Helicases and uses thereof

Abstract

The present invention is in the technical field of nucleic acid sequencing and relates to helicases and their use. In particular, the present invention provides a helicase in which two or more amino acid residues on the surface of the helicase surrounding the polynucleotide binding domain of the helicase are connected by a heteroligative bond, and the helicase retains its ability to control the movement of a target analyte, the heteroligative bond not comprising a heteroligative bond formed with the participation of a cysteine. The present invention also provides a polypeptide, construct, polynucleotide, vector, host cell, method of making a helicase, polypeptide, or construct, method of controlling the movement of a target analyte, method of characterizing a target analyte, method of forming a sensor for characterizing a target analyte, sensor for characterizing a target analyte, use of a helicase or construct in controlling the movement of a target analyte through a pore, kit or device for characterizing a target analyte, and a set of two or more helicases linked to a target analyte.

Description

Technical Field

[0001] This invention belongs to the technical field of nucleic acid sequencing, and specifically relates to a modified helicase and its application in characterizing target analytes. Background Technology

[0002] Nanopore sequencing technology, also known as fourth-generation sequencing technology, utilizes a nanopore that provides an ion current channel, allowing analytes such as single-stranded nucleic acid molecules to pass through the nanopore under electrophoretic drive. As the analyte, such as nucleic acid, passes through the nanopore, the current in the nanopore is reduced, and the gene sequencing technology reads the sequence information in real time from the different signals generated.

[0003] Helicases are a useful tool for controlling the movement of nucleic acid molecules during nanopore sequencing, but current helicases have some problems that need to be addressed. For example, during sequencing, the helicase may detach from the nucleic acid molecule, causing the molecule to be rapidly pulled through the pore at an uncontrolled speed and in an uncontrolled manner, resulting in an indistinguishable electrical signal from analytes such as individual nucleotides.

[0004] To address this issue, prior art CN105899678A discloses a modified helicase. Specifically, at least one cysteine / non-natural amino acid is introduced into the tower / pin / 1A domain of the helicase, thereby improving the helicase's sustained rate control capability in nanopore sequencing. Summary of the Invention

[0005] This application provides a novel helicase modification method that can improve the sustained rate control capability of helicase in nanopore sequencing, and also achieve better results in terms of sequencing stability and accuracy.

[0006] Firstly, this application provides a helicase, which...

[0007] (a) comprising a polynucleotide binding domain and two RecA-like domains, wherein two or more amino acid residues located on the helicase surface surrounding the polynucleotide binding domain are linked by ectopic bonds, such that the polynucleotide bound in the polynucleotide binding domain is surrounded by the structure formed by the linkage; or

[0008] (b) comprising a polynucleotide binding domain and two RecA-like domains, wherein two or more amino acid residues located on the helicase surface surrounding the polynucleotide binding domain are ectopicly linked, such that the polynucleotide bound in the polynucleotide binding domain is surrounded by the linked structure, wherein at least one of the two or more amino acid residues is a mutant amino acid residue; or

[0009] (c) Containing a polynucleotide-binding domain, the polynucleotide-binding domain including an opening in at least one conformational state through which a polynucleotide can bind to the helicase, wherein the helicase forms an ectopic bond between two or more amino acids at the opening (the ectopic bond prevents the polynucleotide from binding to the helicase through the opening), and wherein the helicase retains its ability to control the movement of the target polynucleotide; or

[0010] (d) Contains a polynucleotide binding domain, the polynucleotide binding domain comprising an opening in at least one conformational state (through which a polynucleotide can bind to the helicase), wherein the helicase is modified such that it can form an ectopic bond between two or more amino acids at the opening (the ectopic bond can prevent the polynucleotide from binding to the helicase through the opening), and wherein the helicase retains its ability to control the movement of the target polynucleotide.

[0011] In one embodiment, the ectopic bonds do not include ectopic bonds formed with cysteine, but include ectopic bonds formed with any natural amino acid other than cysteine.

[0012] The natural amino acids, excluding cysteine, are selected from the group consisting of the following amino acids: Ile, Val, Leu, Phe, Met, Ala, Gly, Thr, Ser, Trp, Tyr, Pro, His, Glu, Gln, Asp, Asn, Lys, and Arg.

[0013] Preferably, the ectopic bonds include Lys-His, Lys-Ser, Lys-Thr, Lys-Tyr, Lys-Lys, Lys-Glu, Lys-Asp, Lys-Gln, Lys-Arg, Arg-Glu, Lys-Met, Arg-Asp, Arg-Arg, Tyr-Tyr, Tyr-Trp, Met-Met ectopic bonds or combinations thereof;

[0014] And / or, the helicase is composed of one or more monomers.

[0015] And / or, the two amino acids that form the isopeptide bond are located in the same or different structural domains.

[0016] In one embodiment, the helicase is derived from a natural or modified member of the following helicase family: Dda helicase, Pifl-like helicase, Upfl-like helicase, UvrD / Rep helicase, Ski-like helicase, Rad3 / XPD helicase, NS3 / NPH-II helicase, DEAD helicase, DEAHi RHA helicase, RecG-like helicase, REcQ-like helicase, T1R-like helicase, Swi / Snf-like helicase, and Rig-I-like helicase, preferably Dda helicase, more preferably T4-Dda helicase;

[0017] And / or, the helicase is derived from a natural or modified member of the following helicase family: RecD helicase, Upfl helicase, PcrA helicase, Rep helicase, UvrD helicase, Hel308 helicase, Mtr4 helicase, XPD helicase, NS3 helicase, Mssl 16 helicase, Prp43 helicase, RecG helicase, RecQ helicase, T1R helicase, RapA helicase, and Hef helicase.

[0018] In one embodiment, the natural or modified Dda helicase is derived from the Dda helicases disclosed in Tables 1 and 2 of CN105899678A.

[0019] In one embodiment, the natural or modified Pifl-like helicase is derived from the Pifl-like helicases disclosed in Tables 1 and 2 of CN113930406A.

[0020] In one embodiment, an ectopic bond is introduced between native amino acid residues in the 1A and 2A domains of the helicase. In one embodiment, the ectopic bond includes Lys-His, Lys-Ser, Lys-Thr, Lys-Tyr, Lys-Lys, Lys-Glu, Lys-Asp, Lys-Gln, Lys-Arg, Arg-Glu, Lys-Met, Arg-Asp, Arg-Arg, Tyr-Tyr, Tyr-Trp, Met-Met ectopic bonds, or combinations thereof. In one embodiment, amino acid side chains are directly linked to form a covalent bond or linked via a linker molecule to form an ectopic bond. In one embodiment, the helicase is derived from Dda helicase, preferably T4-Dda helicase.

[0021] In one embodiment, the helicase is derived from T4-Dda helicase, and the helicase comprises:

[0022] (1) The Tyr-Tyr heterop bond formed by x1 and x2;

[0023] (2) The Lys-Gln heterop bond formed by x3 and x4;

[0024] (3) The Tyr-Lys heterop bond formed by x1 and x3;

[0025] (4) The Tyr-Gln heterobonded bond formed between x1 and x4;

[0026] (5) The Tyr-Lys heterop bond formed by x2 and x3;

[0027] (6) The Tyr-Gln heterop bond formed by x2 and x4; or

[0028] (7) Any combination of the above.

[0029] In one embodiment, the helicase comprises any mutant of the 1A domain and / or any mutant of the 2A domain, provided that the helicase retains its ability to control the movement of the target analyte, preferably the target polynucleotide. In one embodiment, the target analyte is modified with one or more proteins or one or more markers, tags, or spacers via methylation, oxidation, or damage. In one embodiment, the target analyte is a target polynucleotide.

[0030] Secondly, this application provides a polypeptide comprising an ectopic bond-forming 1A and 2A domains from the aforementioned helicase, and a polynucleotide-binding domain, but excluding other domains of the helicase.

[0031] Thirdly, this application provides a helicase comprising the polypeptide, wherein the helicase has the ability to control the movement of a preferred target polynucleotide of a target analyte.

[0032] Fourthly, this application provides a construct comprising a helicase or polypeptide and a target polynucleotide bound to its polynucleotide binding domain, wherein two or more amino acid residues located on the surface of the helicase surrounding the polynucleotide binding domain are linked by isopeptide bonds, wherein the bound target polynucleotide is surrounded by the structure formed by the isopeptide bonds.

[0033] In one embodiment, the construct includes an adaptor to which the target polynucleotide is linked, and the construct has the ability to control the movement of the target polynucleotide.

[0034] In one embodiment, the construct comprises two or more of the helicases described above. In one embodiment, the helicase may be any one of the helicases described above, or a combination thereof.

[0035] Fifthly, this application provides a polynucleotide including, or consisting of, sequences encoding the helicase, the polypeptide, or the construct described herein.

[0036] In a sixth aspect, this application provides a vector comprising the polynucleotide operatively linked to a promoter.

[0037] In a seventh aspect, this application provides a host cell, including the aforementioned vector.

[0038] Eighthly, this application provides a method for preparing the helicase, the polypeptide, or the construct, comprising expressing the polynucleotide, transfecting cells with the vector, or culturing the host cells.

[0039] In a ninth aspect, this application provides a method for controlling the movement of a target analyte, preferably a target polynucleotide, comprising contacting the target polynucleotide with the helicase or polypeptide, or the construct, thereby controlling the movement of the target analyte, preferably a target polynucleotide.

[0040] In one embodiment, the method is used to control the movement of a target analyte, preferably a target polynucleotide, through a pore.

[0041] Tenthly, this application provides a method for characterizing a target analyte to select a target polynucleotide, comprising:

[0042] (a) Contacting the target analyte, preferably the target polynucleotide, with a pore and the helicase or polypeptide, or the construct thereof, such that the helicase controls the movement of the target analyte, preferably the target polynucleotide, through the pore; and

[0043] (b) As the target analyte, preferably the target polynucleotide, moves relative to the well, one or more measurements are acquired, wherein the measurements represent one or more characteristics of the target polynucleotide and thereby characterize the target analyte, preferably the target polynucleotide.

[0044] In one embodiment, the target analyte is selected from one or more of polynucleotides, peptides, polysaccharides, and lipids, preferably a polynucleotide or a peptide, polysaccharide, or lipid linked to a polynucleotide, more preferably a single-stranded polynucleotide, a double-stranded polynucleotide, or a partially double-stranded polynucleotide; or

[0045] The target analyte is a target polynucleotide, and the one or more features are selected from (i) the length of the target polynucleotide, (ii) the identity of the target polynucleotide, (iii) the sequence of the target polynucleotide, (iv) the secondary structure of the target polynucleotide; and (v) whether the target polynucleotide is modified.

[0046] In one embodiment, the target polynucleotide is modified with one or more proteins or one or more markers, tags, or spacer regions via methylation, oxidation, or damage. In one embodiment, one or more characteristics of the target analyte, preferably the target polynucleotide, are measured by electrical and / or optical measurements. In one embodiment, the electrical measurements are current measurements, impedance measurements, tunneling measurements, or field-effect transistor measurements.

[0047] In one embodiment, the method includes:

[0048] (a) Contacting the target analyte, preferably the target polynucleotide, with a pore and the helicase or the construct such that the helicase or the construct controls the movement of the target analyte, preferably the target polynucleotide, through the pore; and

[0049] (b) As the target analyte, preferably the target polynucleotide, moves relative to the pore, a current is obtained passing through the pore, wherein the current represents one or more specific features of the target analyte, preferably the target polynucleotide, and thereby characterizes the target analyte, preferably the target polynucleotide.

[0050] In one embodiment, the method further includes the step of applying a voltage across the pore to form a complex between the pore and the helicase or construct. In one embodiment, the target analyte is a target polynucleotide, and at least a portion of the target polynucleotide is double-stranded. In one embodiment, the pore is a nanopore or a transmembrane pore, or the pore is selected from biological pores, solid pores, or biological-solid hybrid pores. In one embodiment, the biological pore is derived from autolysin, leukocytocin, CsGG, Mycobacterium smegmatis porin A (MspA), porin B, porin C, porin D, outer membrane porin F, outer membrane porin G, outer membrane phospholipase A, Neisseria spp. self-transporting lipoprotein, and WZA; the solid pore is derived from graphene nanopores, MoS2 nanopores, BN nanopores, or PA63 nanopores.

[0051] In one aspect, this application provides a method for forming a sensor for characterizing a target analyte, preferably a target polynucleotide, comprising forming a complex between (a) a well and (b) the helicase or polypeptide, or the construct, thereby forming a sensor for characterizing the target analyte, preferably a target polynucleotide.

[0052] In one embodiment, the complex is formed by (a) contacting the pore and the helicase or construct in the presence of the target analyte, preferably a target polynucleotide, and (b) applying a potential across the pore. In one embodiment, the potential is a voltage potential or a chemielectric potential. In another embodiment, the complex is formed by covalently linking the pore to the helicase or construct.

[0053] In a twelfth aspect, this application provides a sensor for characterizing a target analyte, preferably a target polynucleotide, comprising (a) a pore and (b) a complex between the helicase or polypeptide, or the constructs described herein.

[0054] In a thirteenth aspect, this application provides the use of the helicase or polypeptide, or the construct thereof, in controlling the movement of a target analyte, preferably a target polynucleotide, through a pore.

[0055] In a fourteenth aspect, this application provides a kit for characterizing a target analyte, preferably a target polynucleotide, comprising (a) a well and (b) the helicase or polypeptide, or the construct described herein.

[0056] In one embodiment, the kit further includes a chip containing an amphiphilic membrane.

[0057] In a fifteenth aspect, this application provides an apparatus for characterizing a target analyte, preferably a target polynucleotide, comprising (a) a plurality of pores and (b) a plurality of the helicases or peptides or the constructs described herein.

[0058] In one embodiment, the apparatus includes: a sensor device capable of supporting a plurality of wells and operable to characterize a target analyte, preferably a target polynucleotide, using the wells and a helicase or construct; and at least one port for delivering material for characterization. In another embodiment, the apparatus includes: a sensor device capable of supporting a plurality of wells and operable to characterize a target analyte, preferably a target polynucleotide, using the wells and a helicase or construct; at least one memory for storing material for characterization; a flow control system configured to controllably supply material from the at least one memory to the sensor device; and one or more containers for receiving corresponding samples, the flow control system being configured to selectively supply samples from the one or more containers to the sensor device.

[0059] In a sixteenth aspect, this application provides a method for preparing the helicase, comprising:

[0060] (a) Provides a helicase, preferably a Dda helicase, more preferably a T4-Dda helicase; and

[0061] (b) To prepare the helicase by forming an ectopic bond within the protein of the helicase;

[0062] Preferably, step (b) further includes a step of contacting the helicase with a polynucleotide.

[0063] Preferably, the ectopic bond is formed using H2O2, Hemin and H2O2, HRP enzyme and H2O2, transglutaminase, EDC, or Ru catalysis; more preferably, HRP enzyme and H2O2.

[0064] In one embodiment, the method further includes (c) determining whether the obtained helicase is able to control the movement of the target analyte, preferably the target polynucleotide.

[0065] In a seventeenth aspect, this application provides a method for preparing the construct, comprising linking the helicase or polypeptide to an adaptor and thereby preparing the construct.

[0066] In one embodiment, the method further includes determining whether the obtained construct can control the movement of the target analyte, preferably the target polynucleotide.

[0067] In a seventeenth aspect, this application provides a group of two or more helicases linked to a target analyte, preferably a target polynucleotide, wherein at least one of the two or more helicases is one of the aforementioned helicases. Attached Figure Description

[0068] The accompanying drawings are illustrative only and not restrictive.

[0069] Figures 1 to 4 The effects of enzyme cross-linking with the addition of different catalysts are shown.

[0070] Figure 5 The effects of different enzymes on enzyme-locking crosslinking under HRP / H2O2 catalysis according to one embodiment are shown.

[0071] Figure 6 The column purification and elution process of a Tyr-Tyr crosslinked lockase mutant according to one embodiment is shown.

[0072] Figure 7 The image shows a column-purified eluted PAGE gel image of a Tyr-Tyr cross-linked nucleic acid-protein complex according to one embodiment.

[0073] Figure 8 The diagram shows the on-machine test signal of a nucleic acid-protein complex based on Tyr-Tyr crosslinking according to one embodiment. Detailed Implementation

[0074] It should be understood that different applications of the disclosed products and methods may be adapted to the specific needs of the respective art. It should also be understood that the terminology used herein is for the purpose of describing specific embodiments of this application only and is not intended to be limiting.

[0075] Furthermore, unless the context clearly specifies otherwise, as used in this specification and claims, the singular forms “a” and “the” include multiples. For example, a reference to “nucleotide” includes two or more nucleotides, and a reference to “a helicase” includes two or more helicases.

[0076] As used herein, the term "comprising" means that any of the listed elements must be included, and other elements may optionally be included. "consisting of" means that all unlisted elements are excluded. Embodiments defined by each of these terms are within the scope of the embodiments of this application.

[0077] As used herein, “nucleotide sequence,” “DNA sequence,” or “nucleic acid molecule” refers to a polymer of nucleotides (ribonucleotides or deoxyribonucleotides) of any length. The term refers only to the primary structure of the molecule. Therefore, the term includes both double-stranded and single-stranded DNA and RNA.

[0078] As used herein, the term "nucleic acid" refers to a single-stranded or double-stranded covalently linked sequence of nucleotides, wherein the 3' and 5' ends of each nucleotide are linked by a phosphodiester bond. Nucleotides can consist of deoxyribonucleotide or ribonucleotide bases. Nucleic acids can include DNA and RNA and can be synthesized in vitro or isolated from natural resources. Nucleic acids can further include modified DNA or RNA, such as methylated DNA or RNA, or post-translational modified RNA, such as 5'-capping with 7-methylguanosine, 3'-end processing, such as cleavage and polyadenylation, and splicing. Nucleic acids can also include synthetic nucleic acids (XNAs), such as hexetol nucleic acids (HNAs), cyclohexene nucleic acids (CeNAs), threonine nucleic acids (TNAs), glycerol nucleic acids (GNAs), locked nucleic acids (LNAs), and peptide nucleic acids (PNAs). The size of a nucleic acid (or polynucleotide) is typically expressed in terms of the number of base pairs (bp) of a double-stranded polynucleotide, or in the case of a single-stranded polynucleotide, in terms of the number of nucleotides (nts). One thousand bp or nt equals one thousand base pairs (kb). Polynucleotides shorter than about 40 nucleotides are often called "oligonucleotides" and can contain primers used in DNA manipulations, such as by polymerase chain reaction (PCR).

[0079] Polynucleotides, such as nucleic acids, are macromolecules containing two or more nucleotides. The polynucleotide or nucleic acid can contain any combination of any nucleotides. The nucleotides can be naturally occurring or artificially synthesized. One or more nucleotides in the polynucleotide can be oxidized or methylated. One or more nucleotides in the polynucleotide can be damaged. For example, the polynucleotide can contain pyrimidine dimers. Such dimers are commonly associated with damage caused by ultraviolet radiation and are a major cause of skin melanoma. One or more nucleotides in the polynucleotide can be modified, for example, by conventional labeling or tagging. The polynucleotide can contain one or more nucleotides that are abase-free (i.e., lacking a nucleobase) or lacking both a nucleobase and a sugar (i.e., C3).

[0080] The nucleotides in the polynucleotide can be linked to each other in any manner. The nucleotides are typically linked by their sugar and phosphate groups, as in nucleic acids. The nucleotides can also be linked by their nucleobases, as in pyrimidine dimers.

[0081] Polynucleotides can be single-stranded or double-stranded. At least a portion of a polynucleotide is preferably double-stranded. Polynucleotides can be nucleic acids, such as deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). A polynucleotide may contain an RNA strand hybridized to a DNA strand. Polynucleotides can be any synthetic nucleic acid known in the art, such as peptide nucleic acid (PNA), glycerol nucleic acid (GNA), threonine nucleic acid (TNA), locked nucleic acid (LNA), or other synthetic polymers having nucleotide side chains. The PNA backbone consists of repeating N-(2-aminoethyl)-glycine units linked by peptide bonds. The GNA backbone consists of repeating ethylene glycol units linked by phosphodiester bonds. The TNA backbone consists of repeating threoyl groups linked together by phosphodiester bonds. LNAs are formed from the aforementioned ribonucleic acids, having additional bridging structures linking the 2' oxygen and 4' carbon in the ribose moiety. The bridging nucleic acid (BNA) is a modified RNA nucleotide. These can also be referred to as restricted or inaccessible RNA13BNA monomers, which may contain 5-, 6-, or even 7-membered bridging structures and have “fixed” C3'-endo sugar puckering. The bridging structure is synthesized to introduce the 2',4'-position of the ribose to produce 2',4'-BNA monomers.

[0082] The polynucleotide is preferably ribonucleic acid (RNA) or deoxyribonucleic acid (DNA). The polynucleotide can be of any length. For example, the length of the polynucleotide can be at least 10, at least 50, at least 100, at least 150, at least 200, at least 250, at least 300, at least 400, or at least 500 nucleotides or nucleotide pairs. The length of the polynucleotide can be 1000 or more nucleotides or nucleotide pairs, 5000 or more nucleotides or nucleotide pairs, or 100,000 or more nucleotides or nucleotide pairs.

[0083] Any number of polynucleotides can be studied. For example, the methods of the embodiments may involve characterizing 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 50, 100 or more polynucleotides. If two or more polynucleotides are characterized, they may be different polynucleotides or the same polynucleotide.

[0084] Polynucleotides can be naturally occurring or artificially synthesized. For example, the method described can be used to verify the sequence of the prepared oligonucleotides. The method is typically performed in vitro.

[0085] The terms “protein,” “polypeptide,” and “peptide” are further used interchangeably herein to refer to polymers of amino acid residues, as well as variants and synthetic analogs of amino acid residues. Therefore, these terms apply to polymers of amino acids in which one or more amino acid residues are synthetic non-naturally occurring amino acids, such as chemical analogs of the corresponding naturally occurring amino acids, and to polymers of naturally occurring amino acids. Polypeptides may also undergo maturation or post-translational modifications, which may include, but are not limited to, glycosylation, proteolytic cleavage, lipolysis, signal peptide cleavage, propeptide cleavage, phosphorylation, etc.

[0086] Conservative substitution involves replacing an amino acid with another amino acid having a similar chemical structure, similar chemical properties, or similar side chain volume. The introduced amino acid may have similar polarity, hydrophilicity, hydrophobicity, basicity, acidity, neutrality, or charge as the amino acid it replaces. Alternatively, conservative substitution may introduce another aromatic or aliphatic amino acid to replace a pre-existing aromatic or aliphatic amino acid. Conservative amino acid variations are well known in the art and can be selected based on the properties of the 20 major amino acids defined in Table 1 below. In cases where the amino acids have similar polarity, this can also be determined with reference to the hydrophilicity scale of the amino acid side chains in Table 2.

[0087] Table 1 - Chemical properties of amino acids

[0088]

[0089] Table 2 - Hydrophilicity Measurement

[0090] Ile,I 4.5 Val,V 4.2 Leu,L 3.8 Phe,F 2.8 Cys,C 2.5 Met,M 1.9 Ala,A 1.8 Gly,G -0.4 Thr,T -0.7 Ser,S -0.8 Trp,W -0.9 Tyr,Y -1.3 Pro,P -1.6 His,H -3.2 Glu,E -3.5 Gln,Q -3.5 Asp,D -3.5 Asn,N -3.5 Lys,K -3.9 Arg,R -4.5

[0091] As is well known, conserved substitutions between amino acids with similar properties usually do not affect the activity of peptide sequences. Conserved substitutions are shown in Table 3.

[0092] Table 3 Conserved Amino Acid Substitutions

[0093]

[0094] Polynucleotide sequences can be derived and replicated using standard methods in the art. Suitable methods for site-directed mutagenesis are known in the art and include, for example, combinatorial chain reactions. The polynucleotides encoding the embodiments can be prepared using techniques known in the art, such as those described in Sambrook, J. and Russell, D. (2001). Molecular Cloning A Laboratory Manual, 3rd Edition. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

[0095] The obtained polynucleotide sequence can then be integrated into a recombinant reproducible vector, such as a cloning vector. The vector can then be used to replicate the polynucleotide in a compatible host cell. Therefore, the polynucleotide sequence can be prepared by introducing the polynucleotide into a reproducible vector, introducing the vector into a compatible host cell, and allowing the host cell to grow under conditions that induce vector replication. The vector can then be recovered from the host cell.

[0096] Since the four bases that make up DNA—adenine (A), guanine (G), cytosine (C), and thymine (T)—have different molecular structures and sizes, when single-stranded DNA (ssDNA) passes through nanoscale pores under the drive of rate-controlled enzymes (such as the helicase in the embodiments of this application) and an electric field, the differences in the chemical properties of the different bases lead to different amplitudes of current changes when passing through nanopores, protein pores, or transmembrane pores, thereby obtaining the sequence information of the nucleic acid, such as DNA, being measured.

[0097] In one embodiment of a nanopore / protein pore / transmembrane pore sequencing experiment, the nanopore is the only channel through which ions pass between the two sides of the phospholipid membrane. Rate-controlling proteins, such as polynucleotide-binding proteins (e.g., helicases according to the embodiments of this application), act as motor proteins for nucleic acid molecules such as DNA, pulling the DNA strand through the nanopore / protein pore / transmembrane pore sequentially in steps of single nucleotides. Each time a nucleotide passes through the nanopore / protein pore / transmembrane pore, the corresponding pore-clogging signal is recorded. By analyzing these sequence-related current signals using appropriate algorithms, the sequence information of the nucleic acid molecule, such as DNA, can be deduced.

[0098] helicase

[0099] This application provides modified helicases, preferably modified DNA-dependent ATPase helicases (Dda helicases), more preferably T4-Dda helicases. The modification allows the modified helicase to maintain its binding to the preferred analyte polynucleotide for a longer period. The modified helicase retains its ability to control the movement of the preferred analyte polynucleotide. In other words, the modified helicase can still control the movement of the preferred analyte polynucleotide. The degree to which the helicase controls the movement of the preferred analyte polynucleotide is generally altered by the modification, as detailed below.

[0100] In one embodiment, the helicase, preferably Dda helicase, more preferably T4-Dda helicase, is modified. The modified helicase is typically modified relative to the corresponding wild-type or natural helicase. The helicases in the embodiments of this application are artificial or non-natural.

[0101] The ability of helicases to bind or not bind to polynucleotides can be determined using any method known in the art. Suitable binding / non-binding assays include, but are not limited to, native polyacrylamide gel electrophoresis (PAGE), fluorescence anisotropy, calorimetry, and surface plasmon resonance (SPR) assays, such as Biacore. TM Of course, the ability of helicases to unwind polynucleotides can be determined by measuring the time it takes for the helicase to control the movement of the polynucleotide. This can also be determined using any method known in the art. The ability of helicases to control the movement of polynucleotides is typically analyzed in nanopore systems.

[0102] Modified helicases are a useful tool for controlling the movement of polynucleotides during chain sequencing. In one embodiment, the Dda helicase can operate in at least two modes of activity (when the helicase is provided with all the necessary components to promote movement, such as ATP and Mg). 2+The Dda helicase controls DNA movement in two modes: a passive mode (when no necessary components for movement are provided to the helicase) and an inactive mode (when no necessary components for movement are provided). When all necessary components for movement are provided, the Dda helicase moves along the DNA in a 5'–3' orientation, but the orientation of the DNA in the nanopore (depending on which end of the DNA is captured) means that the enzyme can be used to move the DNA out of the nanopore against the direction of the applied field, or to move the DNA into the nanopore with the direction of the applied field. When the 3' end of the DNA is captured, the helicase works against the direction of the field applied by the potential, pulling the helical DNA out of the nanopore and into the cis compartment. However, when the DNA is captured into the nanopore at 5' down, the helicase works with the direction of the field applied by the potential, pushing the helical DNA into the nanopore and into the trans compartment. When no necessary components for movement are provided to the Dda helicase, the Dda helicase can bind to the DNA and act as a brake to slow down DNA movement when the DNA is pulled into the pore by the applied field. In inactive mode, it is not important whether the DNA is trapped with the 3' or 5' end facing down; rather, an applied field pulls the DNA into the nanopore on the opposite side, and the enzyme acts as a brake. The control of DNA movement by the helicase in inactive mode can be described in several ways, including ratcheting, sliding, and braking.

[0103] A problem in sequencing polynucleotides, especially those of 500 or more nucleotides, is that the molecular motors controlling the movement of the polynucleotide can become detached from the polynucleotide. This allows the polynucleotide to be rapidly and uncontrolledly pulled through the pore in the direction of the applied field. The modified helicase of this embodiment does not detach from the polynucleotide being sequenced. When the modified helicase controls the movement of the polynucleotide through the nanopore, it provides an increased polynucleotide read length. The ability of the modified helicase of this embodiment to move an entire polynucleotide through a nanopore under its control allows the polynucleotide to be characterized, such as its sequence, with greater accuracy and speed than known methods. This becomes even more important as chain length increases and as a molecular motor with increased progressiveness is required. The modified helicase of this embodiment is particularly effective for controlling the movement of 500 or more nucleotides, such as 1000, 5000, 10000, 20000, 50000, 100000 or more nucleotides.

[0104] Furthermore, using the modified helicase according to the embodiments of this application means that a lower helicase concentration can be used.

[0105] The modified helicase of this application embodiment is also a useful tool for isothermal polymerase chain reaction (PCR). In this method, the strands of double-stranded DNA are first separated by a helicase and covered with single-stranded DNA (ssDNA)-binding proteins. In a second step, two sequence-specific primers typically hybridize to each edge of the DNA template. The primers annealed to the template can then be extended using DNA polymerase to prepare double-stranded DNA, and the two newly synthesized DNA products can then be used as substrates by the helicase of this application embodiment to proceed to the next round of reaction. Thus, a synchronous chain reaction occurs, resulting in the exponential amplification of the selected target sequence.

[0106] The modified helicase possesses the ability to control the movement of polynucleotides. This ability of the helicase to control polynucleotide movement can be analyzed using any method known in the art. For example, the helicase can be contacted with the polynucleotide, and the position of the polynucleotide can be determined using standard methods. The ability of the modified helicase to control polynucleotide movement is analyzed in a nanopore system.

[0107] The modified helicases of this application embodiment can be isolated, substantially isolated, purified, or substantially purified. If the helicase is completely free of any other components such as lipids, polynucleotides, porous monomers, or other proteins, the helicase is isolated or purified. If the helicase is mixed with a carrier or diluent that does not interfere with its intended use, the helicase is substantially isolated. For example, if the helicase is present in a form containing less than 10%, less than 5%, less than 2%, or less than 1% of other components such as lipids, polynucleotides, porous monomers, or other proteins, the helicase is substantially isolated or substantially purified.

[0108] Any helicase, preferably Dda helicase, and more preferably T4-Dda helicase, can be modified according to the embodiments of this application. In one embodiment, the Dda helicase is T4-Dda helicase.

[0109] Dda helicases typically contain five domains: 1A (RecA motor), 2A (RecA motor), tower, pin, and hook domains (Xiaoping He et al., 2012, Structure; 20:1189-1200). These domains can be identified using the following methods: protein modeling, X-ray diffraction of crystalline proteins (Rupp B (2009). Biomolecular Crystallograph: Principles, Practice and Application to Structural Biology. New York: Gartner and Science.), and nuclear magnetic resonance (NMR) spectroscopy of protein solutions (Mark Rance; Cavanagh, John; Wayne J. Fairbrother; Arthur W. Hunt III; Skelton, N. Nicholas J. (2007). Protein NMR spectroscopy: principles and practice (2 nd (ed.). Boston: Academic Press.) or cryo-electron microscopy of cold-particle hydrated proteins (van Heel M, Gowen B, Matadeen R, Orlova EV, Finn R, Pape T, Cohen D, Stark H, Schmidt R, Schatz M, Patwardhan A (2000). "Single-particle electron cryo-microscopy: towards atomic resolution." Q Rev Biophys. 33:307-69). The structural information of proteins determined by the above methods is publicly available in protein databases (PDB).

[0110] In one embodiment, the modified helicase is further modified to reduce its surface negative charge. Surface residues can be identified in the same manner as the Dda domain described above. Surface negative charges are typically associated with negatively charged amino acids, such as aspartic acid (D) and glutamic acid (E).

[0111] The helicase is preferably modified to neutralize one or more surface negative charges by replacing one or more negatively charged amino acids with one or more positively charged amino acids, uncharged amino acids, nonpolar amino acids, and / or aromatic amino acids, or by introducing one or more positively charged amino acids, preferably adjacent to one or more negatively charged amino acids. Suitable positively charged amino acids include, but are not limited to, histidine (H), lysine (K), and arginine (R). Uncharged amino acids have no net charge. Suitable uncharged amino acids include, but are not limited to, cysteine ​​(C), serine (S), threonine (T), methionine (M), asparagine (N), and glutamine (Q). Nonpolar amino acids have nonpolar side chains. Suitable nonpolar amino acids include, but are not limited to, glycine (G), alanine (A), proline (P), isoleucine (I), leucine (L), and valine (V). Aromatic amino acids have aromatic side chains. Suitable aromatic amino acids include, but are not limited to, histidine (H), phenylalanine (F), tryptophan (W), and tyrosine (Y).

[0112] Preferred substitutions include, but are not limited to, replacing E with R, replacing E with K, replacing E with N, replacing D with K, and replacing D with R.

[0113] Modification of 1A and 2A structural domains

[0114] This embodiment provides a modified helicase that forms an ectopic bond between the 1A and 2A domains of the helicase. Introducing non-natural amino acids is cumbersome and costly, while introducing disulfide bonds results in poor stability and easy cleavage by reducing agents. Conversely, introducing natural side chains into the 1A and 2A domains allows for the formation of ectopic bond amino acid residues, thereby mediating the formation of stable covalent ectopic bonds and improving the enzyme's sustained rate control during sequencing.

[0115] Ex-position bond

[0116] Ectopic bonds are a type of covalent bond formed by the reaction of amino acid R chains (excluding the skeletal peptide bonds) within a protein. Ectopic bonds can form either intramolecularly or intermolecularly in the natural environment. Intramolecular isopeptide bonds generally help proteins respond to environmental stresses and improve their stability (DOI:10.1016 / j.tibs.2010.09.007), while intermolecular isopeptide bonds can be used in the food industry (doi:10.1007 / s12223-013-0287-x) or in protein-protein interaction research. Ectopic bond formation can be categorized into three modes: internal autocatalytic formation, enzymatic catalysis, and chemical catalysis. Specific examples of these three formation methods will be provided below.

[0117] Spontaneous covalent bond formation within proteins: For example, studies have found that Lys-Asp ectovalent bonds (also known as isopeptide bonds) can spontaneously form within proteins in hydrophobic environments and in the presence of carboxyl groups as catalysts (DOI:10.1002 / anie.201004340), commonly seen in CnaA / CnaB proteins. Therefore, by creating a hydrophobic environment and introducing specific reactive and catalytic amino acids, ectovalent bonds can spontaneously form within proteins. These heteropeptide bonds can also be modified into peptide ligase / dual substrate forms, which divide the protein that can spontaneously form heteropeptide bonds into three parts: the catalytic protein and two polypeptides with reactive side chains that can form heteropeptide bonds. The polypeptides with reactive side chains can then be integrated into the site where covalent bonds need to be formed through recombinant protein. Examples of this include SpyTag / KTag heteropeptide bond ligation catalyzed by SpyLiagse based on CnaB (doi / 10.1073 / pnas.ss11113) and SnoopLigase catalyzed by SnoopTagJr / DogTag ligation based on RrgA C-terminal domain, etc.

[0118] Enzymatic catalysis: This type of method involves a variety of reactions, such as the formation of dityrosine or Trityrosine covalent bonds catalyzed by peroxidases (HRP, myeloperoxidase, Tyrosinas, laccase, etc.) (DOI:10.1021 / acsbiomaterials.6b00454). This cross-linking reaction can also be catalyzed by G4-hemin nuclease (DOI:10.1002 / chem.201101941); the formation of Lys-Gln heteropeptide bonds catalyzed by transglutaminase (https: / / doi.org / 10.1016 / j.ijbiomac.2017.10.115); and Lys-Lys cross-linking catalyzed by Lysyl Oxidases (doi:10.1021 / Bm1010195).

[0119] Chemical cross-linking: Chemical cross-linking produces a variety of heteropeptide bonds, such as the heteropeptide bonds formed between the side chains of D / E acidic amino acids and K / R basic amino acids catalyzed by EDC / NHS / S-NHS, the Tyr-Tyr covalent cross-linking catalyzed by H2O2 / Hemin,ruthenium, and the cross-linking between D / E and D / E mediated by diazo-containing cross-linkers (doi.org / 10.1021 / acs.analchem.7b03789).

[0120] Non-Cys-involved ectopic bonds include, but are not limited to: Lys-His, Lys-Ser, Lys-Thr, Lys-Tyr, Lys-Lys, Lys-Glu, Lys-Asp, Lys-Gln, Lys-Arg, Arg-Glu, Lys-Met, Arg-Asp, Arg-Arg, Tyr-Tyr, Tyr-Trp, and Met-Met. These amino acid side chains can directly form covalent bonds or be linked through other linker molecules. In one embodiment, the ectopic bond can be Tyr-Tyr, Lys-Lys, Gln-Lys, Glu-Lys, etc.

[0121] In one embodiment, an ectopic bond is formed between the 1A and 2A domains of the helicase, preferably Dda helicase, more preferably T4-Dda helicase. In another embodiment, an ectopic bond is introduced between the native amino acid residues of the 1A and 2A domains of the helicase.

[0122] In one embodiment, the ectopic bond includes a Tyr-Tyr ectopic bond, a Lys-Lys ectopic bond, a Gln-Lys ectopic bond, a Glu-Lys ectopic bond, or a combination thereof. In one embodiment, the helicase is derived from T4-Dda helicase, and the helicase includes: (1) a Tyr-Tyr ectopic bond formed by x1 and x2; (2) a Lys-Gln ectopic bond formed by x3 and x4; (3) a Tyr-Lys ectopic bond formed by x1 and x3; (4) a Tyr-Gln ectopic bond formed by x1 and x4; (5) a Tyr-Lys ectopic bond formed by x2 and x3; (6) a Tyr-Gln ectopic bond formed by x2 and x4; or (7) any combination thereof.

[0123] In one embodiment, the helicase is further modified to reduce its surface negative charge. In one embodiment, one or more negatively charged amino acids are neutralized by replacing one or more negatively charged amino acids with one or more positively charged amino acids, uncharged amino acids, nonpolar amino acids, and / or aromatic amino acids, or by introducing one or more positively charged amino acids near one or more negatively charged amino acids.

[0124] In one embodiment, the helicase comprises any mutant of the 1A domain or any mutant of the 2A domain, provided that the helicase retains its ability to control the movement of the target analyte, preferably the target polynucleotide.

[0125] In one embodiment, the target analyte comprises a polynucleotide, peptide, polysaccharide, or lipid, preferably a polynucleotide. In one embodiment, the polynucleotide comprises DNA and / or RNA.

[0126] variants

[0127] Variants of helicases, such as variants of Dda helicase, are enzymes having an amino acid sequence that is derived from the wild-type helicase and retains polynucleotide binding activity. Polynucleotide binding activity can be determined using methods known in the art. Suitable methods include, but are not limited to, fluorescence anisotropy assays, tryptophan fluorescence assays, and electrophoretic migration shift assays (EMSA).

[0128] The variant retains helicase activity. This can be determined using a variety of methods. For example, the ability of the variant to translocate along polynucleotides can be determined using electrophysiological methods, fluorescence analysis, or ATP hydrolysis.

[0129] The variants may include various modifications that promote the treatment of the polynucleotide encoding the helicase or promote the activity of the polynucleotide at high salt concentrations and / or room temperature.

[0130] helicase fragment

[0131] Examples provide fragments of helicases, such as fragments of Dda helicase (more preferably T4-Dda helicase), which can be used to prepare the helicases of the embodiments of this application. In one embodiment, the polypeptide comprises a 1A domain and a 2A domain from a Dda helicase (preferably T4-Dda helicase) and does not include any other domains from a Dda helicase, wherein an ectopic bond is formed between the 1A domain and the 2A domain. The polypeptide may include any variant of the 1A domain and 2A domain defined above.

[0132] Construct

[0133] This application also provides a construct comprising the Dda helicase or modified Dda helicase (preferably modified T4-Dda helicase) of this application and an inverse linker, wherein the helicase is linked to the inverse linker and the construct has the ability to control the movement of a target analyte, preferably a target polynucleotide. The construct may be artificial or non-natural.

[0134] In one embodiment, the construct is a useful tool for controlling the movement of preferred target polynucleotides during strand sequencing. The construct of this embodiment does not cause the modified helicase of this embodiment to detach from the sequenced preferred target polynucleotide. As the construct controls the translocation of the preferred target polynucleotide through the nanopore, the construct can even provide longer read lengths for the preferred target polynucleotide.

[0135] Alternatively, target constructs that bind to specific polynucleotide sequences can be designed. As discussed in detail below, the adaptor can bind to a specific polynucleotide sequence and thereby target the helicase portion of the construct to that specific sequence.

[0136] The construct has the ability to control the preferred movement of target polynucleotides by the target analyte. This can be determined as described above.

[0137] The constructs of this application embodiment can be isolated, substantially isolated, purified, or substantially purified. If the construct is completely free of any other components such as lipids, polynucleotides, or porous monomers, the construct is isolated or purified. If the construct is mixed with a carrier or diluent that does not interfere with its intended use, the construct is substantially isolated. For example, if the construct is present in a form containing less than 10%, less than 5%, less than 2%, or less than 1% of other components such as lipids, polynucleotides, or porous monomers, the construct is substantially isolated or substantially purified.

[0138] The Dda helicase can be any Dda helicase. Preferred Dda helicases include, but are not limited to, T4-Dda helicase and its variants. Variants are described above.

[0139] The helicase is preferably a modified Dda helicase, more preferably a T-Dda helicase. The helicase in any embodiment may be present in the construct of this application embodiment.

[0140] The helicase is preferably covalently linked to an adaptor. The helicase can be linked to the adaptor at more than one site, such as two or a single site. The helicase can be linked to the adaptor using any method known in the art.

[0141] The helicase and the adaptor can be prepared separately and then linked together. The two components can be linked in any conformation. For example, they can be linked by their terminal (i.e., amino-terminal or carboxyl-terminal) amino acids. Suitable conformations include, but are not limited to, the amino terminus of the adaptor being linked to the carboxyl terminus of the helicase and vice versa. Alternatively, the two components can be linked by amino acids in their sequence. For example, the polynucleotide-binding moiety can be linked to one or more amino acids in the cyclic region of the helicase. In a preferred embodiment, the terminal amino acid of the polynucleotide-binding moiety is linked to one or more amino acids in the cyclic region of the helicase.

[0142] In a preferred embodiment, the helicase is chemically ligated to the integrator, for example, via one or more linker molecules. Each linker may have two or more functional ends, such as two, three, or four functional ends. Suitable end configurations in the linkers are known in the art. In another preferred embodiment, the helicase is fused to the integrator gene. The helicase is fused to the integrator gene if the entire construct is expressed from a single polynucleotide sequence. The coding sequences of the helicase and the integrator can be combined in any manner to form a single polynucleotide sequence encoding the construct.

[0143] The helicase and the adaptor can be fused in any conformational gene. The helicase and the polynucleotide-binding moiety can be fused via their terminal amino acids. For example, the amino terminus of the polynucleotide-binding moiety can be fused to the carboxyl terminus of the helicase, and vice versa. The amino acid sequence of the polynucleotide-binding moiety is preferably added within the framework to the amino acid sequence of the helicase. In other words, it is preferred that the polynucleotide-binding moiety be inserted into the sequence of the helicase. In this embodiment, the helicase and the adaptor are typically connected at two sites, namely via the amino-terminal and carboxyl-terminal amino acids of the adaptor. If the adaptor is inserted into the sequence of the helicase, it is preferred that the amino-terminal and carboxyl-terminal amino acids of the moiety are very close and each is connected to an adjacent amino acid in the sequence of the helicase or a variant thereof. In a preferred embodiment, the adaptor is inserted into the cyclic region of the helicase.

[0144] The helicase can directly connect to the adaptor. The helicase preferably uses one or more, such as two or three, adaptors as described above to connect to the portion. One or more adaptors can be designed to restrict the mobility of the portion. The helicase and / or the adaptor can be modified to facilitate the connection of one or more adaptors as described above.

[0145] Shearable connectors can be used to help separate the construct from the unconnected component and can be used for further control of the synthetic reaction. For example, a heterogeneous-bifunctional connector can react with helicase but not with the connected portion. If the free end of the connector is used to attach the helicase protein to a surface, unreacted helicase from the first reaction can be removed from the mixture. Subsequently, the connector can be sheared to expose the group that reacts with the integrator. Furthermore, following this sequence of ligation reactions, the reaction conditions with the helicase can be optimized first, and then the reaction conditions with the integrator can be optimized after the connector is sheared. The second reaction can proceed more directly toward the correct site for reaction with the integrator because the connector is confined to the region where it has already been connected.

[0146] Before the helicase / crosslinker complex is covalently linked to the linker, the helicase may be covalently linked to the bifunctional crosslinker. Alternatively, the linker may be covalently linked to the bifunctional crosslinker / partial complex before the helicase is linked to the bifunctional crosslinker. The helicase and the linker may be covalently linked to the chemical crosslinker simultaneously.

[0147] Cross-linking of the helicase or its components can be prevented by maintaining a large excess of the connector concentration in the helicase and / or its components. Alternatively, a "lock and key" setup can be used with two connectors. Only one end of each connector can react together to form a longer connector, and the other ends of the connectors react separately with different portions (i.e., the helicase or its components) of the construct.

[0148] The linkage site is selected such that when the construct comes into contact with the polynucleotide, both the helicase and the adaptor can bind to the polynucleotide and control its movement.

[0149] The helicase and the inverse can facilitate ligation. For example, complementary polynucleotides can be used to bind the helicase and the inverse during hybridization. The helicase binds to a polynucleotide and the inverse can bind to a complementary polynucleotide. The two polynucleotides can then hybridize. This allows the helicase to come into close contact with the inverse, making the ligation reaction more efficient. This is particularly advantageous for controlling the movement of the target polynucleotide by ligating two or more helicases in the correct orientation.

[0150] Tags can be added to the construct to facilitate its purification. These tags can then be chemically or enzymatically cleaved, if necessary. Fluorescent or chromogenic groups may also be included, and these can also be cleaved.

[0151] A simple way to purify the construct is to include different purification tags on each protein (i.e., the helicase and the polynucleotide binding moiety), such as a 6His tag and This method is particularly useful if the two proteins are distinct. Using two tags allows for easy purification of substances that possess both tags. If the two proteins do not have two distinct tags, other methods can be used.

[0152] The construct can be purified from unreacted proteins based on various DNA progressive properties. In particular, the construct can be purified from unreacted proteins based on: increased affinity for the target analyte-preferred polynucleotide, reduced likelihood of detachment from the analyte-preferred polynucleotide after binding, and / or increased readout length of the analyte-preferred polynucleotide as it controls the translocation of the analyte-preferred polynucleotide through the nanopore.

[0153] Alternatively, a target construct that binds to a specific polynucleotide sequence can be designed. The adaptor can bind to the specific polynucleotide sequence and thereby target the helicase portion of the construct to that specific sequence.

[0154] Connector

[0155] In one embodiment, the construct includes an adaptor. In one embodiment, the adaptor is a polypeptide capable of binding to a preferred polynucleotide of the analyte. The adaptor preferably binds specifically to a defined polynucleotide sequence. In some embodiments, the multiple adaptors bind to specific polynucleotide sequences, while binding to different sequences is undetectable. The portion binding to the specific sequence can be used to design constructs that target said sequence.

[0156] In one embodiment, the adaptor has at least one property of interacting with or modifying a polynucleotide. The adaptor can be modified by cleaving the polynucleotide into a single nucleotide or a shorter nucleotide chain, such as two or three nucleotides. The adaptor can also be modified by positioning the polynucleotide or moving it to a specific location, i.e., controlling its movement.

[0157] In one embodiment, the adaptor is derived from a polynucleotide-binding enzyme. A polynucleotide-binding enzyme is a polypeptide capable of binding to and interacting with a polynucleotide and modifying at least one of its properties. The enzyme can modify the polynucleotide by cleaving it into single nucleotides or shorter nucleotide chains, such as dinucleotides or trinucleotides. The enzyme can also modify the polynucleotide by directing or moving it to a specific location. The polynucleotide-binding moiety does not need to exhibit enzymatic activity, as long as it can bind to the polynucleotide and control its movement. For example, the moiety can derive itself from an enzyme modified to remove its enzymatic activity or to be used under conditions that prevent it from functioning as an enzyme.

[0158] In one embodiment, the adaptor-derived autolysin. In one embodiment, the preferred enzyme is an exonuclease, polymerase, helicase, and topoisomerase, such as a helicase.

[0159] In one embodiment, the adaptor is linked to a helicase and a target analyte (preferably a target polynucleotide). In one embodiment, the adaptor is a nucleic acid. In one embodiment, the adaptor is a polynucleotide. In another embodiment, the adaptor includes a double-stranded nucleic acid region capable of linking other double-stranded nucleic acids, such as the target polynucleotide. In one embodiment, the adaptor is a Y-type adaptor. In one embodiment, the adaptor is composed of three DNA strands. In one embodiment, the adaptor includes a spacer region, preferably inserted within the adaptor, or located at the 5' or 3' end of one strand. In one embodiment, the adaptor is a polynucleotide containing a spacer region. In one embodiment, the adaptor is a Y-type polynucleotide containing a spacer region. In one embodiment, the adaptor is a polynucleotide, polypeptide, polysaccharide, or lipid containing a spacer region. The helicase may become stationary on the spacer region of the adaptor. By contacting the helicase and the polynucleotide (or polypeptide, polysaccharide, or lipid) on the adaptor with a transmembrane pore and applying a potential, the stationary helicase can be moved across the spacer region on the adaptor. Since helicases cannot pass through transmembrane pores, the force generated by the movement of the polynucleotide (or polypeptide, polysaccharide, or lipid) of the adaptor across the transmembrane pore along a potential propels the helicase across the spacer region. In one embodiment, multiple adaptors are included. In one embodiment, the adaptor may be part of the target analyte or may not be part of the target analyte. In one embodiment, other adaptors may be intercalated within the target analyte (preferably the target polynucleotide).

[0160] Polynucleotide sequence

[0161] This application provides embodiments of a polynucleotide containing a sequence encoding a helicase, polypeptide, or construct of this application embodiment. The polynucleotide may contain such a sequence. The polynucleotide may be any of the polynucleotides discussed above.

[0162] Any protein described herein can be expressed using methods known in the art. Polynucleotide sequences can be isolated and replicated using standard methods in the art. Chromosomal DNA can be extracted from helicase-producing organisms such as *Burton's methanococcus* and / or SSB-producing organisms such as *Escherichia coli*. The gene-coding sequence of interest can be amplified using PCR with specific primers. The amplified sequence can then be inserted into a recombinant replication vector, such as a cloning vector. The vector can be used to replicate the polynucleotide in a compatible host cell. Thus, a polynucleotide sequence can be prepared by introducing a polynucleotide encoding a reproducible vector, including introducing the vector into a compatible host cell and growing the host cell under conditions that induce vector replication. The vector can be recovered from the host cell. Suitable host cells for cloning polynucleotides are known in the art and are described in more detail below.

[0163] The polynucleotide sequence can be cloned into a suitable expression vector. In the expression vector, the polynucleotide sequence is typically operatively linked to a control sequence that enables expression of the coding sequence via host cells. This expression vector can be used to construct expression structures.

[0164] The term "operable ligation" refers to a juxtaposition where multiple components are positioned in a way that allows them to function in the intended manner. "Operable ligation" of a control sequence to a coding sequence refers to ligation in a manner compatible with the control sequence to achieve expression of the coding sequence. Multiple copies of the same or different polynucleotides can be introduced into the vector.

[0165] The expression vector can then be introduced into a suitable host cell. Therefore, the construct can be prepared by introducing a polynucleotide sequence encoding the construct into an expression vector, including introducing the vector into a compatible bacterial host cell and allowing the host cell to grow under conditions that induce polynucleotide sequence expression.

[0166] The vector can be, for example, a plasmid, virus, or phage vector with an origin of replication, optionally a promoter for expressing the polynucleotide sequence, and optionally a regulatory factor of the promoter. The vector may contain one or more selective marker genes, such as an ampicillin resistance gene. Promoters and other expression regulatory signals compatible with the host cell (to which the expression vector is designed) can be selected. Typically, T7, Trc, lac, ara, or k promoters are used.

[0167] The host cells typically express the construct at high levels. A host cell compatible with the expression vector used to transform the host cells is selected for polynucleotide sequence transformation. The host cells are typically bacteria, preferably *E. coli*. Any cell with λDE3 lysogens, such as Rosetta2(DE3)pLys, C41(DE3), BL21(DE3), JM109(DE3), B834(DE3), TUNER, Origami, and Origami B, can express vectors containing the T7 promoter.

[0168] helicase group

[0169] This application also provides series of two or more helicases that have been linked (or bound) to polynucleotides, wherein at least one of the two or more helicases is a helicase of this application, preferably a Dda helicase, more preferably a T4-Dda helicase. The series may include any number of helicases, such as 2, 3, 4, 5, 6, 7, 8, 9, 10 or more helicases. Any number of helicases may be helicases of this application, preferably Dda helicases, more preferably T4-Dda helicases. All of the two or more helicases are preferably helicases of this application, preferably Dda helicases, more preferably T4-Dda helicases. One or more helicases of this application, preferably Dda helicases, more preferably T4-Dda helicases, may be any helicase discussed above, preferably Dda helicases, more preferably T4-Dda helicases.

[0170] The two or more helicases may be the same or different helicases. For example, if the group includes two or more helicases from the embodiments of this application, preferably Dda helicase, more preferably T4-Dda helicase, the helicases from the embodiments of this application, preferably Dda helicase, more preferably T4-Dda helicase, may be the same or different.

[0171] The group may include any number and combination of helicases from the embodiments of this application, preferably Dda helicases, more preferably T4-Dda helicases. The group of two or more helicases preferably includes at least two helicases from the embodiments of this application, preferably Dda helicases, more preferably T4-Dda helicases. Each helicase, preferably Dda helicase, more preferably T4-Dda helicase, includes the modifications described above, including the formation of an ectopic bond between the 1A and 2A domains.

[0172] In addition to one or more helicases from the embodiments of this application, preferably Dda helicases, more preferably T4-Dda helicases, the group may include one or more helicases that are not part of the embodiments of this application. The one or more helicases may be or be derived from Hel308 helicases, RecD helicases, such as Tral helicases or TrwC helicases, XPD helicases, or Dda helicases. The one or more helicases may be any helicase, modified helicase, or helicase construct disclosed in the following international applications: International Application No. PCT / GB2012 / 052579 (Publication No. WO 2013 / 057495); PCT / GB2012 / 053274 (Publication No. WO 2013 / 098562); PCT / GB2012 / 053273 (Publication No. WO2013 / 098561); PCT / GB2013 / 051925 (Publication No. WO 2014 / 013260); PCT / GB2013 / 051924 (Publication No. WO 2014 / 013259) and PCT / GB2013 / 051928 (Publication No. WO WO 2014 / 013262); and UK Application No. 1318464.3, filed October 18, 2013. In particular, the one or more helicases are preferably modified to reduce the size of the opening in the polynucleotide-binding domain, through which the polynucleotide can be detached from the helicase in at least one conformational state. This is disclosed in WO 2014 / 013260.

[0173] The two or more helicases in the group may be separate from each other. The two or more helicases in the group may bind together through transmembrane pores as the polynucleotide moves through the pores. The two or more helicases in the group may come into contact with each other.

[0174] Preferably, the two or more helicases are not interconnected except by means of polynucleotide linkages. The two or more helicases are preferably not covalently linked.

[0175] The two or more helicases may be linked together or covalently linked together. The helicases may be linked in any order and using any method. A group of linked helicases may be referred to as a team.

[0176] Methods for controlling the preferred target polynucleotide transport of target analytes

[0177] This application provides a method for controlling the movement of a preferred target polynucleotide of a target analyte. The method includes contacting the preferred target polynucleotide of the target analyte with a helicase of the embodiment, preferably a Dda helicase, more preferably a T4-Dda helicase, or a construct of the embodiment of this application, thereby controlling the movement of the preferred target polynucleotide of the target analyte. This method is preferably carried out under a potential applied across the pore. As described in detail below, the applied potential generally results in the formation of a complex between the pore and the helicase or construct. The applied potential can be a voltage potential. Alternatively, the applied potential can be a chemielectric potential. One example is the use of a salt gradient across a zwitterionic layer. Salt gradients are disclosed in Holden et al., J Am Chem Soc. 2007 Jul 11; 129(27): 8650-5.

[0178] This application also provides a method for characterizing a preferred target polynucleotide of a target analyte. The method includes (a) contacting the preferred target polynucleotide of the target analyte with a pore and a helicase of the embodiment, preferably a Dda helicase, more preferably a T4-Dda helicase, or a construct of the embodiment of this application, such that the helicase or construct controls the movement of the preferred target polynucleotide of the target analyte through the pore. The method further includes (b) as the preferred target polynucleotide of the target analyte moves relative to the pore, acquiring one or more measurements, wherein the measurements represent one or more characteristics of the preferred target polynucleotide of the target analyte, thereby characterizing the preferred target polynucleotide of the target analyte.

[0179] In all methods of the embodiments of this application, the helicase can be any helicase as described above for the constructs of the embodiments of this application, including the modified helicases of the embodiments of this application, preferably Dda helicases, more preferably T4-Dda helicases, and helicases not modified according to the embodiments of this application, preferably Dda helicases, more preferably T4-Dda helicases.

[0180] Any number of helicases from the embodiments of this application can be used in these methods, preferably Dda helicases, more preferably T4-Dda helicases. For example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more helicases can be used. If two or more helicases from the embodiments of this application are used, preferably Dda helicases, more preferably T4-Dda helicases, they can be the same or different. Suitable numbers and combinations are as described above in the group of embodiments of this application. They can be equally applied to the methods of the embodiments of this application.

[0181] If two or more helicases are used, they can be linked together. The two or more helicases can be covalently linked. The helicases can be linked in any order and using any method. Preferred helicase constructs used in embodiments of this application are described in International Applications No. PCT / GB2013 / 051925 (Publication No. WO 2014 / 013260); PCT / GB2013 / 051924 (Publication No. WO 2014 / 013259) and PCT / GB2013 / 051928 (Publication No. WO 2014 / 013262) and UK Application No. 1318464.3 filed on October 18, 2013.

[0182] If two or more helicases are used, they are preferably not linked to each other except by polynucleotide linkages. More preferably, the two or more helicases are not covalently linked to each other.

[0183] Steps (a) and (b) are preferably performed under conditions where a potential is applied across the pore as described above. In some cases, the sequence of the target polynucleotide is determined using a current flowing through the pore as the polynucleotide moves relative to it. This is strand sequencing.

[0184] The method described in this application is for characterizing a target analyte, preferably a target polynucleotide. The polynucleotide is as defined above.

[0185] The target polynucleotide, in whole or in part, can be characterized using this method. The target polynucleotide can be of any length. For example, the polynucleotide can be at least 10, at least 50, at least 100, at least 150, at least 200, at least 250, at least 300, at least 400, or at least 500 nucleotide pairs. The polynucleotide can be 1000 or more nucleotide pairs, 5000 or more nucleotide pairs, or 100000 or more nucleotide pairs.

[0186] The target polynucleotide is typically present in any suitable sample. Embodiments of this application are typically implemented on samples known to contain or suspected of containing the target polynucleotide. Alternatively, embodiments of this application may be implemented on samples to confirm the identity of one or more target polynucleotides known to be or expected to be present in the sample.

[0187] The sample may be a biological sample. Embodiments of this application can be performed in vitro on samples obtained or extracted from any organism or microorganism. The organism or microorganism is typically archaic, prokaryotic, or eukaryotic, and generally belongs to one of the following five kingdoms: plant, animal, fungi, anucleate protozoa, and protists. Embodiments of this application can be performed in vitro on samples obtained or extracted from any virus. The sample is preferably a liquid sample. The sample typically includes bodily fluids from a patient. The sample may be urine, lymph, saliva, mucus, or amniotic fluid, but preferably blood, plasma, or serum. Typically, the sample is derived from humans, but alternatively it may be derived from other mammals, such as commercially raised animals like horses, cattle, sheep, or pigs, or from pets such as cats or dogs. Alternatively, plant-derived samples are typically obtained from commercial crops such as cereals, legumes, fruits, or vegetables, such as wheat, barley, oats, brass, corn, soybeans, rice, bananas, apples, tomatoes, potatoes, grapes, tobacco, kidney beans, lentils, sugarcane, cocoa, and cotton.

[0188] The sample may be a non-biological sample. Non-biological samples are preferably liquid samples. Examples of non-biological samples include surgical fluids, water such as drinking water, seawater or river water, and reagents used for laboratory testing.

[0189] Samples are typically processed before use in the embodiments of this application, for example by centrifugation or membrane filtration to remove unwanted molecules or cells, such as red blood cells. Detection can be performed immediately after obtaining the sample. The sample can also typically be stored prior to analysis, preferably below -70°C.

[0190] A pore is a structure that spans a membrane to some extent. It allows hydrated ions to flow across or within the membrane by being driven by an applied electrical potential. A pore typically spans the entire membrane so that hydrated ions can flow from one side of the membrane to the other. However, a pore does not necessarily have to span the membrane. It can be closed at one end. For example, a pore can be a well in the membrane, along which hydrated ions can flow or inflow.

[0191] This application embodiment can use any type of pore. The pore can be biological or artificial. Suitable pores include, but are not limited to, protein pores, polynucleotide pores, and solid pores.

[0192] Suitable membranes are preferably amphiphilic layers. An amphiphilic layer is a layer formed of amphiphilic molecules, such as phospholipids, which are both hydrophilic and lipophilic. The amphiphilic molecules can be synthetic or naturally occurring. The amphiphilic layer can be a monolayer or a bilayer. The amphiphilic layer is typically planar. The amphiphilic layer can be curved. The amphiphilic layer can be supported. The membrane can be a lipid bilayer. A lipid bilayer is formed by two opposing layers of lipids. The two lipid layers are arranged such that their hydrophobic tail groups face each other to form a hydrophobic interior. The hydrophilic head groups of the lipids face outward toward the aqueous environment on each side of the bilayer. The membrane includes a solid layer. The solid layer can be formed of organic and inorganic materials. If the membrane includes a solid layer, pores are typically present in the amphiphilic membrane or in layers included within the solid layer, for example, pores, traps, gaps, channels, trenches, or slits within the solid layer.

[0193] The polynucleotide can be attached to the membrane. This can be accomplished using any known method. If the membrane is an amphipathic molecular layer, such as a lipid bilayer, the polynucleotide is preferably attached to the membrane via a polypeptide present in the membrane or via a hydrophobic anchor present in the membrane. The hydrophobic anchor is preferably a lipid, fatty acid, sterol, carbon nanotube, or amino acid.

[0194] The polynucleotide can be directly attached to the membrane. Preferably, the polynucleotide is attached to the membrane via a connector. Preferred connectors include, but are not limited to, polymers such as polynucleotides, polyethylene glycol (PEG), and polypeptides. If the polynucleotide is directly attached to the membrane, characterization cannot proceed to the end of the polynucleotide due to the distance between the membrane and the helicase, resulting in data loss. Using a connector allows for complete characterization of the polynucleotide. When using a connector, it can be attached to any position on the polynucleotide. The connector is typically attached to the polymer at the tail of the polynucleotide.

[0195] The ligation can be stable or transient. For some applications, the transient nature of the ligation is preferred. If a stable ligation molecule is directly attached to the 5' or 3' end of the polynucleotide, characterization cannot proceed to the end of the polynucleotide due to the distance between the membrane and the active site of the helicase, resulting in data loss. If the ligation is transient, the polynucleotide can be fully characterized when the ligation ends randomly become membrane-free. In a preferred embodiment, the polynucleotide is attached to an amphipathic molecular layer.

[0196] Transmembrane pores or nanopores are preferably transmembrane protein pores, which define channels or pores that allow molecules and ions to translocate from one side of the membrane to the other. The translocation of ionic substances through the pore can be driven by a potential difference applied to either side of the pore. A "nanopore" is a protein pore or transmembrane pore in which the minimum diameter of the channel through which molecules or ions pass is on the nanometer scale (10⁻⁶). -9(meters). In some embodiments, the protein pore can be a transmembrane protein pore, a transmembrane pore, or a nanopore. The transmembrane protein structure of the transmembrane pore can be a monomer or oligomer in nature. Typically, the pore contains multiple polypeptide subunits arranged around a central axis, thereby forming a protein-lined channel that extends substantially perpendicular to the membrane in which the pore resides. There is no limitation on the number of polypeptide subunits. Typically, the number of subunits is 5 to 30, and suitably, the number of subunits is 6 to 10. Alternatively, the number of subunits is not defined as in the case of perfringolysin or related large membrane pores. The protein subunit portions forming the protein-lined channel within the pore typically contain secondary structural motifs that may include one or more transmembrane β-barrels and / or α-helical portions.

[0197] The method of the embodiments can measure two, three, four, five or more features of a polynucleotide. The one or more features are preferably selected from (i) the length of the polynucleotide, (ii) the identity of the polynucleotide, (iii) the sequence of the polynucleotide, (iv) the secondary structure of the polynucleotide, and (v) whether the polynucleotide is modified. In one embodiment, any combination of (i) to (v) can be measured.

[0198] For (i), the length of the polynucleotide can be measured, for example, by determining the amount of interaction between the polynucleotide and the pore or the duration of the interaction between the polynucleotide and the pore.

[0199] Regarding (ii), the identity of a polynucleotide can be measured in several ways, either in conjunction with or without measuring the polynucleotide sequence. The former is simpler; the polynucleotide is sequenced and then identified. The latter can be accomplished in several different ways. For example, the presence of a specific motif in the polynucleotide can be measured (without measuring the rest of the polynucleotide's sequence). Alternatively, the measurement of specific electrical and / or optical signals in the method can identify that the polynucleotide originates from a specific source.

[0200] For (iii), the sequence of the polynucleotide can be determined as previously described. Suitable sequencing methods, particularly those using electrical measurement methods, are described in Stoddart D et al., ProC Natl Acad Sci, 12; 106(19)7702-7, Lieberman KR et al., J Am Chem SoC. 2010; 132(50)17961-72, and International Application WO2000 / 28312.

[0201] Regarding (iv), the secondary structure can be measured using various methods. For example, if the method involves an electrical measurement, the secondary structure can be measured using variations in residence time or changes in the current flowing through the orifice. This allows for the differentiation of regions of single-stranded and double-stranded polynucleotides.

[0202] For (v), the presence of any modification can be measured. The method preferably includes determining whether the polynucleotide has been modified by methylation, oxidation, damage, with one or more proteins or with one or more labels, tags, or by being baseless or lacking nucleobases and sugars. Specific modifications will result in a specific interaction with the pore, which can be measured using the methods described below. For example, methylcytosine can be distinguished from cytosine based on the current flowing through the pore during its interaction with each nucleotide.

[0203] Various types of measurements can be performed. These include, but are not limited to, electrical and optical measurements. Electrical measurements include voltage measurements, capacitance measurements, current measurements, impedance measurements, tunneling measurements (Ivanov AP et al., Nano Lett. 2011 Jan 12; 11(I):279-85), and FET measurements (International Application WO2005 / 124888). Optical measurements can be combined with electrical measurements (Soni GV et al., Rev SciInstrum. 2010 Jan; 81(1)014301). The measurements can be transmembrane current measurements, such as measurements of ion current flowing through the pore. In one embodiment, the electrical or optical measurements can be performed using conventional electrical or optical measurements.

[0204] Electrical measurements can be performed using standard single-channel recording equipment as described in Stoddart D et al., ProC Natl Acad Sci., 12; 106(19)7702-7, Lieberman KR et al., J Am Chem SoC. 2010; 132(50)17961-72 and International Application WO2000 / 28312. Alternatively, electrical measurements can be performed using multi-channel systems, such as those described in International Applications WO2009 / 077734 and WO 2011 / 067559.

[0205] The method preferably employs a transmembrane applied potential. The applied potential can be a voltage potential. Alternatively, the applied potential can be a chemical potential. One example is the use of a transmembrane, such as an amphiphilic molecular layer, salt gradient. Salt gradients are disclosed in Holden et al., J Am Chem SoC. 2007 Jul 11; 129(27):8650-5. In some cases, the current flowing through the pore as the polynucleotide moves relative to it is used to estimate or determine the sequence of the polynucleotide. This is strand sequencing.

[0206] The method may include measuring the current flowing through the pore as the polynucleotide moves relative to the pore. Therefore, the apparatus used in the method may also include circuitry capable of applying a potential and measuring the electrical signal passing through the membrane and the pore. The method may be performed using patch clamp or voltage clamp.

[0207] The method may include measuring the current flowing through the pore as the polynucleotide moves relative to it. Suitable conditions for measuring the ion flow through the transmembrane protein pore are known in the art and disclosed in the embodiments. The method is typically performed by applying a voltage to the membrane and the pore. The voltage used is typically from +5V to -5V, for example from +4V to -4V, from +3V to -3V, or from +2V to -2V. The voltage used is typically from -600mV to +600V or -400mV to +400mV. The voltage used is preferably within a range having a lower limit selected from -400mV, -300mV, -200mV, -150mV, -100mV, -50mV, -20mV, and 0mV, and an upper limit independently selected from +10mV, +20mV, +50mV, +100mV, +150mV, +200mV, +300mV, and +400mV. More preferably, the voltage used is in the range of 100mV to 240mV, and most preferably in the range of 120mV to 220mV. By using an increased applied potential, the recognition of different nucleotides by the pore can be increased.

[0208] The method is typically carried out in the presence of any charge carrier, such as metal salts (e.g., alkali metal salts), halide salts (e.g., chloride salts), or alkali metal chloride salts. The charge carrier may include ionic liquids or organic salts, such as tetramethylammonium chloride, trimethylphenylammonium chloride, phenyltrimethylammonium chloride, or 1-ethyl-3-methylimidazolium chloride. In the exemplary apparatus described above, the salt is present in an aqueous solution within the chamber. Potassium chloride (KCl), sodium chloride (NaCl), cesium chloride (CsCl), or mixtures of potassium ferrocyanide and potassium ferricyanide are commonly used. Mixtures of KCl, NaCl, and potassium ferrocyanide and potassium ferricyanide are preferred. The charge carrier on the membrane may be asymmetric. For example, the type and / or concentration of the charge carrier may differ on each side of the membrane.

[0209] The salt concentration can be saturated. The salt concentration can be 3M or lower, and is typically 0.1 to 2.5M, 0.3 to 1.9M, 0.5 to 1.8M, 0.7 to 1.7M, 0.9 to 1.6M, or 1M to 1.4M. The salt concentration is preferably 150mM to 1M. The method is preferably performed using a salt concentration of at least 0.3M, for example at least 0.4M, at least 0.5M, at least 0.6M, at least 0.8M, at least 1.0M, at least 1.5M, at least 2.0M, at least 2.5M, or at least 3.0M. High salt concentrations provide a high signal-to-noise ratio and allow the presence of the nucleotide to be identified to be indicated by current under normal current fluctuations.

[0210] The method is typically performed in the presence of a buffer solution. In the exemplary apparatus described above, the buffer solution is present in an aqueous solution within the chamber. Any buffer solution can be used in the method of this application embodiment. Typically, the buffer solution is a phosphate buffer. Other suitable buffer solutions are HEPES or Tris-HCl buffer. The method is typically performed at a pH of 4.0 to 12.0, 4.5 to 10.0, 5.0 to 9.0, 5.5 to 8.8, 6.0 to 8.7, 7.0 to 8.8, or 7.5 to 8.5. The pH value used is preferably about 7.5.

[0211] The method can be performed at temperatures ranging from 0°C to 100°C, 15°C to 95°C, 16°C to 90°C, 17°C to 85°C, 18°C ​​to 80°C, 19°C to 70°C, or 20°C to 60°C. The method is typically performed at room temperature. Optionally, the method is performed at a temperature that supports enzyme function, such as approximately 37°C.

[0212] In one embodiment, the method includes:

[0213] (a) Contacting the target analyte, preferably the target polynucleotide, with a well and the helicase or construct of the present invention, such that the target analyte, preferably the target polynucleotide, moves through the well and the helicase or construct controls the movement of the target analyte, preferably the target polynucleotide, through the well; and

[0214] (b) As the target analyte preferred polynucleotide moves relative to the pore, a current is obtained passing through the pore, wherein the current represents one or more features of the target analyte preferred polynucleotide and thereby characterizes the target analyte preferred polynucleotide.

[0215] The method can be implemented using any apparatus suitable for studying membrane / pore systems (where pores are embedded in the membrane). The method can be implemented using apparatus suitable for sensing pores. For example, the apparatus includes a chamber comprising an aqueous solution and a barrier dividing the chamber into two parts. The barrier typically has slits in which a membrane including pores is formed. Alternatively, the barrier forms a membrane in which pores are present. The method can be implemented using the apparatus described in International Application No. PCT / GB08 / 000562 (WO 2008 / 102120).

[0216] The method may include measuring the current through the pore as the target analyte, preferably a polynucleotide, moves relative to the pore. Therefore, the device may also include circuitry capable of applying a potential across the membrane and the pore and measuring the current signal. The method may be implemented using patch clamp or voltage clamp. The method preferably includes the use of voltage clamp. The target polynucleotide may contact the helicase or construct and the pore in any order. Preferably, when the target analyte, preferably a polynucleotide, contacts the helicase or construct and the pore, the target analyte, preferably a polynucleotide, first forms a complex with the helicase or construct. When a potential is applied across the pore, the target analyte, preferably a polynucleotide / helicase or construct complex forms a complex with the pore and controls the movement of the target analyte, preferably a polynucleotide, through the pore.

[0217] sensor

[0218] This application also provides a sensor and method for forming a sensor for characterizing a target analyte, preferably a target polynucleotide. The method includes forming a complex between a well and a helicase of the embodiment, preferably a Dda helicase, more preferably a T4-Dda helicase, an enzyme, or a construct of this application. The helicase can be any helicase described above for the constructs of this application, including the helicases of this application and helicases not modified according to this application. Any number and combination of the Dda helicases of the embodiments discussed above for the groups and methods of this application can be used.

[0219] The complex can be formed by contacting a pore and a helicase or construct in the presence of a target analyte, preferably a target polynucleotide, and then applying a potential to the pore. The applied potential can be a chemielectric potential or a voltage potential, as described above. Alternatively, the complex can be formed by covalently linking the pore to the helicase or construct. Methods of covalent linking are known in the art and, for example, disclosed in International Applications PCT / GB09 / 001679 (Publication No. WO2010 / 004265) and PCT / GB10 / 000133 (Publication No. WO 2010 / 086603). The complex is a sensor for characterizing a target analyte, preferably a target polynucleotide. The method preferably includes forming a complex between a pore derived from an Msp and the helicase or construct of the embodiments of this application. Any of the embodiments of the method discussed above is equally applicable to this method. The embodiments of this application also provide sensors prepared using the methods of the embodiments of this application.

[0220] Reagent test kit

[0221] This application also provides a kit for characterizing a target analyte, preferably a target polynucleotide. The kit includes (a) wells and (b) a helicase, preferably a Dda helicase, more preferably a T4-Dda helicase, or a construct from this application. Any of the embodiments described above with respect to the methods of this application is also applicable to this kit. The helicase can be any helicase described above with respect to the constructs of this application, including the helicases of this application and helicases not modified according to this application. The kit may include any number and combination of the helicases discussed above with respect to the groups and methods of this application, preferably a Dda helicase, more preferably a T4-Dda helicase.

[0222] The kit may further include membrane components, such as phospholipids required to form amphipathic molecular layers, such as lipid bilayers. The kits of this application embodiment may additionally include one or more other reagents or instruments capable of implementing any of the embodiments described above. The reagents or instruments include one or more of the following: suitable buffers (aqueous solutions), tools for obtaining samples from a recipient (such as catheters or needle-containing instruments), tools for amplifying and / or expressing polynucleotides, such as membranes or voltage clamp or patch clamp devices as defined above. The reagents present in the kit may be in a dry state, such that liquid samples resuspend the reagents. The kit may also optionally include instruments enabling the kit to be used in the methods of this application embodiment or instructions regarding which patients the method may be used for. The kit may optionally include nucleotides.

[0223] Device

[0224] This application also provides an apparatus for characterizing a target analyte, preferably a target polynucleotide. The apparatus includes multiple wells and multiple helicases, preferably Dda helicases, more preferably T4-Dda helicases, multiple helicases from this application, or multiple constructs from this application. The apparatus preferably further includes a specification for implementing the methods of this application. The apparatus can be any conventional apparatus for the analysis of a target analyte, preferably a polynucleotide, such as an array or chip. Any of the embodiments of the methods discussed above can be equally applied to the apparatus of this application. The helicase can be any helicase described above for the constructs of this application, including helicases from this application and helicases not modified according to this application. The apparatus can include any number and combination of the helicases discussed above for the groups and methods of this application, preferably Dda helicases, more preferably T4-Dda helicases. The apparatus is preferably assembled for implementing the methods of this application.

[0225] In one embodiment, the apparatus preferably comprises:

[0226] A sensor device capable of supporting multiple wells and operablely using the wells and helicases or constructs for the characterization of preferred polynucleotides of target analytes; and

[0227] At least one port is used to pass the material being characterized.

[0228] Alternatively, the device preferably includes:

[0229] A sensor device capable of supporting multiple wells and operablely using the wells and helicases or constructs for the characterization of preferred polynucleotides of target analytes; and

[0230] At least one memory for storing materials used for characterization.

[0231] The device more preferably includes:

[0232] A sensor device capable of supporting the membrane and multiple pores, and operable to use the pores and helicase or construct for the characterization of preferred polynucleotides of target analytes;

[0233] At least one memory for storing materials used for characterization;

[0234] A flow control system configured to controllably supply material to the sensor device from at least one memory; and one or more containers for receiving samples, the flow control system being configured to selectively supply samples to the sensor device from the one or more containers. The device may be any of those described in International Application No. PCT / GB08 / 004127 (Publication No. WO2009 / 077734), PCT / GB10 / 000789 (Publication No. WO 2010 / 122293), International Application No. PCT / GB10 / 002206 (Publication No. WO 2011 / 067559), or International Application No. PCT / US99 / 25679 (Publication No. WO 00 / 28312).

[0235] Methods for preparing helicases

[0236] This application also provides a method for preparing the modified helicase of this application. The method includes providing a helicase, preferably a Dda helicase, more preferably a T4-Dda helicase, to form the modified helicase of this application.

[0237] The method preferably further includes determining whether the helicase can control the movement of the target analyte, preferably a polynucleotide. The analysis performed on this is described above. If the movement of the target analyte, preferably a polynucleotide, can be controlled, then the helicase is correctly modified and the helicase of the present application embodiment is obtained. If the movement of the target analyte, preferably a polynucleotide, cannot be controlled, then the helicase of the present application embodiment is not obtained.

[0238] Methods for preparing constructs

[0239] This application also provides a method for preparing the construct. The method includes linking, and preferably covalently linking, the helicase of this application, preferably Dda helicase, more preferably T4-Dda helicase, to an adapter. Any helicase and adapter described above can be used in this method.

[0240] The method preferably further includes determining whether the construct can control the movement of the target analyte, preferably a polynucleotide. The analysis performed on this is described above. If the movement of the target analyte, preferably a polynucleotide, can be controlled, the helicase and the adaptor are correctly linked, and the construct of the present application embodiment is obtained. If the movement of the target analyte, preferably a polynucleotide, cannot be controlled, then the construct of the present application embodiment is not obtained.

[0241] The aforementioned prior art is incorporated herein by reference in its entirety.

[0242] The following examples are used to illustrate the embodiments of this application, but are not intended to be limiting.

[0243] Example 1:

[0244] Enzyme cross-linking mediated under different catalytic systems

[0245] Main chain S1: 5'-3333333333333333333333333333- GCGGAGTCAAACGGTAGAAG TCGTTTTTTTTTT(SEQ ID NO:1)-8888- ACTGCTCATTCGGTCCTGCTGAC T(SEQ ID NO:2)-3'

[0246] Antisense chain S2: 5'- CGACTTCTACCGTTTGACTCCGC (SEQ ID NO:3)-3'

[0247] Link chain YB: 5'P- GTCAGCAGGACCGAATGA (SEQ ID NO:4) / i2OMeG / / i2OMeC / / i2OMeA / / i2OMeG / / i2OMeU / / i2OMeA / / i2OMeG / / i2OMeU / / i2OMeC / / i2OMeC / / i2OMeA / / i2OMeG / / i2OMeC / / i2OMeA / / i2OMeC / / i2OMeC / / i2OMeG / / i2OMeA / / i2OMeC / / i2OMeC / -3' The host chain S1, antisense chain S2, and linker chain YB were synthesized respectively, and the three were mixed in a ratio of 1:1.1:1.1 and annealed to form a linker. Specifically, the annealing process involved slowly cooling from 95℃ to 25℃, with a cooling rate not exceeding 0.1℃ / s.

[0248] Four reaction systems were prepared. For each system, 1 μM of the linker was added, along with 7.5 times the amount of T53 (T4 DDA-E94Y / N365Y, wild-type T4DDA sequence as shown in SEQ ID NO: 5). Additionally, systems were prepared without a catalyst, and systems were prepared with 100 μM H2O2, 50 μM Hemin / 100 μM H2O2, and 0.1 U HRP / 100 μM H2O2 respectively. The mixtures were incubated at 30 °C for 18 h, and then TBE PAGE was performed at 160 V for 40 min to detect enzyme cross-linking. The results are shown below. Figure 1 As shown. Figure 1 As shown, the nucleic acid-protein complex is a complex of the adaptor and the helicase. The addition of H2O2 enables the formation of an effective cross-linking product, and the catalytic effect of HRP enzyme is significantly better than that of other catalysts.

[0249] Two reaction systems were prepared. For each system, 1 μM of the linker was added, along with 5 times the amount of Q1 (T4DDA-E93Q) protein. Additionally, 0.1 U of microbial transglutaminase was added as a catalyst, and the mixtures were incubated at 37°C for 36 h. The enzyme cross-linking was then detected using a TBE gel electrophoresis system at 160 V for 40 min. The results are as follows: Figure 2 As shown, the nucleic acid-protein complex is a complex of an adaptor and a helicase. The addition of microbial transglutaminase can form an effective cross-linked product.

[0250] Two reaction systems were prepared. For each system, 1 μM of the linker was added, along with 5 times the amount of Q11 (T4DDA-E94G) protein. Alternatively, 5 mM EDC was added as a catalyst, and the mixtures were incubated at 30°C for 4 h. Afterward, TBE PAGE gel electrophoresis was performed at 160 V for 40 min to detect enzyme cross-linking. Results are as follows: Figure 3 As shown, the nucleic acid-protein complex is a complex of an adaptor and a helicase. The addition of EDC enables the formation of an effective cross-linking product.

[0251] Example 2: Ru-catalyzed Tyr-amino-locking enzyme reaction

[0252] Main chain S1: 5'-333333333333333333333333333333-GCGGAGTCAAACGGTAGAAGTCGTTTTTTTTTT (SEQ ID NO: 1)-8888-ACTGCTCATTCGGTCCTGCTGAC T (SEQ ID NO: 2)-3'

[0253] Antisense chain S2: 5'-Ru-CGACTTCTACCGTTTGACTCCGC(SEQ ID NO:3)-3'

[0254] Connecting chain YB: 5'P-GTCAGCAGGACCGAATGA(SEQ ID NO:4) / i2OMeG / / i2OMeC / / i2OMeA / / i2OMeG / / i2OMeU / / i2OMeA / / i2OMe G / / i2OMeU / / i2OMeC / / i2OMeC / / i2OMeA / / i2OMeG / / i2OMeC / / i2OMeA / / i2OMeC / / i2OMeC / / i2OMeG / / i2OMeA / / i2OMeC / / i2OMeC / -3'

[0255] The main chain S1, antisense chain S2, and linker chain YB were synthesized separately, and then mixed and annealed in a ratio of 1:1.1:1.1 to form a linker. The annealing process involved slowly cooling from 95℃ to 25℃, with the cooling rate not exceeding 0.1℃ / s.

[0256] Two reaction systems were prepared. For each system, 2 μM of the linker was added, along with 4 times the amount of T49 (T4 DDA-E94Y) or 4 times the amount of T53 protein / 1 mM 1,4-butanediamine. The mixtures were then incubated at 30°C for 30 min. Afterward, 1.25 mM sodium persulfate was added to each system, and the mixtures were placed under LED light at 450 nm (light power 50 mW / cm²) for cross-linking. 2 (15cm distance), then TBEPAGE gel was run at 160V for 40min and its enzyme cross-linking was detected. The results are as follows. Figure 4 As shown. The nucleic acid-protein complex is a complex of the adaptor and the helicase. Under Ru light catalysis, cross-linking of the enzyme can be clearly observed (Y94-K364 in T49; Y94 and N365Y in T53 are cross-linked with 1,4-butanediamine).

[0257] Example 3: HRP crosslinking reaction of different Tyr-Tyr mutants

[0258] Three reaction systems were prepared. For each system, 1 μM of the linker was added, along with 7.5 times the amount of T52 (T4DDA-E94Y / G357Y) / T53 / T61 (T4DDA-A372Y) protein and 0.1 UHRP / 100 μM H2O2. The mixtures were incubated at 30°C for 18 h, and then TBE PAGE was performed at 160 V for 40 min to detect enzyme cross-linking. The results are as follows: Figure 5 As shown, all three selected Tyr-Tyr mutants exhibited good enzyme-locking cross-linking effects under HRP / H2O2 catalysis.

[0259] Implementation 4: Preparation of nucleic acid-protein complexes based on Tyr-Tyr crosslinks

[0260] The enzyme cross-linking product catalyzed by HRP / H2O2 in Example 1 was added to a DNAPac PA200 column and purified with elution buffer to remove enzymes that were not bound to the linker and impurities such as unreacted EDC from the column.

[0261] The nucleic acid-protein complex was then eluted with a 10-column volume mixture of buffer A and buffer B. The main elution peak was then collected, its concentration was measured, and a TBE PAGE gel was run at 160V for 40 minutes. Buffer A consisted of 20 mM Na-CHES, 250 mM NaCl, 4% (w / v) glycerol, pH 8.6; Buffer B consisted of 20 mM Na-CHES, 1 M NaCl, 4% (w / v) glycerol, pH 8.6. The elution process was as follows: Figure 6 As shown, each peak during the elution process was collected and detected using a TBE PAGE gel at 160V for 40 min. The results are as follows. Figure 7 As shown, E3 is the required nucleic acid-protein complex.

[0262] Example 5: Instrumental testing of nucleic acid-protein complexes based on Tyr-Tyr crosslinks

[0263] A 10kb library was prepared using end-repair techniques and then ligated to the nucleic acid-protein complex from Example 4. Finally, sequencing was performed on a QNome-3841 microarray from QiCarbon Technology Co., Ltd., and the actual sequencing signal is shown below. Figure 8 As shown, this nucleic acid-protein complex can generate sequencing signals normally, and the signal steps are clear, allowing for subsequent base estimation. Complete library per-well signals can be observed. This indicates that the helicase forming Tyr-Tyr heterotopic bonds between the 1A and 2A domains can control the movement of target polynucleotides and can be used for sequencing polynucleotides via nanopores. Subsequent analysis of its sequencing signal revealed that it is superior to the traditional disulfide crosslinking (referring to the nucleic acid-protein complex formed by T4Dda-E94C / A360C) form in terms of noise and signal-to-noise ratio. The analysis results are shown in Table 3.

[0264] Example 6: Sequencing accuracy analysis based on Tyr-Tyr crosslinking

[0265] A randomly fragmented Human genome library was prepared using end-repair techniques and then ligated to the library with the nucleic acid-protein complex from Example 4 or the SAC-M1 (a nucleic acid-protein complex formed by T4Dda-E94C / A360C) cross-linked with disulfide bonds. Sequencing was then performed on a QNome-3841 from QiCarbon Technology Co., Ltd. Under the same small dataset training scale, the accuracy obtained based on Tyr-Tyr cross-linking was higher than that of the traditional disulfide bond cross-linking method. The analysis results are shown in Table 4.

[0266] Table 3 - Sequencing signals of nucleic acid-protein complexes based on Tyr-Tyr crosslinks

[0267] Normalized noise 0.245 0.274 noise 1.991 2.359 Signal-to-noise ratio 8.893 7.757

[0268] Table 4 - Sequencing accuracy analysis based on Tyr-Tyr crosslinking

[0269] Traditional disulfide bond locking enzymes 0.261 0.324 85.36 T53 lockase 0.222 0.279 86.96

[0270] The parameters in Tables 3 and 4 have the following meanings:

[0271] 1. Normalized noise: The signal value of each read is normalized by the median absolute deviation (MAD). The signal and noise are separated by median filtering. The root mean square (RMS) value of the noise is calculated as an indicator of normalized noise. The smaller the normalized noise value, the less noise interference the signal level is affected, that is, the higher the clarity of the signal.

[0272] 2. Noise: Perform median filtering on the signal value of each read to obtain the filtered noise signal. Calculate the root mean square (RMS) value of the noise signal as an indicator of noise, reflecting the relative intensity of noise. The smaller the noise value, the less noise interference.

[0273] 3. Signal-to-noise ratio (SNR): The signal value of each read is standardized by the median absolute deviation (MAD). The signal and noise are separated by median filtering. The SNR is expressed as the ratio of signal power to noise power. The higher the SNR value, the better the signal quality and the less noise interference.

[0274] 4. Train loss: This is the error between the prediction result and the actual result of the neural network model during the training process of the training dataset.

[0275] 5. Valuation loss: This is the error between the predicted results of the validation dataset and the actual results obtained through a neural network model.

[0276] 6. ACC: This is the accuracy of the results predicted by a neural network model on a validation dataset compared to the actual results.

Claims

1. A helicase derived from T4-Dda helicase, wherein the mutation compared to wild-type T4-Dda helicase consists of E94Y and N365Y, wherein an ectopic bond is formed between E94Y and N365Y, and the amino acid sequence of wild-type T4-Dda helicase is shown in SEQ ID NO:

5.

2. The helicase according to claim 1, wherein the helicase retains its ability to control the movement of polynucleotides.

3. A construct comprising a helicase according to any one of claims 1-2, and a target polynucleotide bound to its polynucleotide binding domain, wherein E94Y and N365Y in the helicase are linked by an ectopic bond, and the bound target polynucleotide is surrounded by the structure formed by the ectopic bond.

4. The construct according to claim 3, comprising an adaptor, wherein the target polynucleotide is connected to the adaptor, and the construct having the ability to control the movement of the target polynucleotide.

5. The construct according to claim 4, wherein the construct comprises two or more helicases according to any one of claims 1-2.

6. A polynucleotide comprising, or consisting of, a sequence encoding the helicase of any one of claims 1-2, the construct of any one of claims 3-5.

7. A vector comprising the polynucleotide of claim 6 operably linked to a promoter.

8. A host cell comprising the vector of claim 7.

9. A method for preparing the helicase according to any one of claims 1-2 or the construct according to any one of claims 3-5, comprising expressing the polynucleotide according to claim 6, transfecting cells with the vector according to claim 7, or culturing the host cells according to claim 8.

10. A method for controlling the movement of a target analyte, comprising contacting the target analyte with a helicase according to any one of claims 1-2, thereby controlling the movement of the target analyte.

11. The method of claim 10, wherein the method is used to control the movement of the target analyte through the orifice.

12. A method for characterizing a target analyte, comprising: (a) Contacting the target analyte with a well and the helicase according to any one of claims 1-2, such that the helicase controls the movement of the target analyte through the well; and (b) As the target analyte moves relative to the orifice, one or more measurements are acquired, wherein the measurements represent one or more features of the target analyte and thereby characterize the target analyte.

13. The method according to any one of claims 10-12, wherein the target analyte is selected from one or more of polynucleotides, peptides, polysaccharides, and lipids.

14. The method according to any one of claims 10-12, wherein the target analyte is selected from polypeptides, polysaccharides, and lipids linked to polynucleotides.

15. The method according to any one of claims 10-12, wherein the target analyte is a single-stranded polynucleotide, a double-stranded polynucleotide, or a partially double-stranded polynucleotide.

16. The method of claim 12, wherein the target analyte is a target polynucleotide, and the one or more features are selected from (i) the length of the target polynucleotide, (ii) the identity of the target polynucleotide, (iii) the sequence of the target polynucleotide, (iv) the secondary structure of the target polynucleotide; and (v) whether the target polynucleotide is modified.

17. The method of claim 12, wherein one or more characteristics of the target analyte are measured by electrical and / or optical measurements.

18. The method of claim 17, wherein the electrical measurement is a current measurement, impedance measurement, tunneling measurement, or field-effect transistor measurement.

19. The method of claim 12, wherein the method further comprises the step of applying a voltage across the pore to form a complex between the pore and the helicase.

20. The method of claim 12, wherein the pore is a nanopore or a transmembrane pore, or the pore is selected from biological pores, solid pores, or pores that are a hybrid of biological and solid components.

21. The method of claim 20, wherein the biopore-derived autolysin, leukocidin, CsGG, Mycobacterium smegmatis porin A, porin B, porin C, porin D, outer membrane porin F, outer membrane porin G, outer membrane phospholipase A, Neisseria spp. autotransport lipoprotein, and WZA; The solid pores are derived from graphene nanopores, MoS2 nanopores, BN nanopores, or PA63 nanopores.

22. A method for forming a sensor for characterizing a target analyte, comprising forming a complex between (a) a pore and (b) a helicase according to any one of claims 1-2 and thereby forming a sensor for characterizing the target analyte.

23. A sensor for characterizing a target analyte, comprising (a) a pore and (b) a complex between the helicases of any one of claims 1-2.

24. A kit for characterizing a target analyte, comprising (a) a well and (b) the helicase as described in any one of claims 1-2.

25. An apparatus for characterizing a target analyte, comprising (a) a plurality of wells and (b) a plurality of helicases as described in any one of claims 1-2.

26. A method for preparing the helicase according to any one of claims 1-2, comprising: (a) Provide T4-Dda helicase; and (b) To prepare the helicase according to any one of claims 1-2 by forming an ectopic bond within the protein of the helicase.

27. The method of claim 26, wherein step (b) further comprises contacting the helicase with a polynucleotide.

28. The method of claim 26, wherein the ectopic bond is formed using catalysis of H2O2, Hemin and H2O2, HRP enzyme and H2O2, transglutaminase, EDC, or Ru.

29. A method for preparing the construct according to any one of claims 3-5, comprising linking the helicase according to any one of claims 1-2 to the adaptor and thereby preparing the construct.

30. A group of two or more helicases linked to a target analyte, wherein at least one of the two or more helicases is a helicase according to any one of claims 1-2.

Images