A specific detection kit for detecting the main epidemic strain of new coronavirus

Abstract

The application discloses a specific detection kit for distinguishing a main epidemic variant of a novel coronavirus, relates to the technical field of biomedical detection, and comprises primer probe groups for detecting the novel coronavirus variants XBB and XDV, and can be used for specifically detecting the novel coronavirus XBB strain and the novel coronavirus XDV strain. Compared with the existing fluorescent quantitative PCR detection method, the application has the advantages of high accuracy and fast detection speed, and has great clinical practical value.

Description

Technical Field

[0001] This invention relates to the field of biomedical detection technology, and in particular to a rapid detection kit for COVID-19 XBB and XDV based on recombinase polymerase amplification (RPA) technology. Background Technology

[0002] XBB is an Omeprone subtype variant, primarily characterized by increased transmissibility and immune evasion. Studies indicate that while XBB's pathogenicity is not significantly enhanced, its immune evasion is higher due to the mutant strain's ability to bind better to human cell receptors. Symptoms of XBB subtype infection include difficulty breathing, headache, sore throat, nasal congestion, body aches, fatigue, and fever. Scientists describe the resistance of XBB subvariants to antibodies developed from vaccination and infection as "worrying." They found that XBB subvariants are more effective than BQ subvariants in evading booster shots; these two subvariants are the most effective at evading vaccine protection to date.

[0003] XDV (also known as XDV.1) is a multi-recombinant variant of the Omicron sublineage. It incorporates genomic information from the XBB lineage (which is itself a recombinant) and the JN.1 spike protein (including an FLiRT mutation). In other words, the XDV variant is a subbranch of the SARS-CoV-2 JN.1 variant. Since the end of 2023, the JN.1 variant has gradually become the dominant strain globally, and XDV, as one of its subbranches, has also gradually attracted scientific attention. According to the latest data from the Chinese Center for Disease Control and Prevention (CDC), the proportion of XDV variants in influenza-like illness cases has increased. Because it is a multi-recombinant variant, it may have different transmission characteristics and the ability to evade existing immune protection. Currently, it is unclear whether XDV.1 will pose a significant threat to public health, but its prevalence in Asia and other regions will be closely monitored. Global health agencies are strengthening the monitoring and research of XDV.1 to assess its potential impact on vaccine efficacy, treatment strategies, and public health measures. Clinical observations show that the symptoms of XDV variant infection are generally mild. However, it is worth noting that the elderly and people with chronic underlying diseases such as hypertension and diabetes are still at high risk of infection and progression to severe illness.

[0004] In conclusion, detecting XDV and XBB variants is of great significance for timely understanding their transmission, assessing their impact on public health and safety, and providing a scientific basis for prevention and control measures.

[0005] To accurately identify the XBB and XDV variants of the novel coronavirus, molecular real-time diagnostic methods, including RT-PCR (Reverse Transcription-Polymerase Chain Reaction), are commonly used. For example, some domestic companies and research institutions have developed PCR detection reagents for JN.1.

[0006] Although quantitative real-time PCR is currently the preferred method for virus detection, it has the following limitations: (1) It is prone to aerosol contamination, which can lead to false positives. It requires professionally trained technicians with PCR certification, a professionally certified PCR laboratory, and expensive temperature control and analysis instruments; (2) Traditional quantitative real-time PCR involves two steps: nucleic acid extraction and amplification detection. It takes at least 1.5-2 hours from sampling to obtaining the test results. Although multiplex PCR real-time amplification technology using a single target gene has recently been developed, its amplification detection process, which takes up to 90-120 minutes, and the stringent requirements for experimental equipment and personnel are obviously not suitable for rapid detection. Summary of the Invention

[0007] The purpose of this invention is to address the shortcomings of existing technologies by providing a kit, primer and probe set, amplification system, and applications for the specific detection of SARS-CoV-2 variants XDV and XBB. This invention features high accuracy and fast detection speed, enabling specific detection of SARS-CoV-2 XBB and XDV.

[0008] To achieve the above-mentioned objectives of this invention, the following technical solution is adopted:

[0009] This invention provides a specific detection kit for distinguishing and detecting major circulating variants of the novel coronavirus, the specific detection kit comprising a first kit for specifically detecting the XBB strain and a second kit for specifically detecting the XDV strain;

[0010] The primer and probe set of the first kit includes:

[0011] The upstream primer has the nucleotide sequence shown in SEQ ID No. 1;

[0012] SEQ ID No.1: ACTGAAATCTATCAGGCCGGTAACATACCTT;

[0013] The downstream primer has the nucleotide sequence shown in SEQ ID No. 2;

[0014] SEQ ID No.2: ACTACTACTCTGTATGGTTGGTGACCAACAC;

[0015] The primer and probe set of the second kit includes:

[0016] The upstream primer has the nucleotide sequence shown in SEQ ID No. 3;

[0017] SEQ ID No.3: GTCTCGTCGGCGGCCACGTAGTGTAGCTAGT;

[0018] The downstream primer has the nucleotide sequence shown in SEQ ID No. 4;

[0019] SEQ ID No. 4: TAACACTAATAGTAAAATTTGTGGGTATGGC.

[0020] Furthermore, the probes in the primer and probe sets of both the first and second kits are modified fluorescent probes, wherein,

[0021] The sequence of the probe in the first kit is shown in SEQ ID No. 5;

[0022] S gene:

[0023] SEQ ID No. 5: GCAGGTCTAATTGTTACTCTCCTTTACAA / i6Cy5dT / idSp / A / iBHQ1dT / ATGGTTTCCGACCCAC (C3 Spacer);

[0024] The sequence of the probe in the second kit is shown in SEQ ID No. 6;

[0025] S gene:

[0026] SEQ ID No. 6: CGTAGTGTAGCTAGTCAATCCATCATTGCC / i6HEXdT / A / idSp / AC / iBHQ1dT / ATGTCACTTGGTGCA(C3 Spacer).

[0027] Based on this, the present invention provides an application of the above-mentioned kit in the specific detection of the SARS-CoV-2 variants XBB and XDV.

[0028] Furthermore, the method of application includes the following steps:

[0029] RNA is provided from the sample to be tested, and then isothermal amplification is performed using the primer pair, amplification kit, and rapid detection kit described above for the specific detection of the SARS-CoV-2 variants XBB and XDV.

[0030] Furthermore, the sample to be tested includes at least one of XBB and XDV liquid internal quality control samples.

[0031] Furthermore, in the multi-enzyme isothermal amplification reaction system, the initial concentration of primers is 2-50 mmol / L, and the initial concentration of magnesium acetate is 50-280 mmol / L.

[0032] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0033] 1. The rapid detection kit for SARS-CoV-2 variants XBB and XDV based on recombinase polymerase amplification (RPA) technology provided by this invention can be widely used in clinical detection of SARS-CoV-2 variants XBB and XDV.

[0034] 2. This invention integrates primer and probe sets into a single amplification system, realizing the miniaturization of a real-time rapid amplification and detection system, providing technical support for the identification of unknown SARS-CoV-2 variants XBB and XDV, enabling early identification, early detection, and early treatment. Attached Figure Description

[0035] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0036] Figure 1 This is a sensitivity measurement curve of real-time RT-RPA for the SARS-CoV-2 variant strain XBB in Example 3.

[0037] Figure 2 This is a sensitivity measurement curve of real-time RT-RPA for the SARS-CoV-2 variant strain XDV in Example 3.

[0038] Figure 3 This is a specificity measurement curve of real-time RT-RPA for the SARS-CoV-2 variants XBB and XDV, as shown in Example 4. Detailed Implementation

[0039] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0040] According to one aspect of the present invention, a primer pair, amplification kit, and application for the specific detection of SARS-CoV-2 variants XBB and XDV are provided. The kit includes a primer and probe set for detecting XBB and XDV. Compared with existing quantitative real-time PCR detection methods, it has the advantages of high accuracy and fast detection speed.

[0041] Specifically, the beneficial effects of this application can be summarized as follows:

[0042] (1) This invention uses the S gene as the detection target, designs RPA detection primers and probes, and then establishes a detection method based on isothermal amplification.

[0043] (2) The RPA primers and probes for detecting XBB and XDV of the present invention can be used to detect the XBB and XDV variants of the novel coronavirus in clinical patients or outpatient screening. The kit of the present invention has the characteristics of specificity, low cost, sensitivity, and portability. The kit of the present invention can effectively and specifically detect single-reaction single-copy or higher variants of the novel coronavirus XBB and XDV.

[0044] (3) Using the RPA primers and probes of the present invention, one or more different fluorescence signals can be detected in one reaction, and multiple samples can be detected simultaneously, which effectively simplifies the system design and avoids inaccuracies caused by different optical inspection times of samples.

[0045] (4) Compared with the "gold standard" real-time fluorescence quantitative PCR, the kit of the present invention has higher accuracy and sensitivity, and the detection can be completed within 15 minutes.

[0046] (5) The present invention uses the S gene of the novel coronavirus variants XBB and XDV as the detection target to design primers and probes for RPA detection, and the detection accuracy is high.

[0047] (6) The present invention uses a multi-enzyme optimized ratio and freeze-drying to form dry powder enzyme in amplification tube, which eliminates the reverse transcription process, optimizes the detection time and operation steps, and makes the method simpler.

[0048] (7) The RPA primers and probes of this invention have been verified by clinical real patient throat swab samples, with a 100% concordance rate, very high accuracy and specificity, and are more convincing in terms of clinical application trial results.

[0049] In a preferred embodiment of the present invention, the kit includes a primer and probe set for detecting SARS-CoV-2 variants XBB and XDV. This kit can be used to detect SARS-CoV-2 variants XBB and XDV with high accuracy and speed, yielding results in approximately 15 minutes.

[0050] It should be noted that the modification sites of the fluorescent probe in this application are as follows:

[0051] FAM is a fluorescent group;

[0052] Further fluorescent groups could be Texas Red, TAMRA, ROX, HEX, and JOE.

[0053] BHQ1 is a quenching group;

[0054] THF tetrahydrofuran modification sites;

[0055] Spacer C3 is a 3' end spacer modification.

[0056] According to one aspect of the present invention, the primer pair, amplification kit, and application described above for the specific detection of SARS-CoV-2 variants XBB and XDV are used to detect SARS-CoV-2 variants XBB and XDV.

[0057] It should be noted that the application of the primer pair, amplification kit, and application described above for the specific detection of the novel coronavirus variants XBB and XDV is for non-therapeutic purposes.

[0058] In a preferred embodiment of the present invention, the application method includes the following steps:

[0059] RNA is provided from the sample to be tested, and then multi-enzyme isothermal amplification is performed using the primer pair, amplification kit, and application detection kit described above for the specific detection of the SARS-CoV-2 variants XBB and XDV.

[0060] In the preferred embodiment described above, the sample to be tested includes at least one of the SARS-CoV-2 variant XBB and XDV (RNA) liquid internal quality control samples.

[0061] In the preferred embodiments described above, the initial concentrations of primers in the multi-enzyme isothermal amplification reaction system are all 2-10 mmol / L, and the initial concentrations of magnesium acetate are 50-280 mmol / L.

[0062] Preferably, the method of using the kit includes the following steps:

[0063] (1) RNA template extraction: Extract RNA from the sample to be tested;

[0064] (2) RPA amplification reaction: Using the RNA extracted in step (1) as a template, and using the RPA primers and probes in the kit, the RPA amplification reaction was carried out in the RPA reaction tube.

[0065] (3) Fluorescence detection analysis of RPA amplification products.

[0066] It should be noted that the above kit includes an amplification reaction system containing primer and probe sets for detecting the SARS-CoV-2 variants XBB and XDV. Specifically, the reaction system for this RPA amplification reaction is 50 μL:

[0067] Template RNA 1.0~10μL;

[0068] Upstream primer: 1.0–5.0 μL;

[0069] Downstream primer: 1.0–5.0 μL;

[0070] Probe primers: 0.5–5 μL;

[0071] Rehydration buffer 29.5 μL;

[0072] Magnesium acetate 0.5~2.5μL;

[0073] Add RNase-free sterilized deionized water to a final volume of 50 μL;

[0074] The initial concentrations of both the upstream and downstream primers are 1–10 mmol / L, and the initial concentration of magnesium acetate is 50–280 mmol / L.

[0075] Furthermore, the PRA amplification reaction is carried out at a temperature of 25℃ to 42℃ and for a duration of 1 to 60 minutes, preferably at 39℃ for 3 to 15 minutes.

[0076] More preferably, the fluorescence detection analysis can utilize any instrument capable of recognizing and acquiring fluorescence signals, and its luminescent genes include, but are not limited to, the FAM channel, as well as fluorescent detection groups such as Cy3, Cy5, Texas Red, Alexa Flour, ROX, and all series of JOE.

[0077] More preferably, the isothermal reaction can be carried out using any device capable of temperature control, including but not limited to water baths, thermostats, and visual thermostats.

[0078] The technical solution of the present invention will be further described below with reference to specific embodiments and data.

[0079] Note: In this invention, unless otherwise specified, the term target gene should be understood as a whole gene segment. The gene is not limited to the segment involved by the primer probe, but can also be other regions of the gene that can be designed with primers.

[0080] In this invention, the fluorescent probe is not limited to FAM, but can also be other fluorescent excitation groups such as GFP, Texas Red, DAPI, AlexaFluor@488, FITC, Cy3, Cy5, Cy7, ROX, JOE and Alexa Fluor@750.

[0081] In this invention, the test sample may be at least one of the following: viral nucleic acid template, throat swab, viral culture medium, or sputum containing SARS-CoV-2 variants XBB and XDV. Those skilled in the art or relevant testing personnel can understand the specific meaning of the above terms in this invention according to the specific circumstances.

[0082] In this invention, the dry powder enzyme components—Bsu DNA polymerase, single-stranded DNA binding protein SSB, recombinase Cre that can bind single-stranded nucleic acids (oligonucleotide primers), and reverse transcriptase—are all commercially available finished products.

[0083] In the following examples, the reagents, instruments, etc. used were all commercially available.

[0084] Example 1: Primer and probe design.

[0085] Based on the S gene base sequences of the SARS-CoV-2 variants XBB and XDV published by NCBI, highly specific gene base sequences were identified and compared. Primers were then creatively designed according to primer design principles, and parameters such as GC content of the designed primers were verified to ensure that they reached the optimal range.

[0086] Meanwhile, corresponding probes were designed according to the design principles of RPA probe primers (Table 1). The designed primer sets were sent to Shanghai Jereh Biotechnology Co., Ltd. for synthesis. After obtaining the primers, they were diluted with RNase-free water to 10 mmol / μL for later use.

[0087] Specifically, the primers and probes targeting the S gene of the SARS-CoV-2 XBB and XDV strains are as follows:

[0088] Table 1. Primer and probe sequences

[0089]

[0090] The primers and probes described above can be used to detect the S gene of SARS-CoV-2 XBB and XDV.

[0091] Example 2: RPA amplification system.

[0092] A kit for the specific detection of SARS-CoV-2 variants XBB and XDV and its application, the kit comprising the primers and probes of Example 1;

[0093] The kit also includes rehydration buffer, magnesium acetate, RNase-free water, sterile deionized water, RNA extraction kit (QIAamp Viral RNA Kits(50)), and dry powder enzymes; the dry powder enzymes are Bsu DNA polymerase, single-stranded DNA binding protein SSB, and recombinase Cre that can bind single-stranded nucleic acids (oligonucleotide primers) in a certain proportion of lyophilized powder.

[0094] It should be noted that the RNA extraction kit is used to extract RNA from the sample to be tested as a template; the RNA extraction kit can be a conventional commercially available RNA extraction kit. In this embodiment, the RNA extraction kit used is the QIAGEN QIAamp Viral RNA Kits.

[0095] The kit in this example includes the following RPA amplification reaction system:

[0096] The RPA amplification reaction system for detecting the SARS-CoV-2 variants XBB and XDV contains the primer and probe set for detecting the SARS-CoV-2 variants XBB and XDV described in Example 1.

[0097] The RPA amplification system for the S gene of the SARS-CoV-2 XBB and XDV strains comprises, in 50 μL increments:

[0098] Template DNA 1.0~10μL;

[0099] Upstream primer: 1.0–5.0 μL;

[0100] Downstream primer: 1.0–5.0 μL;

[0101] Probe primers: 0.5–5 μL;

[0102] Rehydration buffer 29.5 μL;

[0103] Magnesium acetate 0.5~2.5μL;

[0104] Dry powder enzyme;

[0105] Add RNase-free sterilized deionized water to a final volume of 50 μL;

[0106] The method of using the reagent kit includes the following steps:

[0107] (1) RNA template extraction: RNA was extracted from the sample to be tested, with RNase-free deionized water as a negative control.

[0108] (2) RPA amplification reaction: Using the RNA extracted in step (1) as a template, and using the RPA primers and probes in the kit, the RPA amplification reaction was carried out in the RPA reaction tube.

[0109] Example 3: Sensitivity detection of RPA primers.

[0110] (1) Provide the kit of Example 2, and add each reagent according to the following reaction system, specifically including:

[0111] Add 2.1 μL of upstream primer, 2.1 μL of downstream primer, 0.6 μL of probe, 29.5 μL of rehydration buffer, and 3.2 μL of RNase-free sterile deionized water to an RPA amplification tube (containing dry powder enzyme). After the dry powder in the amplification tube is completely dissolved, add 10 μL of template, centrifuge briefly at 2,000 rpm, and add 2.5 μL of magnesium acetate activator.

[0112] (2) Immediately place the reaction tube in a pre-set instrument that can collect fluorescence signals. The RPA reaction conditions are 39°C, reaction time is 10 minutes, and fluorescence signals are collected every 30 seconds.

[0113] The specific sensitivity detection fluorescence signal graph is shown below. Figure 1 As shown, the XBB and XDV amplified fluorescence signals of the novel coronavirus can be detected in as little as 1 minute, and the detection sensitivity can reach 3 copies / μL within 10 minutes.

[0114] Example 4: Specificity detection of RPA primers.

[0115] The specificity of RPA primers was verified using SARS-CoV-2 variants XBB and XDV, other strains, and PBS buffer as templates. RNA from SARS-CoV-2 variants XBB and XDV was extracted directly using a purchased kit, and its concentration was measured and converted to copy number. The RNA was then diluted 10-fold to create a series of concentration gradients, including 10-10... 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL and 1 copy / L.

[0116] The kit of Example 2 is provided. The reagents for the sample are added according to the following reaction system, specifically including: 2.1 μL of upstream primer, 2.1 μL of downstream primer, 0.6 μL of probe primer, 29.5 μL of rehydration buffer, and 3.2 μL of RNase-free sterile deionized water to the RPA amplification tube. After the dry powder in the amplification tube is completely dissolved, add 10 μL of template, centrifuge briefly at 2,000 rpm, and add 2.5 μL of magnesium acetate activator.

[0117] Immediately place the reaction tube into a pre-set instrument capable of collecting fluorescence signals. The RPA reaction conditions are 39°C, reaction time is 10 minutes, and fluorescence signals are collected every 30 seconds.

[0118] The results of specific specific tests are as follows: Figure 3 As shown, common bacteria and viruses isolated from oral sputum and the respiratory tract that have been identified were selected, including H1N1, H3N2, rhinovirus, respiratory syncytial virus, Mycoplasma pneumoniae, and wild-type and delta variants of SARS-CoV-2 (see details). Figure 3 The samples were cultured using standard methods, and the final concentration was determined. Nucleic acid was extracted and converted into copy number to achieve a concentration of 10. 5 The nucleic acid template was extracted using a Qiagen genome extraction kit at a concentration of copies / μL. After extraction, the concentration was measured using Nanodrop and adjusted to a uniform concentration of 10. 5 Copies / μL were used for non-specific amplification detection using the kit and RPA amplification method described in Example 2. Figure 3 It can be seen that the primer amplification test for the novel coronavirus only detected the XBB and XDV variants of the novel coronavirus, while the others were negative, and no non-specific amplification was observed.

[0119] Example 5: Comparison and verification of RPA method and real-time PCR method.

[0120] Selected COVID-19 XBB and XDV (10 4 The correlation between RPA amplification and the real-time PCR method was verified using copies / μL as templates.

[0121] The RPA reaction was performed according to the following reaction system, with each reagent added separately. Primers and probes for gene detection were added separately. Specifically, 2.1 μL of the upstream primer, 2.1 μL of the downstream primer, 0.6 μL of the probe primer, 29.5 μL of rehydration buffer, and 3.2 μL of RNase-free sterile deionized water were added to the RPA amplification tube. After the dry powder in the amplification tube was completely dissolved, 10 μL of template was added, and the tube was briefly centrifuged at 2,000 rpm. Then, 2.5 μL of magnesium acetate activator was added.

[0122] Immediately place the RPA reaction tube into a pre-set instrument capable of collecting fluorescence signals. The RPA reaction conditions are 39°C, reaction time is 10 minutes, and fluorescence signals are collected every 30 seconds.

[0123] The real-time PCR reaction was performed using the detection primers and probes recommended by the WHO and a commercially available quantitative detection kit. The reaction system is shown in Table 2.

[0124] S gene:

[0125] 5x QIAGEN® RT-PCR buffer 10 μL;

[0126] dNTP mix 2μL;

[0127] 5x Q-solution 10 μL;

[0128] Forward primer (5 µM) 6 μL;

[0129] Reverse primer (5 µM) 6 μL;

[0130] 2 μL of enzyme mixture;

[0131] RNase inhibitor (20 U / µL) 0.5 μL;

[0132] 9 μL of deionized water;

[0133] 5 μL of viral nucleic acid;

[0134] A total of 50 μL.

[0135] The reaction conditions were: PCR enzyme activation (pre-denaturation) for 15 min at 95 °C;

[0136] Cyclic amplification:

[0137] Table 2. Quantitative PCR Detection Procedure

[0138]

[0139] Table 3 shows the detection of various variant strains of SARS-CoV-2 that have been clinically confirmed by PCR using the RPA method in this embodiment. As can be seen from Table 3, this method can detect the presence of SARS-CoV-2 XBB and XDV within 2 minutes at the fastest, and can complete viral gene detection within 10 minutes. The accuracy fitting results analysis with quantitative PCR amplification results show that there is no significant difference between the detection results of the RPA method in this embodiment and the detection results of quantitative PCR, with a fitting rate of 100%. Currently, the gold standard for nucleic acid detection is still quantitative PCR, indicating that the detection efficiency of the method we established is the same as that of quantitative PCR, but the detection time is greatly shortened, and it is only for XBB and XDV variant strains.

[0140] Table 1 Clinical Sample Testing

[0141]

[0142]

[0143] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A specific detection kit for detecting major circulating variants of the novel coronavirus, characterized in that, The specific detection kit includes a first kit for specific detection of the XBB strain and a second kit for specific detection of the XDV strain. The primer and probe set of the first kit includes: The upstream primer has the nucleotide sequence shown in SEQ ID No. 1; SEQ ID No.1: ACTGAAATCTATCAGGCCGGTAACATACCTT; The downstream primer has the nucleotide sequence shown in SEQ ID No. 2; SEQ ID No.2: ACTACTACTCTGTATGGTTGGTGACCAACAC; The primer and probe set of the second kit includes: The upstream primer has the nucleotide sequence shown in SEQ ID No. 3; SEQ ID No.3: GTCTCGTCGGCGGCCACGTAGTGTAGCTAGT; The downstream primer has the nucleotide sequence shown in SEQ ID No. 4; SEQ ID No.4: TAACACTAATAGTAAAATTTGTGGGTATGGC; The probes in the primer and probe sets of both the first and second kits are modified fluorescent probes, wherein... The sequences of the probes in the first kit are shown below: GCAGTCCTAATTGTTACTCTCCTTTACAA / i6Cy5dT / idSp / A / iBHQ1dT / ATGGTTTCCGACCCAC(C3 Spacer); The probe sequences in the second kit are shown below: CGTAGTGTAGCTAGTCAATCCATCATTGCC / i6HEXdT / A / idSp / AC / iBHQ1dT / ATGTCACTTGGTGCA(C3 Spacer).

Images