A primer, a kit and a detection method for detecting ALDH2 gene mutation

By using RPA-specific isothermal amplification primers and CRISPR-Cas12a fluorescent or test strip detection systems, and by designing specific crRNA with mismatched bases, the complexity and high equipment requirements of fluorescent PCR in detecting ALDH2 gene mutations were solved, enabling rapid and accurate mutation detection.

CN119685472BActive Publication Date: 2026-07-31ZHONGNAN HOSPITAL OF WUHAN UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
ZHONGNAN HOSPITAL OF WUHAN UNIV
Filing Date
2024-12-30
Publication Date
2026-07-31

AI Technical Summary

Technical Problem

Existing fluorescent PCR methods for detecting ALDH2 gene mutations suffer from problems such as long detection time, high equipment requirements, complex operation, and inability to effectively distinguish between wild-type and mutant sequences.

Method used

Using RPA-specific isothermal amplification primers combined with CRISPR-Cas12a fluorescence or test strip detection systems, specific crRNAs were designed with a small amount of mismatched bases added to distinguish between wild-type and mutant ALDH2. The targeting recognition function and side branch cleavage activity of CRISPR-Cas12a were used to cleave signal reporter molecules.

Benefits of technology

It enables rapid and effective detection of ALDH2 gene mutations under basic medical equipment conditions, provides guidance on nitroglycerin medication, reduces false positive and false negative rates, and improves the accuracy and convenience of testing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119685472B_ABST
    Figure CN119685472B_ABST
Patent Text Reader

Abstract

This invention belongs to the field of molecular biology detection technology, specifically relating to primers, kits, and detection methods for detecting ALDH2 gene mutations. This invention is the first to discover that by adding a small amount of mismatched bases to the design of ALDH2*2 gene-specific crRNA, combined with the CRISPR-Cas12a system, ALDH2 mutant types can be efficiently distinguished. The detection method provided by this invention first performs isothermal amplification of nucleic acids in the sample to be tested using the aforementioned specific RPA primers. Then, the CRISPR-Cas12a fluorescence detection system is used to recognize, bind to, cleave, and activate the ssDNA fluorescent probe to obtain lysate products, which are then determined by fluorescence color development; or the CRISPR-Cas12a test strip detection system is used to read the test strip results, achieving efficient, accurate, and rapid detection of the c.1510G>C point mutation in the ALDH2*2 gene.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biological detection technology; specifically, it relates to primers, kits and detection methods for detecting ALDH2 gene mutations; and it efficiently distinguishes between wild-type and mutant ALDH2 based on the RPA and CRISPR-Cas12a system. Background Technology

[0002] Recombinase polymerase amplification (RPA) is considered a nucleic acid detection technique that can replace PCR. Under conditions of 37-42℃, a protein-DNA complex formed by the binding of a recombinase to a primer (an oligonucleotide primer) searches for homologous sequences in double-stranded DNA and initiates strand exchange. DNA synthesis is then initiated by the strand-displacement DNA polymerase, and the replaced DNA strand binds to a single-stranded DNA-binding protein (SSB) to prevent further replacement. The RPA system can produce detectable amplification products within ten minutes. CRISPR / Cas12a (clustered regularly interspaced short palindromic repeats crisper associated gene) is a restriction endonuclease that can cleave DNA under specific RNA guidance. It can be used for genome editing and also has non-specific side-branching activity to cleave fluorescent probes, producing fluorescence. It can be used as a tool for in vitro detection of biomolecules under room temperature conditions.

[0003] Aldehyde dehydrogenase 2 (ALDH2) is a key enzyme in the in vivo and in vitro aldehyde metabolism pathway, belonging to the aldehyde dehydrogenase family. Its main functions include metabolizing reactive aldehydes in the body, such as acetaldehyde, acrolein, 3,4-dihydroxyphenylacetaldehyde (DOPAL), malondialdehyde (MDA), and 4-hydroxynonenal (4-HNE). Alcohol is metabolized into acetaldehyde in the liver, which is then converted into acetic acid. Acetaldehyde is hepatotoxic and muscle-toxic, and also increases the risk of cardiovascular disease and cancer.

[0004] The rate at which acetaldehyde is cleared from the body depends primarily on the activity of the ALDH2 enzyme. The ALDH2 gene, which encodes acetaldehyde, is polymorphic and prone to mutation. The substitution of glutamic acid at position 487 of the ALDH2 amino acid sequence with lysine results in a significant loss of catalytic activity in the synthesized acetaldehyde dehydrogenase. The wild-type gene encoding the normal enzyme is ALDH2*1. A point mutation at c.1510G>C results in a mutant gene encoding the inactive enzyme (named ALDH2*2), one of the most common gene mutations in humans. It is estimated that 560 million people worldwide (approximately 8% of the world's population) carry this gene, with approximately 35%–45% of this population in Southeast Asia. This mutation affects the activity of enzymes encoded by ALDH2, including acetaldehyde dehydrogenase and nitrate lipase.

[0005] Nitroglycerin has a wide range of applications in the treatment of cardiovascular diseases. Nitroglycerin esterase is used to denitrate nitroglycerin to produce nitric oxide, which exerts its vasodilatory effect. When the ALDH2*2 mutation is present, the activity of nitroglycerin esterase is severely reduced, thus affecting the efficacy of nitroglycerin. Detection of this mutation site can provide clues for relevant treatment of patients and reduce ineffective drug use.

[0006] Currently, the main detection technology for this mutation is fluorescent PCR, which has good accuracy but suffers from drawbacks such as long detection time, high equipment requirements, and complex operation. Compared to traditional PCR methods, the RPA combined with CRISPR nucleic acid detection system offers rapid reaction, lower equipment requirements, and simpler operation.

[0007] However, due to the inherent tolerance of the CRISPR system—that is, even with a few mismatched bases in the target sequence—the guide RNA can still bind to the mutation site sequence and trigger the CRISPR cleavage effect. Therefore, guide RNA matching the wild-type sequence can bind to the mutation site sequence, and vice versa. Conventional guide RNA designs cannot distinguish between wild-type and mutant sequences. To address this issue, the inventors innovatively utilized CRISPR's tolerance by introducing mismatched guide RNA. For sequences with single-base mutations, adding an extra mismatch site to the guide RNA allows it to bind to the mutant sequence; however, because the mismatched guide RNA has two mismatches with the wild-type sequence, the binding efficiency is significantly reduced, preventing it from properly activating the CRISPR cleavage effect and generating a fluorescent signal. By screening mismatched guide RNA for ALDH2 mutation detection, the inventors can provide rapid and effective detection clues for nitroglycerin medication guidance in situations where primary healthcare or laboratory equipment is insufficient. It can also indicate the risk of diseases such as Alzheimer's disease and remind individuals carrying the ALDH2 mutation to consume alcohol in moderation. Summary of the Invention

[0008] This invention provides primers, kits, and detection methods for detecting ALDH2 gene mutations. It is the first discovery that by adding a small number of mismatched bases to the crRNA design specifically targeting the c.1510G>C mutation site in the ALDH2*2 gene, the targeting recognition function and side branch cleavage activity of CRISPRCas12a can be used to identify the DNA site and cleave the signal reporter molecule, which can efficiently distinguish between wild-type and mutant ALDH2.

[0009] Based on the above-mentioned technical objectives and technical problems, the present invention provides the following technical solution:

[0010] A primer for detecting ALDH2 gene mutations, comprising RPA-specific isothermal amplification primers targeting the ALDH2 gene;

[0011] The RPA-specific isothermal amplification primers for the ALDH2 gene (NC_000012.12:111803796-111804368) include a forward primer and a reverse primer, with the sequences as follows:

[0012] RPA-3F (SEQ ID NO: 13)CTCGTTTTCAAATTACAGGGTCAACTGCTATG,

[0013] RPA-2R (SEQ ID NO: 15) CCAACAGACCCCAATCCCCCAGCAGGCTCC.

[0014] The application of the primers described herein in the detection of ALDH2 gene mutations.

[0015] An ALDH2 gene mutation detection kit, comprising the RPA-specific isothermal amplification primers targeting the ALDH2 gene and a CRISPR-Cas12a fluorescent or test strip detection system;

[0016] The CRISPR-Cas12a fluorescence or detection system comprises 10×NEBuffer 2.1 and DEPC water.

[0017] The CRISPR-Cas12a fluorescence detection system also includes specific crRNA, Cas12a protein, and ssDNA fluorescent probes targeting the c.1510G>C mutation point in the ALDH2*2 gene.

[0018] The CRISPR-Cas12a test strip detection system also includes crRNA specific to the c.1510G>C mutation point of the ALDH2*2 gene, Cas12a protein, and CRISPR-LFA ssDNA reporter (CRISPR single-system test strip);

[0019] Wherein, the Cas12a protein is the LbCas12a protein;

[0020] The sequence of the specific crRNA targeting the c.1510G>C mutation site in the ALDH2*2 gene is shown in SEQ ID NO: 6.

[0021] crRNA-mm1 (SEQ ID NO: 6)UAAUUUCUACUAAGUGUAGUACUUUAGUGUCUGCCUGCAGCCCG;

[0022] The ssDNA fluorescent probe is a single-stranded DNA probe double-labeled with a fluorescent group and a fluorescence quencher group, and the sequence of the single-stranded DNA probe is FAM-TTATT-Quencher.

[0023] This invention also provides a method for detecting ALDH2 gene mutations, comprising the following steps:

[0024] 1) Obtain the kit; 2) Obtain the sample to be tested and perform isothermal amplification based on the RPA-specific isothermal amplification primers to obtain RPA amplification products; 3) Use the CRISPR-Cas12a system to identify, cut, and activate the RPA amplification products obtained in step 2) to obtain lysis products; 4) Detect the lysis products obtained in step 3) using the CRISPR-Cas12a detection system (a CRISPR-Cas12a fluorescence detection system or a CRISPR-Cas12a test strip detection system can be used); and combine the first-generation sequencing results of the lysis products to complete the detection of the c.1510G>C point mutation in the ALDH2*2 gene.

[0025] The RPA amplification system is as follows: 2.4 μL of 10 mM RPA upstream primer and 2.4 μL of 10 mM RPA downstream primer, mixed well, and then added to the sample to be tested to a final concentration of 0.5 nM; then 2.5 μL of... Add DEPC water to the MgOAc solution to make up to 50 μL, heat in a metal bath at 37°C for 10 minutes to start amplification, and obtain the PRA amplification product.

[0026] The CRISPR-Cas12a fluorescence detection system is as follows: 33 nM crRNA, 33 nM LbaCas12a, 3 μL Nebbuffer 2.1, 50 nM fluorescence quenching probe, 2 μL of RPA amplification product obtained in step 2), and DEPC water added to 30 μL; fluorescence intensity was detected after reacting at 37°C for 60 minutes.

[0027] The CRISPR-Cas12a test strip detection system is as follows: 33 nM crRNA, 33 nM LbaCas12a, 3 μL Neb buffer 2.1, 100 nM CRISPR-LFA ssDNA reporter, 2 μL of the RPA amplification product obtained in step 2), and DEPC water to a final volume of 30 μL; after incubation at 37°C for 60 minutes, insert the CRISPR single-system test strip to read the results.

[0028] The advantages and beneficial effects of this invention compared to the prior art include:

[0029] This invention provides primers, a kit, and a detection method for detecting ALDH2 gene mutations, including specific RPA primers targeting the lung cancer mutant ALDH2 gene and specific crRNA designed for the c.1510G>C mutation site of the ALDH2*2 gene. It is the first discovery that by adding a small number of mismatched bases to the design of the crRNA specific to the c.1510G>C mutation site of the ALDH2*2 gene, and combining it with the CRISPR-Cas12a system, it is possible to efficiently distinguish between wild-type and mutant ALDH2. The detection method provided by this invention first performs isothermal amplification of nucleic acids in the sample to be tested using the aforementioned specific RPA primers. Then, in a CRISPR-Cas12a fluorescence detection system containing the aforementioned specific crRNA, the RPA amplification products are recognized, bound, and cleaved to activate the non-specific nuclease function. Subsequently, the ssDNA fluorescent probe in the system is arbitrarily cleaved to obtain lysis products. Finally, the fluorescence color development of the lysis products is used for judgment, or the test strip results are read in a CRISPR-Cas12a test strip detection system containing the aforementioned specific crRNA. This method enables the detection of the c.1510G>C point mutation in the ALDH2*2 gene, providing technical support for determining whether a sample contains an ALDH2 gene mutation site. Attached Figure Description

[0030] Figure 1 : A schematic diagram of the crRNA screening results used to distinguish between wild-type and mutant ALDH2 in Example 1 of this invention;

[0031] The X-axis represents fluorescence intensity, and the Y-axis represents the crRNA group. In the absence of crRNA, neither the wild-type nor the mutant sequences showed obvious fluorescence.

[0032] Figure 2 : Schematic diagram of the screening and results of the optimal RPA primers for crRNA in Example 2 of this invention;

[0033] Figure 3: A schematic diagram of sample verification and results of the detection method in Example 3 of this invention, wherein + / - indicates that the first-generation sequencing results contain / do not contain ALDH2 mutation points, but do not match the fluorescence detection results, i.e., false positives or false negatives; the color indicates the detection fluorescence value of this invention;

[0034] Figure 4 Image of the test strip outputting the test results in an embodiment of this invention;

[0035] Figure 5 The diagram above illustrates the principle of distinguishing between wild-type and mutant sequences in this invention. In the diagram above, normal mutant crRNA can match sequences without mutation points (left) and completely match sequences with mutation points (right). In the diagram below, mutant crRNA with a mismatch point only matches sequences with mutation points (right) and cannot match sequences without mutation points (left). Detailed Implementation

[0036] Example 1. Screening of ALDH2 mutant gene crRNA

[0037] 1.1 Reference Sequence Synthesis and Amplification

[0038] The wild-type ALDH2 gene reference sequence was obtained from the NCBI website, NC_000012.12:111803796-111804368; the mutant sequence has guanine G replaced with cytosine C at c.1510. The backbone of the reference sequence plasmid is PUC19, and the recombinant plasmid was synthesized by Shanghai Sangon Biotech Co., Ltd., and introduced into TOP10 *E. coli*. The ALDH2 plasmid was inoculated onto ampicillin LB agar plates and incubated overnight at 37°C for 20 hours. Single colonies were picked and inoculated into 100 μg / mL ampicillin LB liquid medium for amplification. After 10-14 hours, bacteria were collected, and plasmid extraction was performed according to the plasmid extraction kit instructions (Kangwei, CW209S).

[0039] 1.2 crRNA sequence design

[0040] The Cas12a protein selected in this experiment was Cas12a. Based on its PAM (TTTN) characteristics, seven crRNAs were selected for the detection of the c.1510G>C mutation site in the ALDH2*2 gene (Table 1). Cas12a detection has a certain degree of tolerance, meaning that even with a small number of mismatched bases in the crRNA, Cas12a cleavage activity can still be activated. Therefore, in the design of some crRNAs, a small number of mismatched bases were added to distinguish between the wild-type ALDH2 and the c.1510G>C mutant ALDH2*2 gene, namely crRNA-mm1, crRNA-mm2, crRNA-mm3, crRNA-ww1, and crRNA-ww2 as shown in the table below. The reaction principle is as follows: Figure 5 As shown in the figure, the upper part of the figure shows that normal mutant crRNA can match sequences without mutation points and completely match sequences with mutation points; the lower part of the figure shows that mutant crRNA with a mismatch point only matches sequences with mutation points and cannot match sequences without mutation points.

[0041] The crRNA used in this experiment was synthesized by General Biotechnology Co., Ltd.

[0042] Table 1: crRNA Sequence

[0043] crRNA-mu (SEQ ID NO: 4) UAAUUUCUACUAAGUGUAGAUACUUUAGUGUAUGCCUGCAGCCCG crRNA-wt (SEQ ID NO: 5) UAAUUUCUACUAAGGUAGUACUUCAGUGUAUGCCUGCAGCCCG crRNA-mm1 (SEQ ID NO: 6) UAAUUUCUACUAAGUGUAGAUACUUUAGUGUCUGCCUGCAGCCCG crRNA-mm2 (SEQ ID NO: 7) UAAUUUCUACUAAGUGUAGAUACCUUAGUGUAUGCCUGCAGCCCG crRNA-mm3 (SEQ ID NO: 8) UAAUUUCUACUAAGUGUAGAUACUUUAUUGUAUGCCUGCAGCCCG crRNA-ww1 (SEQ ID NO: 9) UAAUUUCUACUAAGUGUAGAUACUUCAGUGGCAUGCCUGCAGCCCG crRNA-ww2 (SEQ ID NO: 10) UAAUUUCUACUAAGUGUAGAUACUUCAUUGUAUGCCUGCAGCCCG

[0044] 1.3 CRISPRCas12a detection

[0045] The CRISPR-Cas12a reaction system was as follows: 33 nM LbaCas12a (NEBiolabs), 3 μL Nebbuffer 2.1 (NEBiolabs), 33 nM crRNA, 50 nM MF-Q fluorescence quenching probe (FAM-TTATT-Quencher), 8 nM reference plasmid, and DEPC water to a final volume of 30 μL. The reaction was carried out at 37°C in clear tubes for 60 minutes, and the fluorescence intensity was detected using a quantitative PCR instrument (Tianlong Gentier 96R). A total of 16 groups were set up, each with 3 identical replicate wells. Each group consisted of different combinations of reference plasmid and crRNA sequences (the selection of crRNA and reference plasmid for each group is shown in Table 2). The Neg group contained only the reference plasmid and no crRNA.

[0046] Table 2: Experimental group design (where numbers represent groups)

[0047]

[0048] The reaction results are as follows Figure 1As shown, the X-axis represents fluorescence intensity, and the Y-axis represents the crRNA group. The left side shows the detection results of wild-type sequences, and the right side shows the detection results of mutant sequences. The sequence concentration is 100 ng / uL. Specifically, crRNA-WT is a guide RNA that perfectly matches the wild-type sequence, showing high-intensity fluorescence with the wild-type sequence and significant fluorescence (>750) with the mutant sequence; crRNA-ww1 and ww2 are guide RNAs with one mismatch with the wild-type sequence and two mismatches with the mutant sequence, showing no significant fluorescence (<750) with either the wild-type or mutant sequences; crRNA-MU is a guide RNA that perfectly matches the mutant sequence, showing high-intensity fluorescence with the mutant sequence and significant fluorescence (>800) with the wild-type sequence. crRNA-mm1, mm2, and mm3 are guide RNAs with one mismatch with the mutant sequence and two mismatches with the wild-type sequence. The results showed that mm2 produced obvious fluorescence with the mutant and with the wild-type sequence, while mm3 produced significant fluorescence (<750) with both the wild-type and mutant sequences. mm1 produced obvious fluorescence with the mutant (mean 3756.7) and little fluorescence with the wild-type (mean 681.3), which can be used to distinguish between the wild-type and ALDH2*2 mutations. When crRNA was not present, neither the wild-type nor the mutant sequence showed obvious fluorescence.

[0049] As can be seen, crRNA-mm1 has a high recognition effect on the ALDH2 mutant sequence, but a low fluorescence detection result for the ALDH2 wild-type sequence. Meanwhile, other crRNA sequences do not show a significant distinguishing effect between the ALDH2 wild-type and the ALDH2*2 gene c.1510G>C mutant. Therefore, this invention selects crRNA-mm1 as a feasible crRNA sequence for recognizing the ALDH2 mutant gene.

[0050] Example 2. Screening of optimal RPA primers for crRNA

[0051] Based on design principles, three upstream primers and three downstream primers were selected from the NC_000012.12:111803796-111804368 sequence, and paired to form nine experimental groups of RPA reaction systems (see Table 4 for details). The optimal RPA primers were selected by comparing the fluorescence intensity of the RPA reaction products using CRISPRCas12a detection.

[0052] In this embodiment, the RPA amplification system is as follows: Take... Rehydration buffer dissolves Add 2.4 μL of 10 mM RPA upstream primer and 2.4 μL of 10 mM RPA downstream primer to the lyophilized powder; the RPA upstream and downstream primers are shown in Table 3. Mix thoroughly, add the reference sequence plasmid to a final concentration of 0.5 nM, and add 2.5 μL of the lyophilized powder. MgOAc solution, add DEPC water to 50uL, heat in a 37℃ metal bath for 10 minutes to start amplification, and obtain amplification products;

[0053] Table 3: RPA Sequences

[0054] RPA-1F (SEQ ID NO: 11) CCTGGGAGTGTAACCCATAACCCCCAAGAGTG RPA-2F (SEQ ID NO: 12) CCAGTCACCCTTTGGTGGCTACAAGATGTCG RPA-3F (SEQ ID NO: 13) CTCGTTTCAAATTACAGGGTCAACTGCTATG RPA-1R (SEQ ID NO: 14) CAGCAGACCCTCAAGCCCCAACAGGCCCTGAGC RPA-2R (SEQ ID NO: 15) CCAACAGACCCCAATCCCCCAGCAGGCTCC RPA-3R (SEQ ID NO: 16) TGGGAAATTAGTAGGAAACACTGATGGCCTC

[0055] The CRISPR-Cas12a experimental system was as follows: 33 nM crRNA-mm1, 33 nM LbaCas12a (NEBiolabs), 3 μL Nebbuffer 2.1 (NEBiolabs), 50 nM FQ fluorescence quenching probe, and 2 μL of the RPA amplification product obtained in the previous step. DEPC water was added to a final volume of 30 μL. The reaction was carried out at 37°C in clear tubes for 60 minutes, and the fluorescence intensity was detected using a quantitative real-time PCR instrument (CFX96, BioRad). A total of 10 groups were set up, including 9 experimental groups as described above and 1 blank control group (as shown in Table 4). Each group had 3 replicate wells (with identical settings to meet statistical requirements). Each group was amplified using different RPA primers, with the Neg group containing primer-free RPA product.

[0056] Table 4 shows the upstream and downstream primer groups corresponding to the RPA amplification products in each group (where the numbers represent the group).

[0057]

[0058] RPA screening results are as follows Figure 2 As shown, all RPA primers had significant amplification effects, with group 8 (RPA-3F / RPA-2R) showing the best results and being selected for subsequent amplification experiments.

[0059] Example 3. Sample Validation of the Detection Method

[0060] The sample testing procedure was as follows: collection of oral epithelial cells from the subject, DNA extraction, RPA amplification, and CRISPR-Cas12a detection. The control method was first-generation sequencing.

[0061] 3.1 DNA extraction from the sample to be tested

[0062] Oral epithelial cells were obtained from the subjects using oral swabs, and DNA was extracted from the samples according to the instructions of the oral epithelial cell DNA extraction kit (B58268, Sangon Biotech Co., Ltd.).

[0063] 3.2 RPA Amplification Reaction

[0064] The RPA amplification system for this experiment is as follows: (Take...) Rehydration buffer dissolves Add 2.4 μL of 10 mM RPA-3F upstream primer and 2.4 μL of 10 mM RPA-2R downstream primer to the lyophilized powder and mix thoroughly; add 2 μL of the sample to be tested; add... Add DEPC water to the MgOAc solution to a final volume of 50 μL. Initiate amplification by heating in a 37°C metal bath for 10 minutes to obtain the amplification products.

[0065] 3.3 CRISPRCas12a detection

[0066] The CRISPR-Cas12a experimental system was as follows: 33 nM crRNA-mm1, 33 nM LbaCas12a (NEBiolabs), 3 μL Nebbuffer 2.1 (NEBiolabs), 50 nM FQ fluorescence quenching probe, 2 μL of the RPA amplification product from the previous step, and DEPC water to a final volume of 30 μL. The mixture was incubated at 37°C in clear tubes for 60 minutes, and the fluorescence intensity was detected using a quantitative real-time PCR instrument (CFX96, BioRad).

[0067] 3.4 First-generation sequencing of samples

[0068] The true ALDH2 gene sequence of the sample was obtained through first-generation sequencing. Specifically, the DNA obtained in step 3.1 was amplified by PCR. The PCR primers were [F(SEQ ID NO: 17)-GGTCCTGGGAGTGTAACCCA; R(SEQ ID NO: 18)-CAGGCCTTGGCGTATAACGA], and the kit was the Vazyme C112 PCR amplification kit. The reaction system was prepared according to the kit instructions. The reaction program was 95 degrees Celsius for 3 minutes for pre-denaturation, three-stage cycling: 95 degrees Celsius for 15 seconds, 56 degrees Celsius for 15 seconds, and 72 degrees Celsius for 15 seconds, for a total of 25 cycles, followed by an extension at 72 degrees Celsius for 5 minutes. The PCR products were sent to Shanghai Sangon Biotech Co., Ltd. for first-generation sequencing. The obtained results were compared with the detection results of this invention, such as... Figure 3 As shown, + / - indicates that the first-generation sequencing results contain / do not contain the ALDH2 mutation point, while the results of this method do not match the sequencing results; the color indicates the detection fluorescence value of this invention. Compared with the first-generation sequencing results, the accuracy of this invention is 98.15%.

[0069] 3.5 Test strips are used for CRISPR test result output.

[0070] To facilitate rapid result output, we used colloidal gold test strips for result presentation. The experimental procedure was as follows: collection of oral epithelial cells from the subject, DNA extraction, RPA amplification, and CRISPR-Cas12a detection using test strips. The first three steps are as described above. The CRISPR-Cas12a detection system using test strips includes:

[0071] Add 33 nM crRNA-mm1, 33 nM LbaCas12a (NEBiolabs), 3 μL Nebbuffer 2.1 (NEBiolabs), and 2 μL of the RPA amplification product obtained in the previous step, then add DEPC water to a final volume of 30 μL. Incubate at 37°C in a clear tube for 60 minutes. Insert the CRISPR single-system detection test strip FAM / FITC, which is from Tolo Harbour BioMed's CRISPR-LFA ssDNA reporter (#31201). Interpret the results according to the test strip instructions. Figure 4 These are the results for ALDH2 mutant and ALDH2 wild-type testing. Both control lines show bands, while the test line only shows a band for the mutant.

[0072] Experimental results of Examples 1-3:

[0073] 1. For example Figure 1 As shown, crRNA-WT, which perfectly matches the wild-type strain, can bind to both the wild-type and mutant sequences simultaneously, activating enzyme cleavage activity, but cannot distinguish between them. Similarly, crRNA-MT, which perfectly matches the mutant sequence, can bind to both the mutant and wild-type sequences, also failing to distinguish between them. However, in the crRNA design of this application, a small number of mismatched bases were added to distinguish between ALDH2 wild-type and mutant types. The results showed that crRNA-Mm1 reacted significantly with the mutant strain but showed no obvious reaction with the wild-type strain. This crRNA can clearly distinguish between the wild-type and mutant strains. Therefore, it was used for subsequent detection.

[0074] 2. For example Figure 2 As shown, RPA-7 produced a high fluorescence value, which was used for subsequent detection;

[0075] 3. For example Figure 3 As shown, among the 162 tested samples, 58 out of 60 mutant samples were mutation-positive and 2 were mutation-negative (false negatives), with a sensitivity of 96.67%; among the 102 wild-type samples, 101 were mutation-negative and 1 was mutation-positive (false positive), with a specificity of 99.01% and a detection accuracy of 98.15%.

[0076] 4. For example Figure 4 As shown, the test strip can be used to output sample test results. Wild type has one indicator line, and mutant type has two indicator lines.

Claims

1. An ALDH2*2 genetic mutation detection kit, characterized by, The kit includes primers for detecting ALDH2*2 gene mutations. The upstream primer sequence for RPA in the primers for detecting ALDH2*2 gene mutations is shown in SEQ ID NO: 13, and the downstream primer sequence for RPA in the primers for detecting ALDH2*2 gene mutations is shown in SEQ ID NO:

15. The primers for detecting ALDH2*2 gene mutations also include RPA-specific isothermal amplification primers for the ALDH2*2 gene and a CRISPR-Cas12a detection system. The CRISPR-Cas12a detection system is a CRISPR-Cas12a fluorescence detection system or a CRISPR-Cas12a test strip detection system. The kit also includes a specific crRNA targeting the c.1510 G>C mutation site of the ALDH2*2 gene; the sequence of the specific crRNA is shown in SEQ ID NO: 6; the specific crRNA has one mismatch with the mutant sequence and two mismatches with the wild-type sequence, which prevents the wild-type sequence from activating Cas12a, thereby achieving efficient differentiation between the c.1510G>C mutant and wild-type ALDH2*2 gene.

2. The kit of claim 1, wherein The CRISPR-Cas12a fluorescence detection system also includes an ssDNA fluorescent probe, which is a single-stranded DNA probe double-labeled with a fluorescent group and a fluorescence quencher group; the sequence of the single-stranded DNA probe is FAM-TTATT-Quencher; and the Cas12a protein is LbCas12a protein.

3. The kit of claim 1, wherein The CRISPR-Cas12a test strip detection system also includes a CRISPR-LFA ssDNA reporter at a final concentration of 100 nM; the Cas12a protein is the LbCas12a protein.

4. A method for detecting ALDH2*2 gene mutations based on the kit described in claim 1, 2, or 3, characterized in that, The method is used for non-therapeutic or diagnostic purposes and includes the following steps: 1) Obtain the kit according to claim 1; 2) Obtain the sample to be tested and perform isothermal amplification based on the RPA-specific isothermal amplification primers described in claim 1 to obtain the RPA amplification product; 3) The RPA amplification product obtained in step 2) is identified, cleaved, and activated using the CRISPR-Cas12a system described in claim 2 to obtain the cleavage product; 4) The lysis products obtained in step 3) were detected using the CRISPR-Cas12a detection system; and the c.1510 G>C point mutation in the ALDH2*2 gene was detected by combining the first-generation sequencing results of the lysis products. In step 2), the temperature for the intermediate temperature is set to any temperature within the range of 37-42℃.

5. The method of claim 4, wherein, In step 4), the CRISPR single-system test strip results are as follows: both the mutant and wild-type control lines show bands, while only the mutant test line shows a band; the fluorescence colorimetric judgment is as follows: a fluorescence value higher than 750 indicates the presence of the ALDH2*2 gene c.1510 G>C mutation point, while a fluorescence value lower than 750 indicates the absence of the ALDH2*2 gene c.1510 G>C mutation point.

6. The method of claim 4, wherein, The RPA amplification system is as follows: 2.4 μL of 10 mM RPA upstream primer and 2.4 μL of 10 mM RPA downstream primer were mixed and then the sample to be tested was added to a final concentration of 0.5 nM. Then, 2.5 μL of TwistAmp® MgOAc solution was added, and DEPC water was added to a final concentration of 50 μL. The amplification was started by heating in a metal bath at 37°C for 10 minutes to obtain the RPA amplification product.

7. The method of claim 4, wherein, The CRISPR-Cas12a fluorescence detection system is as follows: 33 nM crRNA, 33 nM LbaCas12a, 3 μL Nebbuffer 2.1, 50 nM fluorescence quenching probe, 2 μL of RPA amplification product obtained in step 2), and DEPC water added to 30 μL; fluorescence intensity was detected after reacting at 37°C for 60 minutes.

8. The method of claim 4, wherein, The CRISPR-Cas12a test strip detection system is as follows: crRNA with a final concentration of 33 nM, LbaCas12a with a final concentration of 33 nM, 3 μL Neb buffer 2.1, 2 μL of RPA amplification product obtained in step 2), and DEPC water added to a final concentration of 30 μL; after reacting at 37°C for 60 minutes, a CRISPR-LFAssDNA reporter with a final concentration of 100 nM is inserted to read the results.