reaction mixture:

[0015] S3. Detection of target miRNA-21 using the CHA-CpAgo system: Add the miRNA extracted in step S1 to the CHA-CpAgo reaction system mixture prepared in step S2, and perform a constant temperature reaction to obtain the target miRNA.

[0016] Preferably, the miRNA in step S1 includes miRNA-21, and the nucleotide sequence of miRNA-21 is shown in SEQ ID NO.1.

[0017] 5'-UAGCUUAUCAGACUGAUGUUGA-3' (SEQ ID NO. 1);

[0018] Preferably, in step S2, the nucleotide sequence of H1 is shown in SEQ ID NO.2, the nucleotide sequence of H2 is shown in SEQ ID NO.3, the nucleotide sequence of gDNA1 is shown in SEQ ID NO.4, and the nucleotide sequence of gDNA2 is shown in SEQ ID NO.5.

[0019] H1: (SEQ ID NO.2);

[0020] H2: (SEQ ID NO.3);

[0021] gDNA1:5'-P-TCAGTCTACGGACTTAG-3' (SEQ ID NO.4);

[0022] gDNA2: 5'-P-AAGCTAAGTCCGTAGAC-3' (SEQ ID NO. 5).

[0023] The method provided by the present invention includes nucleotide sequences of two DNA hairpins H1 and H2 for detecting the catalytic hairpin assembly (CHA) of miRNA-21, and nucleotide sequences of two guide strands gDNA1 and gDNA2 in the CpAgo protein recognition system.

[0024] In the above sequence, " TCAACATCAGTCTGATAAGCTA "This refers to the complementary pairing of miRNA-21 and H1." The ring-shaped portion of H1 This represents the circular portion of H2. "*" indicates the CpAgo protease cleavage site.

[0025] H1 has a fluorescent reporter group FAM at its 5' end and a fluorescent quencher group BHQ1 at its 30th 5' end. H2 has a fluorescent reporter group FAM at its 3' end and a fluorescent quencher group BHQ1 at its 28th 5' end. In this case, the fluorescence emitted by the luminescent group at the 5' end is quenched due to its proximity to the quencher group, resulting in a fluorescence-quenched state.

[0026] Meanwhile, the first base at the 5' end of gDNA1 and the 5' end of gDNA2 in this invention are both phosphorylated.

[0027] Preferably, the working concentration range of H1 is 250-500 nM, the working concentration range of H2 is 250-500 nM, the working concentration range of gDNA1 is 150-250 nM, the working concentration range of gDNA2 is 150-250 nM, and the working concentration range of CpAgo protein is 2-10 nM.

[0028] Preferably, the preparation process of the 10×reaction buffer is as follows: MgCl2, KCl, Tris-HCl, DTT and Tween 20 are mixed so that the final concentration of MgCl2 is 45-55 mM, the final concentration of KCl is 550-650 mM, the final concentration of Tris-HCl is 500-600 mM, the final concentration of DTT is 8-15 mM, and the final concentration of Tween 20 is 0.01%.

[0029] Preferably, the isothermal reaction conditions in step S3 are 37℃~40℃, and the reaction time is 30-40 min.

[0030] The present invention also provides a kit for detecting miRNA-21, comprising CHA reaction mixture, CpAgo and DEPC (0.1%) water, wherein the CHA reaction mixture comprises H1, H2, gDNA1, gDNA2 and 10×reaction buffer.

[0031] Preferably, the nucleotide sequence of H1 is shown in SEQ ID NO.2, the nucleotide sequence of H2 is shown in SEQ ID NO.3, the nucleotide sequence of gDNA1 is shown in SEQ ID NO.4, and the nucleotide sequence of gDNA2 is shown in SEQ ID NO.5.

[0032] Preferably, the preparation process of the 10×reaction buffer is as follows: MgCl2, KCl, Tris-HCl, DTT and Tween 20 are mixed so that the final concentration of MgCl2 is 45-55 mM, the final concentration of KCl is 550-650 mM, the final concentration of Tris-HCl is 500-600 mM, the final concentration of DTT is 8-15 mM, and the final concentration of Tween 20 is 0.01%.

[0033] The technical principle of this invention is as follows (e.g.) Figure 1(As shown): When the target miRNA-21 is present, because the miRNA-21 sequence is complementary to the 5' end sequence of H1, a strand displacement reaction triggers the unwinding of the H1 stem. miRNA-21 binds to the 5' end of the hairpin H1, forming a miRNA-21-H1 structure. Subsequently, because the 5' end sequence of H2 is complementary to H1, a strand displacement reaction can displace miRNA-21, which then binds to H1 to form a stable H1-H2 double-stranded structure. The released miRNA-21 enters the next CHA cycle. When the system contains a guide strand gDNA that is completely base-paired with the H1-H2 double strand, gDNA1 matches H1, and gDNA2 matches H2, forming a CpAgo-gDNA-dsDNA ternary complex. This then induces the endonuclease activity of the CpAgo protein, cleaving the H1-H2 double strand between the 10th and 11th bases of the guide strand gDNA, separating the luminescent group from the quencher group, thus causing the luminescent group to emit a detectable fluorescent signal. As the number of amplification cycles increases, the released fluorescent groups accumulate continuously, so the fluorescence intensity is directly proportional to the amount of amplification products.

[0034] This invention combines a DNA-based catalytic hairpin assembly (CHA) circuit with a CpAgo protein recognition system to achieve one-step, rapid detection of microRNA under isothermal conditions at 40°C. In this method, two DNA hairpins (H1 and H2) are used, with H1 modified with a FAM fluorescent group at its 5' end and a BHQ1 quencher group in the middle. Target microRNA specifically triggers the DNA-based CHA, initiating a DNA cycling circuit and releasing a large amount of dsDNA. The released microRNA can then proceed to the next cycling circuit. The dsDNA formed by H1 and H2 is further recognized by two guide strands and the CpAgo protein, forming a CpAgo-guide-dsDNA ternary complex. This induces the endonuclease activity of the CpAgo protein, cleaving the dsDNA. The fluorescent and quencher groups separate, generating a fluorescent signal, thus achieving highly sensitive detection of microRNA. In this way, the developed method reaches the femtomolar detection limit. This improves upon existing technologies that suffer from complex operation, high cost, long processing time, and low sensitivity.

[0035] In summary, compared with the prior art, the technical advantages of the present invention are as follows:

[0036] (1) High specificity: Based on the design of H1 and H2 sequences, this invention will form a stable hairpin structure. When there is no target, gDNA1 and gDNA2 will not bind to H1 and H2, so no non-specific fluorescent signal will be generated. Moreover, CpAgo protein can only recognize double-stranded DNA to perform enzymatic cleavage. Only when the target is present can the hairpin be catalyzed to assemble into H1-H2 double-stranded DNA, which can be cleaved by CpAgo protein to generate a fluorescent signal.

[0037] (2) Wide detection range: It can detect the expression level of miRNA-21 in patients with various cancers such as brain cancer, liver cancer, prostate cancer and lung cancer;

[0038] (3) High sensitivity: In the hairpin assembly process of this invention, for each molecule of H1-H2 double-stranded DNA formed, one molecule of miRNA-21 is released as a template for the next CHA cycle. In addition, both hairpin H1 and hairpin H2 are labeled with fluorescent groups. When they are cleaved by CpAgo protein, they generate a stronger fluorescence amplification signal, reaching a detection limit of 5 fM.

[0039] (4) Short detection time: This invention is a constant temperature reaction, which does not require a complicated process of heating and cooling. Therefore, the detection time is short and 96 samples can be detected at the same time, with a large detection volume.

[0040] (5) Simple operation: One-step operation, only one tube of CHA-CpAgo reaction system is needed. After adding the sample to be tested, it can be tested on the machine. Attached Figure Description

[0041] Figure 1 This is a schematic diagram of the technical solution of the present invention;

[0042] Figure 2 To evaluate the results of miRNA-21 detection in serum samples from healthy individuals and lung cancer patients;

[0043] Figure 3 To compare the results of miRNA-21 detection in serum samples from healthy individuals and lung cancer patients in Group 1;

[0044] Figure 4 To compare the results of miRNA-21 detection in serum samples from healthy individuals and lung cancer patients in Group 2;

[0045] Figure 5 To evaluate the detection results of the group at different miRNA-21 sample concentrations;

[0046] Figure 6 The results of the comparison group 1 were obtained at different miRNA-21 sample concentrations;

[0047] Figure 7 The results of the comparison group 2 were obtained at different miRNA-21 sample concentrations. Detailed Implementation

[0048] The present invention will be further described below with reference to the accompanying drawings and specific embodiments. It should be noted that, without conflict, the various embodiments or technical features described below can be arbitrarily combined to form new embodiments. Unless otherwise specified, the raw materials, equipment, etc. used in the following embodiments can all be obtained through conventional means.

[0049] Example 1: Detection of miRNA-21 expression levels in serum samples from lung cancer patients

[0050] In this invention, the sequence of miRNA in the selected serum sample during detection is: 5'-UAGCUUAUCAGACUGAUGUUGA-3' (SEQ ID NO.1);

[0051] 1. First, the hairpin H1, H2, and guide strand gDNA1, gDNA2 sequences were designed. The sequence design was divided into an evaluation group and a control group. The sequence information for each group is as follows:

[0052] Evaluation Group:

[0053] H1: (SEQ ID NO.2);

[0054] H2: (SEQ ID NO.3);

[0055] gDNA1:5'-P-TCAGTCTACGGACTTAG-3' (SEQ ID NO.4);

[0056] gDNA2:5'-P-AAGCTAAGTCCGTAGAC-3' (SEQ ID NO.5);

[0057] Comparison Group 1:

[0058] H1b: (SEQ ID NO.6);

[0059] H2b: (SEQ ID NO.7);

[0060] gDNA1c:5'-P-TCAGTCTATTTACTTAG-3' (SEQ ID NO.8);

[0061] gDNA2c:5'-P-AAGCTAAGTAAATAGAC-3' (SEQ ID NO.9);

[0062] In the above sequence, " TCAACATCAGTCTGATAAGCTA "This refers to the complementary pairing of miRNA-21 and H1." The ring-shaped portion of H1 This represents the circular portion of H2. "*" indicates the CpAgo protease cleavage site.

[0063] Comparison Group 2:

[0064] H1: (SEQ ID NO.2);

[0065] H2: (SEQ ID NO.3);

[0066] gDNA1b:5'-P-ACATCAGTCTACGGACT-3' (SEQ ID NO. 10);

[0067] gDNA2b:5'-P-GATAAGCTAAGTCCGT-3' (SEQ ID NO. 11);

[0068] In the above sequence, " TCAACATCAGTCTGATAAGCTA "This refers to the complementary pairing of miRNA-21 and H1." The ring-shaped portion of H1 This represents the circular portion of H2. "*" indicates the CpAgo protease cleavage site.

[0069] Hairpins H1 and H2, and guide strands gDNA1 and gDNA2 were all synthesized by Beijing Qingke Biotechnology Co., Ltd., and purified by HPLC.

[0070] 2. Sample Processing: Serum samples were selected from 5 lung cancer patients and 5 healthy individuals. The samples were processed using a miRNA extraction kit (purchased from Yisheng Biotechnology (Shanghai) Co., Ltd., Serum / Plasma miRNA Extraction Kit). Nucleic acid extraction was performed using a Serum / Plasma miRNA Kit. The procedure was carried out in a biosafety cabinet.

[0071] 3. Preparation of the reaction system:

[0072] (1) Prepare a 10× reaction buffer according to the formula and concentration in Table 1:

[0073] Table 1 10×reaction buffer formulation

[0074]

[0075] (2) Prepare the CHA-CpAgo mixture according to the formula and concentration in Table 2 below:

[0076] Table 2. CHA-CpAgo Mixture Formulation

[0077]

[0078]

[0079] PCR testing: Add 10 μL of the extracted nucleic acid sample to the prepared CHA-CpAgo mixture (dispense 30 μL of the CHA-CpAgo mixture into 200 μL eight-tube arrays, then add 10 μL of the extracted nucleic acid sample to each tube). Perform the reaction on a Hongshi SLAN-96S fully automated medical PCR analysis system at an isothermal temperature of 37℃ for 30 minutes. Collect fluorescence data every minute, observe the changes in the fluorescence curve, and analyze the results.

[0080] 4. Experimental results: The fluorescence intensity results obtained from different blood sources and different sequences in this invention are shown in Table 3. Figures 2-4 The results of miRNA21 detection in serum samples from healthy individuals and lung cancer patients were obtained in the evaluation group, control group 1, and control group 2, respectively.

[0081] Table 3. Results of miRNA21 detection in serum samples from healthy individuals and lung cancer patients.

[0082]

[0083] From Table 3, Figures 2-4 The results showed that in the evaluation group, the fluorescence signal was low in serum samples from healthy individuals, while it was high in serum samples from lung cancer patients. There was a clear distinction between the healthy and lung cancer patient samples, and the expression level of miRNA-21 in lung cancer patient serum samples was higher than that in healthy individuals. In control group 1, the sequences of the hairpin DNA and gDNA were adjusted, and the fluorescence signals in both healthy and lung cancer patient serum samples were low, indicating low catalytic hairpin assembly efficiency. In control group 2, the sequence of the guide strand gDNA was adjusted, and the restriction enzyme site of the cpAgo protein was changed. Normal fluorescence signals were observed in healthy serum samples; however, the fluorescence intensity in lung cancer patient serum samples was lower than that in the evaluation group, and the fluorescence signal did not show a clear distinction from that of healthy individuals. This demonstrates that the hairpin DNA and guide strand gDNA sequences designed in this invention can accurately detect the expression level of miRNA-21 in serum samples from lung cancer patients.

[0084] 5. Further detection was performed on miRNA-21 samples at different concentrations. The miRNA-21 samples were diluted to 0fM, 1fM, 5fM, 50fM, 1pM, 10pM, 500pM, 1nM, and 10nM, respectively. The remaining procedures were the same as above. The fluorescence intensity of the evaluation group, control group 1, and control group 2 was detected.

[0085] 6. Test Results: The test results are shown in Table 4, and Figures 5-7 The fluorescence signals of the evaluation group, control group 1, and control group 2 at different sample concentrations are shown respectively.

[0086] Table 4. Detection results of miRNA21 samples at different concentrations

[0087]

[0088] from Figures 5-7 As shown in Table 4, the evaluation group exhibited low fluorescence background in samples with a concentration of 0 fM miRNA-21; samples with a concentration of 1 fM miRNA-21 showed low fluorescence with no significant distinction from negative samples; samples with concentrations of 5 fM to 10 nM miRNA-21 showed fluorescence intensities ranging from 389.24 to 1977.68, indicating a positive fluorescence signal and a clear distinction from negative samples. Therefore, the evaluation group of this invention can reach the detection limit of 5 fM. In contrast, control group 1 showed low fluorescence background in samples with a concentration of 0 fM miRNA-21; samples with concentrations of 1 fM to 5 fM miRNA-21 showed low fluorescence with no significant distinction from negative samples; samples with concentrations of 50 fM to 10 nM miRNA-21 showed fluorescence intensities ranging from 273.77 to 1039.69, with an increasing trend in fluorescence signal intensity, but the intensity was lower than that of the evaluation group. In control group 2, samples with a concentration of 0 fM miRNA-21 showed high fluorescence background and non-specific signals, with no significant difference in fluorescence intensity compared to samples with concentrations of 1 fM to 1 pM miRNA-21. Samples with concentrations of 10 pM to 10 nM miRNA-21 showed increasing fluorescence intensity from 506.27 to 1094.56, but the intensity was lower than that of the evaluation group. This demonstrates that the detection results of this invention have high specificity and can reach the femtomolar detection limit.

[0089] Finally, it should be noted that the above description of the embodiments is intended to enable those skilled in the art to understand and use the invention. Those skilled in the art will readily make various modifications to these embodiments and apply the general principles described herein to other embodiments without inventive effort. Therefore, the present invention is not limited to the above embodiments, and any improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the invention should be within the protection scope of the present invention.

Claims

1. A method for detecting miRNA-21 based on CHA circuit and CpAgo protein catalytic binding, said method for non-diagnostic or therapeutic purposes, characterized in that, Includes the following steps: S1. Extraction of miRNA nucleic acid from the sample to be tested; S2, CHA-CpAgo reaction system preparation: Mix H1, H2, gDNA1, gDNA2, CpAgo protein, and 10×reaction buffer to prepare CHA-CpAgo reaction mixture; S3. Detection of target miRNA-21 using the CHA-CpAgo system: The miRNA nucleic acid extracted in step S1 is added to the CHA-CpAgo reaction mixture prepared in step S2, and the reaction is carried out at an isothermal temperature. Detection is performed based on the fluorescence signal. The nucleotide sequence of H1 in step S2 is shown in SEQ ID NO.2, the nucleotide sequence of H2 is shown in SEQ ID NO.3, the nucleotide sequence of gDNA1 is shown in SEQ ID NO.4, and the nucleotide sequence of gDNA2 is shown in SEQ ID NO.

5. The first base at the 5' end of H1 is modified with a fluorescent reporter group FAM, and the 30th base at the 5' end is modified with a fluorescent quencher group BHQ1. The first base at the 3' end of H2 is modified with a fluorescent reporter group FAM, and the 28th base at the 5' end is modified with a fluorescent quencher group BHQ1.

2. The method as described in claim 1, characterized in that, The miRNA nucleic acid in step S1 includes miRNA-21, and the nucleotide sequence of miRNA-21 is shown in SEQ ID NO.

1.

3. The method as described in claim 1, characterized in that, The working concentration range of H1 is 250-500 nM, the working concentration range of H2 is 250-500 nM, the working concentration range of gDNA1 is 150-250 nM, the working concentration range of gDNA2 is 150-250 nM, and the working concentration range of CpAgo protein is 2-10 nM.

4. The method as described in claim 1, characterized in that, The 10×reaction buffer is prepared by mixing MgCl2, KCl, Tris-HCl, DTT and Tween 20 to achieve a final concentration of 45~55mM for MgCl2, 550~650mM for KCl, 500~600mM for Tris-HCl, 8~15mM for DTT, and 0.01% for Tween 20.

5. The method as described in claim 1, characterized in that, The isothermal reaction conditions in step S3 are 37℃~40℃ and the reaction time is 30-40 min.

6. A kit for detecting miRNA-21, characterized in that, The mixture includes a CHA reaction mixture, CpAgo protein, and DEPC water. The CHA reaction mixture comprises H1, H2, gDNA1, gDNA2, and a 10× reaction buffer. The nucleotide sequence of H1 is shown in SEQ ID NO.2, the nucleotide sequence of H2 is shown in SEQ ID NO.3, the nucleotide sequence of gDNA1 is shown in SEQ ID NO.4, and the nucleotide sequence of gDNA2 is shown in SEQ ID NO.

5. The first base at the 5' end of H1 is modified with a fluorescent reporter group FAM, and the 30th base at the 5' end is modified with a fluorescent quencher group BHQ1. The first base at the 3' end of H2 is modified with a fluorescent reporter group FAM, and the 28th base at the 5' end is modified with a fluorescent quencher group BHQ1.

7. The kit according to claim 6, characterized in that, The 10×reaction buffer is prepared by mixing MgCl2, KCl, Tris-HCl, DTT and Tween 20 to achieve a final concentration of 45~55mM for MgCl2, 550~650mM for KCl, 500~600mM for Tris-HCl, 8~15mM for DTT, and 0.01% for Tween 20.

Images