Transcription factor gata3 interacting with the promoter of plant melatonin synthase gene comt1 and application thereof

Abstract

The application belongs to the technical field of genetic engineering, and particularly relates to a transcription factor GATA3 interacting with a promoter of a plant melatonin synthesis enzyme gene COMT1 and an application thereof. The transcription factor GATA3 interacting with the promoter of the plant melatonin key synthesis enzyme gene COMT1 is obtained by using a yeast one-hybrid method, the transcription factor GATA3 is a regulatory factor upstream of the COMT1 gene, has an important regulatory effect on the synthesis of melatonin in plants, and the application is conducive to cultivating a high-yield melatonin transgenic plant.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a transcription factor GATA3 that interacts with the promoter of the plant melatonin synthase gene COMT1 and its applications. Background Technology

[0002] The information disclosed in this background section is intended only to enhance understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.

[0003] Melatonin (MLT), also known as N-acetyl-5-methoxytryptamine, is an indole-like hormone first discovered in the pineal gland of cattle. It has since been found to be widely present in humans, animals, microorganisms, and plants, playing a vital role in hormone regulation. In animals and humans, melatonin helps maintain the circadian rhythm of physiological activities, promoting sleep; it also enhances immune function, has anti-aging effects, inhibits tumor cell growth, and relieves stress. In higher plants, melatonin not only participates in regulating important growth and development processes such as seed germination, root growth, leaf senescence, flowering, and fruit ripening, but also participates in the plant's response to and regulation of biotic and abiotic stresses such as heavy metals, salt, low temperature, high temperature, drought, and pathogens.

[0004] Animals, including humans, can obtain melatonin from plants containing melatonin, thereby exerting physiological and health-promoting effects in their bodies. However, the melatonin content in plants is very low. Therefore, increasing the melatonin content in plants is not only beneficial to the growth and development of the plants themselves, but also to human health. The synthesis pathway of melatonin in plants is well understood, but research on the regulation of melatonin content is relatively limited. Summary of the Invention

[0005] To overcome the above problems, the present invention provides a transcription factor GATA3 that interacts with the promoter of the plant melatonin synthase gene COMT1 and its applications.

[0006] To achieve the above technical objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides a transcription factor GATA3, which is a protein encoded by a polynucleotide sequence as shown in SEQ ID NO:1.

[0007] The nucleotide sequence shown in SEQ ID NO:1:

[0008] In a second aspect, the present invention provides a polynucleotide encoding the transcription factor GATA3 described in the first aspect.

[0009] A third aspect of the present invention provides a recombinant expression vector containing the polynucleotides described in the second aspect above.

[0010] In one or more embodiments, the recombinant expression vector is obtained by effectively linking the aforementioned polynucleotide to an expression vector. The expression vector is any one or more of a viral vector, plasmid, bacteriophage, kinase, or artificial chromosome. The viral vector may include an adenovirus vector, a retrovirus vector, or an adeno-associated virus vector. The artificial chromosome includes a bacterial artificial chromosome, a vector derived from bacteriophage P1, a yeast artificial chromosome, or a mammalian artificial chromosome. Preferably, the expression vector is a plasmid. In one specific embodiment of the present invention, the plasmid is the pGADT7-Rec-53 yeast cell plasmid.

[0011] In a fourth aspect, the present invention provides a host cell containing the vector described in the third aspect or a chromosome integrated with the polynucleotide described in the second aspect or expressing the transcription factor GATA3 described in the first aspect.

[0012] In one or more embodiments, the host cell may be a prokaryotic cell or a eukaryotic cell.

[0013] Preferably, the host cell is any one or more of bacterial cells and fungal cells; The bacterial cells mentioned therein are any species within the genera Escherichia, Agrobacterium, Bacillus, Streptomyces, Pseudomonas, or Staphylococcus; More preferably, the bacterial cells are Escherichia coli (such as Escherichia coli BL21(DE3)), Agrobacterium tumefaciens (such as GV3101), Agrobacterium rhizogenes, Bacillus subtilis, Bacillus cereus, or Pseudomonas, etc.

[0014] The fungal cells include yeasts (such as Pichia pastoris).

[0015] A fifth aspect of the present invention provides the application of the transcription factor GATA3 described in the first aspect, the polynucleotide described in the second aspect, and the recombinant expression vector described in the third aspect in regulating the expression of the plant melatonin synthase gene COMT1.

[0016] In one or more embodiments, the plant is preferably a cucumber.

[0017] In one or more embodiments, the transcription factor GATA3 of the first aspect interacts with the promoter of the plant melatonin synthase gene COMT1 to regulate the expression of the plant melatonin synthase gene COMT1, wherein the nucleotide sequence of the promoter of the plant melatonin synthase gene COMT1 is shown in SEQ ID NO:2.

[0018] The nucleotide sequence shown in SEQ ID NO:2:

[0019] A sixth aspect of the present invention provides the application of the transcription factor GATA3 described in the first aspect, the polynucleotide described in the second aspect, and the recombinant expression vector described in the third aspect in regulating melatonin synthesis in plants.

[0020] In one or more embodiments, the transcription factor GATA3 of the first aspect interacts with the promoter of the plant melatonin synthase gene COMT1 to regulate the expression of the plant melatonin synthase gene COMT1, thereby regulating the synthesis of melatonin in plants, wherein the nucleotide sequence of the promoter of the plant melatonin synthase gene COMT1 is shown in SEQ ID NO:2.

[0021] A seventh aspect of the present invention provides the application of the transcription factor GATA3 described in the first aspect, the polynucleotide described in the second aspect, and the recombinant expression vector described in the third aspect in the cultivation of transgenic plants that produce high levels of melatonin.

[0022] An eighth aspect of the present invention provides a melatonin synthase gene COMT1 promoter probe, the nucleotide sequence of which is shown in SEQ ID NO:3 or SEQ ID NO:4.

[0023] The beneficial effects of this invention are as follows: This invention uses the yeast one-hybrid method to obtain the transcription factor GATA3, which interacts with the promoter of COMT1, a key melatonin synthase gene in plants. GATA3 is an upstream regulator of the COMT1 gene and plays an important regulatory role in the synthesis of melatonin in plants. Its application is beneficial for cultivating transgenic plants with high melatonin production. Attached Figure Description

[0024] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.

[0025] Figure 1 This was a yeast one-hybrid point-to-point validation of the GATA3 transcription factor and the CsCOMT1 promoter; in the SD-UL results, the number of dilution sites was 10. 0 10 -1 10 -2 10 -3 10 -4 In the SD-UL+100 ng / mL AbA results, the number of dilution points was 10 in each case. 0 10 -1 10 -2 10 -3 10 -4 ; Figure 2 The results of EMSA screening of probes 1, 2, and 3 with protein CsGATA3; Figure 3 The EMSA interaction between probe 1 and protein CsGATA3; Figure 4 For the EMSA interaction between probe 2 and protein CsGATA3; Figure 5 Dual-luciferase assays showed that CsGATA3 positively regulates the expression of CsCOMT1. Detailed Implementation

[0026] It should be noted that the following detailed descriptions are exemplary and intended to provide further illustration of the invention. Unless otherwise specified, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0027] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of exemplary embodiments according to the invention. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof.

[0028] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.

[0029] Unless otherwise specified, the experimental methods in the following examples are performed in accordance with the kit instructions or conventional methods.

[0030] Example 1 Construction of the pABAi-COMT1 promoter plasmid: (1) Primers for promoter amplification of COMT1 (+): CTTGAATTCGAGCTCGGTACtttcacaattgagattgtttcaattttgtaccttctatatg; (-):ATACAGAGCACATGCCTCGAccatatacctaatcccctggttggtg; Sequencing primers: catgccacccaccccctca; 2. PCR system Prepare a 50 μL system and perform the amplification reaction according to the following procedure: The PCR system and procedure are shown in Table 1 and Table 2.

[0031] Table 1 PCR system

[0032] Table 2 PCR Procedure

[0033] The promoter fragment (1500 bp) of COMT1 was excised under UV light using 1% agarose gel electrophoresis at 5 V / cm for 20 minutes. The fragment was then placed in a system for sol-gel recovery. The recovered DNA was dissolved in 40 μL of water (the recovered product was labeled as rDNAC1). After verification, the DNA was recombined with the vector.

[0034] (3) Vector enzyme digestion The enzyme digestion and ligation system and reaction conditions are shown in Tables 3 and 4: Table 3 Enzyme digestion and ligation system

[0035] Table 4 Reaction conditions

[0036] The vector digests were purified using a PCR purification kit and used in the next recombinant reaction.

[0037] (4) The recombination reaction system and reaction conditions are shown in Tables 5 and 6: Table 5 Recombination Reaction System

[0038] Table 6 Reaction conditions

[0039] The ligation product was transformed into competent cells.

[0040] (5) Transformation Transform 5-10 μL of the ligation product into competent E. coli cells, plate the transformed cells onto Amp resistant plates, incubate at 37 ℃ for 12 hours, and perform plaque PCR identification. The identification primers are: pABAi-F:gttccttatatgtagctttcgaca (6137bp).

[0041] Example 2 Construction of pGADT7-GATA3 plasmid: (1) GATA3 amplification primers: (+): GCCATGGAGGCCAGTGAATTatggagtcttctttggctttcatggatgac; (-): CAGCTCGAGCTCGATGGATCtcaccctttatccattggattcaccacc; Sequencing primers: cattttctcccgatccctgc; 2. PCR system Prepare a 50 μL system and perform the amplification reaction according to the following procedure: The PCR system and procedure are shown in Table 7 and Table 8.

[0042] Table 7 PCR System

[0043] Table 8 PCR Procedure

[0044] The GATA3 (864bp) fragment was excised under UV light using 1% agarose gel electrophoresis at 5V / cm for 20 minutes. The fragment was then placed in a system for sol-gel recovery. The recovered DNA was dissolved in 40 μL of water (the recovered product was labeled as rDNAC1). After verification, the DNA was recombined with the vector.

[0045] (3) Vector enzyme digestion The enzyme digestion and ligation system and reaction conditions are shown in Tables 9 and 10: Table 9 Enzyme digestion and ligation system

[0046] Table 10 Reaction Conditions

[0047] The vector digests were purified using a PCR purification kit and used in the next recombinant reaction.

[0048] (4) The recombination reaction system and reaction conditions are shown in Tables 11 and 12: Table 11 Recombination Reaction System

[0049] Table 12 Reaction Conditions

[0050] The ligation product was transformed into competent cells.

[0051] (5) Transformation Transform 5-10 μL of the ligation product into competent E. coli cells, plate the transformed cells onto Amp-resistant plates, incubate at 37 °C for 12 hours, and then perform plaque PCR identification.

[0052] Identification primers: PGADT7-F: gatgatgtatataactatctat (1839bp); Target gene: cattttctcccgatccctgc (2603bp).

[0053] Example 3 To further analyze the molecular mechanism of the COMT1 promoter in melatonin synthesis, a yeast one-hybrid method was used for verification.

[0054] The empty plasmid vector p53-AbAi (i.e., pABAi) and the positive plasmid pGADT7-Rec53 were used as one group; the promoter plasmid of pABAi-COMT1 constructed in Example 1 and the empty plasmid vector pGADT7 were used as another group; and the promoter plasmid of pABAi-COMT1 constructed in Example 1 and the pGADT7-GATA3 plasmid constructed in Example 2 were used as a third group. The three groups of plasmids were transformed into Y1HGold yeast competent cells and cultured in total synthetic yeast medium (SD / -Ura / -Leu) and total synthetic yeast medium containing gold basididin A (SD / -Ura / -Leu + 100 ng / mL AbA), respectively.

[0055] The results are as follows Figure 1 As shown, clear colonies grew in all groups on SD / -Ura / -Leu plates, indicating successful transformation and normal system operation. On SD / -Ura / -Leu + 100 ng / mL AbA plates, pCOMT-AbAi competent cells transformed with the empty pGADT7 vector did not grow colonies, while p53-AbAi competent cells transformed with the pGADT7-Rec53 plasmid all grew large colonies, indicating that the negative and positive controls were functioning normally under this system. The experimental group transformed with the pGADT7-GATA1 plasmid grew colonies on SD / -Ura / -Leu + 100 ng / mL AbA plates, indicating that there is an interaction between the CsGATA3 and CsCOMT1 promoters.

[0056] Example 4 EMSA verification of COMT1 promoter probe and transcription factor GATA3: A COMT1 gene promoter probe was synthesized. The sequence at site 1604 was designed as probe 1; since the sequences at sites 980 and 1001 are close, probe 2 was designed; and the sequence at site 115 was designed as probe 3.

[0057] The nucleotide sequence of probe 1 is shown in SEQ ID NO:3; TATAAAAAGATCAAGAAAAC; The nucleotide sequence of probe 2 is shown in SEQ ID NO:4; CTAAAGATAAATGCATATGCACAAAAGATAGGGTAT; The nucleotide sequence of probe 3 is as follows: AGGTGAAGGATCTGAAATTCT; Recombinant CsGATA3 protein was expressed in Escherichia coli and purified by nickel column chromatography. EMSA experiments showed that probes 1 and 2 could bind to GST-CsGATA3, while probe 3 could not. Figure 2 Probes 1 and 2 showed migration bands with protein CsGATA3. The 5× competing probe could displace a small portion of the probe's migration band with protein CsGATA3, the 20× competing probe could displace a portion of the probe's migration band with protein CsGATA3, and the 50× competing probe could displace most of the probe's migration band with protein CsGATA3. The mutant probe did not show a migration band with protein CsGATA3. Figures 3-4 This means that probes 1 and 2 interact with protein CsGATA3.

[0058] After co-transformation of the promoters of transcription factors CsGATA3 and CsCOMT1 using dual-luciferase reporter gene assay (DLC-CMA) technology, the experimental group showed a significant difference compared with the control group. Figure 5 This indicates that CsGATA3 interacts with the CsCOMT1 promoter and that CsGATA3 positively regulates the expression of CsCOMT1.

[0059] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. Application of transcription factor GATA3 in the breeding of high-melatonin-producing transgenic cucumbers, wherein the transcription factor GATA3 is a protein encoded by a polynucleotide as shown in SEQ ID NO:1, and the transcription factor GATA3 interacts with the promoter of the plant melatonin synthase gene COMT1, positively regulating the expression of the plant melatonin synthase gene COMT1, wherein... The nucleotide sequence of the promoter of the plant melatonin synthase gene COMT1 is shown in SEQ ID NO:2.

Images