Trichoderma spicatum 6311 with biological control ability to phytophthora capsici and application thereof

Abstract

The application belongs to the technical field of microorganisms, and discloses a Trichoderma brevicompactum 6311 with biological control ability on Phytophthora capsici, which is named as 6311, classified as Trichoderma brevicompactum, and has a preservation number of CGMCC No. 41489, a preservation date of August 13, 2024, and a preservation unit of No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, China Microbial Culture Collection Committee General Microorganism Center. The fermentation liquor of the Trichoderma brevicompactum 6311 has the ability to inhibit the growth of the mycelium of Phytophthora capsici on a plate, and the inhibition rate reaches 100 %. The germination rate, radicle and hypocotyl length, growth index and fresh weight of pepper seeds soaked by the fermentation liquor of the Trichoderma brevicompactum 6311 are improved. The research shows that the Trichoderma brevicompactum 6311 has biological control potential, and provides a theoretical basis for the application of the Trichoderma brevicompactum 6311 as a biological fungicide.

Description

Technical Field

[0001] This invention belongs to the field of microbial technology, and in particular to a short-lived Trichoderma 6311 strain with biocontrol capabilities against Phytophthora capsici and its application. Background Technology

[0002] Phytophthora capsici is a fungal pathogen that can cause rot and wilting in various crops. Chili pepper cultivation is highly susceptible to Phytophthora capsici, and the disease often occurs rapidly within a short period, leading to severe yield reduction or even crop failure. The sporangia of Phytophthora capsici can directly germinate and invade plant cells or produce zoospores. These zoospores are released into water, attach to the plant roots, and produce reproductive tubes that penetrate plant cells, causing the chili peppers to wilt. Phytophthora capsici is one of the most common soil-borne fungal diseases in the world, occurring at all stages of chili pepper growth. It exists in the soil in various forms, commonly including chlamydospores, zoosporangia, and oospores, and causes serious soil pollution. Phytophthora capsici can survive in the soil for extended periods, therefore soil contaminated with Phytophthora capsici is a major cause of Phytophthora capsici disease in chili peppers.

[0003] Chemical pesticides are currently the most common method for controlling Phytophthora blight in peppers. However, long-term application of pesticides can easily lead to resistance in Phytophthora capsici. Therefore, the use of biocontrol bacteria and their metabolites as alternatives to traditional chemical pesticides has been proposed. Trichoderma can inhibit Phytophthora growth, enhance plant resistance to pathogens, and promote plant growth. It has been successfully developed into a commercial biocontrol agent, effectively controlling various pathogens such as Phytophthora, Fusarium, and Pythium. Trichoderma antagonizes pathogens through various direct and indirect mechanisms. The direct mechanisms of Trichoderma biocontrol include competition for space and nutrients, fungal parasitism, and the secretion of lysin and antibiotics. For example, Trichoderma hyphae surround and penetrate Phytophthora capsici hyphae, causing hyphal collapse. Simultaneously, it can use spores to enter Phytophthora capsici oospores, develop hyphae, and produce conidia, leading to the decomposition of the Phytophthora capsici oospores. The "gelatinous virin" antibiotic produced by Trichoderma viride can inhibit the growth of Phytophthora species, significantly reducing the incidence rate by 62.64%. Indirect mechanisms mainly involve inducing plant resistance, increasing plant resistance to stress, and promoting root growth. For example, after treating lilac seedlings with Trichoderma afroharzianum T52 bio-fertilizer, the number of lateral roots increased significantly, and the disease incidence rate of the plants decreased by 12.28% compared with the control; Trichoderma kanana and Trichoderma citrinum inhibited cucumber diseases caused by Pythium.

[0004] Although *Trichoderma* has been used as a biocontrol strain for a long time, existing literature lacks sufficient research on the biocontrol of *Trichoderma brevicompactum* against *Phytophthora capsici*, especially regarding its metabolites. This study isolated a highly effective disease-resistant and growth-promoting *Trichoderma brevicompactum* strain from the rhizosphere soil of continuously cropped peppers in Handan and Baoding cities, Hebei Province, China. Research on this strain revealed that its sterile fermentation broth promoted pepper seed germination; the fermentation broth achieved a 100% inhibition rate against *Phytophthora capsici* mycelia over 5 days. This invention is the first to determine the relative concentration of siderophores in *Trichoderma brevicompactum*, finding it to be significantly higher than other *Trichoderma* strains (72.88%). This provides support for the effective control of *Phytophthora capsici* in peppers and the promotion of sustainable pepper production. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of the prior art and provide a short-dense Trichoderma 6311 strain with biocontrol capabilities against Phytophthora capsici and its applications.

[0006] The technical solution adopted by this invention to solve its technical problem is:

[0007] A strain of *Trichoderma brevicompactum* 6311 with biocontrol capabilities against *Phytophthora capsici* has been identified. Its name is 6311, its taxonomic name is *Trichoderma brevicompactum*, its accession number is CGMCC No. 41489, its accession date is August 13, 2024, and its depository is the China General Microbiological Culture Collection Center, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0008] Furthermore, the colony and cell characteristics of the strain are as follows: aerial mycelium is well-developed on PDA plates, the colonies are fluffy to felt-like, white, thick and fluffy, raised, and in obvious concentric circles. After 5 days, the PDA plates are covered with a large number of dark green or yellowish-green spores, and the back is yellowish-brown.

[0009] Furthermore, the strain has the potential for biocontrol.

[0010] Furthermore, the fermentation broth of the aforementioned Trichoderma 6311 can inhibit the growth of Phytophthora mycelia, with an inhibition rate of 100%.

[0011] The *Trichoderma 6311* strain exhibits hyperparasitic activity against *Phytophthora capsici*. 6311 showed the highest activity in siderophore experiments and produced the growth hormone IAA at a yield of 14.56 mg / L, indicating its potential for disease suppression and growth promotion. In in vitro fruit experiments, 6311 inhibited the growth of *Phytophthora capsici* on pepper fruits. Furthermore, the fermentation broth of *Trichoderma 6311* showed 100% inhibition of *Phytophthora capsici* mycelial growth on agar plates. Pepper seeds soaked in the 6311 fermentation broth showed improved germination rate, radicle and hypocotyl length, growth index, and fresh weight.

[0012] An application of *Trichoderma 6311* as described above in the preparation of biocontrol agents for *Phytophthora capsici*.

[0013] The advantages and positive effects of this invention are as follows:

[0014] 1. This invention isolated 60 bacterial strains from the rhizosphere soil of chili peppers, and obtained one biocontrol bacterium with high antagonistic activity against *Phytophthora capsici*. Morphological and molecular identification revealed that the strain belonged to the *Trichoderma* genus, including one strain, *Trichoderma brevicompactum*. *Trichoderma brevicompactum* 6311 showed an inhibition rate of up to 82.22% against *Phytophthora capsici* mycelial growth. Microscopic and scanning electron microscopy (SEM) observations revealed that 6311 exhibited hyperparasitic activity against *Phytophthora capsici*. 6311 showed the highest activity in siderophore experiments and produced the growth hormone IAA (14.56 mg / L), indicating that 6311 has the potential to inhibit disease and promote growth. In in vitro fruit experiments, 6311 inhibited the growth of *Phytophthora capsici* on chili pepper fruits. Simultaneously, the fermentation broth of *Trichoderma brevicompactum* 6311 showed the ability to inhibit *Phytophthora capsici* mycelial growth on agar plates, with an inhibition rate reaching 100%. Pepper seeds soaked in 6311 fermentation broth showed improved germination rate, hypocotyl length, growth index, and fresh weight. This study demonstrates that *Trichoderma brevis* 6311 possesses biocontrol potential and provides a theoretical basis for its application as a biofungicide.

[0015] 2. In July and September 2023, a large number of pepper plants in Hebei Province, China, died from Fusarium wilt. This invention collected rhizosphere soil samples from a small number of healthy pepper plants to determine the presence of biocontrol fungi that could inhibit Phytophthora capsici. This invention isolated a highly effective antagonistic Trichoderma 6311 from the rhizosphere and evaluated its inhibitory effects and mechanisms against Phytophthora capsici on plates and fruits. The disease-suppressing and growth-promoting functions of different Trichoderma fermentation broths were also explored. In summary, this study screened out the highly effective disease-suppressing and growth-promoting biocontrol fungus Trichoderma short-density 6311, providing a basis for the prevention and long-term effective control of Fusarium wilt in peppers, as well as reducing fungicide use and ensuring environmental safety. Attached Figure Description

[0016] Figure 1 The following are experimental images of different confrontation treatments inhibiting Phytophthora in this invention after 5 days: (a) Phytophthora control culture; (b) confrontation culture of 6311 and Phytophthora; (c) 6311 hyphae entwining Phytophthora hyphae under a 400x optical microscope; (d) inhibition rate of 6 biocontrol bacteria against Phytophthora; (e) 6311 hyphae entwining Phytophthora hyphae.

[0017] Figure 2 These are morphological and molecular identification images of the biocontrol bacteria in this invention; (a) morphological characteristics of *Trichoderma* 2221; (b) conidia of *Trichoderma* 6311 under a microscope; (c) phylogenetic tree of 6311. These two phylogenetic trees were constructed based on *its* sequences and closely related phylogenetic species (type cultures) obtained using the NCBIBLAST search tool. Sequence alignment was performed using the clusterW sequence alignment tool in mega11 software; GenBank numbers for isolates and closely related species are added in parentheses.

[0018] Figure 3 The image shows the growth of peppers 4 days after inoculation with *Phytophthora infestans* in this invention; the first row, left image, represents the 6311 treatment group; the first row, right image, represents the *Phytophthora infestans* treatment group; the second row shows the inhibition rate of mycelial growth of *Phytophthora infestans* on pepper fruits by the five *Trichoderma* treatment groups.

[0019] Figure 4 This is a graph showing the iron-carrier production capacity of Trichoderma under double-layer plate culture in this invention; where (a) 6311; (b) the relative iron carrier concentration of the six Trichoderma treatment groups.

[0020] Figure 5 The following are experimental results on the inhibition of *Phytophthora infestans* by different treatments of fermentation broth after 5 days in this invention: (a) 6311; (b) *Phytophthora infestans* control; (c) inhibition rate of *Phytophthora infestans* mycelial growth by 6 *Trichoderma* fermentation broths.

[0021] Figure 6 The graph shows the indexes of the treatment groups inoculated with six different Trichoderma fermentation broths in this invention. The first row of the left graph shows the germination potential (5d) and germination rate (10d) of different treatments after inoculation with the fermentation broth. The first row of the right graph shows the germination index of different treatments after 5d of inoculation with the fermentation broth. The second row of the left graph shows the hypocotyl and radicle length of different treatments after 10d of inoculation with the fermentation broth. The second row of the right graph shows the fresh weight of different treatments after 10d of inoculation with the fermentation broth. Detailed Implementation

[0022] The present invention will be further described below with reference to the embodiments. The following embodiments are descriptive and not limiting, and should not be used to limit the scope of protection of the present invention.

[0023] The various experimental operations involved in the specific embodiments are all conventional techniques in the field. For parts not specifically annotated in this document, those skilled in the art can refer to various commonly used reference books, scientific and technological documents or related instructions and manuals prior to the filing date of this invention to carry out the operations.

[0024] A strain of *Trichoderma brevicompactum* 6311 with biocontrol capabilities against *Phytophthora capsici* has been identified. Its name is 6311, its taxonomic name is *Trichoderma brevicompactum*, its accession number is CGMCC No. 41489, its accession date is August 13, 2024, and its depository is the China General Microbiological Culture Collection Center, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0025] Preferably, the colony and cell characteristics of the strain are as follows: the aerial mycelium is well-developed on the PDA plate, the colony is fluffy to felt-like, white, thick and fluffy, raised, and in obvious concentric circles. After 5 days, the PDA plate is covered with a large number of dark green or yellowish-green spores, and the back is yellowish-brown.

[0026] Preferably, the strain has biocontrol potential.

[0027] Preferably, the fermentation broth of the short-dense Trichoderma 6311 can inhibit the growth of Phytophthora mycelia, with an inhibition rate of 100%.

[0028] The *Trichoderma 6311* strain exhibits hyperparasitic activity against *Phytophthora capsici*. 6311 showed the highest activity in siderophore experiments and produced the growth hormone IAA at a yield of 14.56 mg / L, indicating its potential for disease suppression and growth promotion. In in vitro fruit experiments, 6311 inhibited the growth of *Phytophthora capsici* on pepper fruits. Furthermore, the fermentation broth of *Trichoderma 6311* showed 100% inhibition of *Phytophthora capsici* mycelial growth on agar plates. Pepper seeds soaked in the 6311 fermentation broth showed improved germination rate, radicle and hypocotyl length, growth index, and fresh weight.

[0029] An application of *Trichoderma 6311* as described above in the preparation of biocontrol agents for *Phytophthora capsici*.

[0030] Specifically, the following examples illustrate the technical solution of the present invention from the aspects of strain isolation and identification, and other characteristics, as detailed below.

[0031] 2. Materials and Methods

[0032] 2.1 Pathogen strains and soil sample collection

[0033] Phytophthora capsici was kindly provided by the Institute of Plant Protection, Hebei Academy of Agricultural and Forestry Sciences. Trichoderma strains were collected from rhizosphere soil from chili-growing areas in Handan and Baoding, Hebei Province, China. The collected soil samples were stored at 4℃ for the isolation of biocontrol bacteria.

[0034] 2.2 Isolation and Screening of Biocontrol Bacteria

[0035] Weigh 5g of rhizosphere soil and place it in 45mL of sterile water. Shake on a shaker (28℃, 180r / min) for 1 hour. Dilute the soil sample to 10⁻⁶ ppm using a serial dilution method. -1 10 -2 10 -3 10 -4 10 -5 10 -6 100 μL of soil suspension was spread onto potato dextrose agar (PDA) plates, repeated 3 times, and incubated at 28°C for 3 days. Single colonies were picked with an inoculation loop, transferred to PDA plates for further purification, and incubated at 28°C. This process was repeated 5 times until pure colonies were obtained. The colonies were then numbered and stored at 4°C.

[0036] 2.3 Dual-culture experiment

[0037] Five-day-old *Phytophthora capsici* colonies were perforated at their edges using a 5mm radius punch. Five-mm mycelial discs were inoculated onto the right side of a PDA plate. Symmetrically opposite to the *Phytophthora capsici* discs, six isolated *Trichoderma* mycelial discs were inoculated, 5cm apart. Each plate was sealed with sealing film and incubated in the dark at 28℃. Three replicates were performed for each treatment group. A control group was prepared by inoculating only *Phytophthora capsici* mycelial discs on the PDA plate. After 7 days of inverted incubation, the inhibition rate was calculated using the cross-hatching method, as shown in formula (1).

[0038]

[0039] Wherein, D: diameter of Phytophthora hyphae in the control group, d: diameter of Phytophthora hyphae in the treatment group.

[0040] 2.4 Identification of biocontrol strains

[0041] 2.4.1 Morphological Study

[0042] The strains to be identified were inoculated onto PDA plates and incubated at 28°C. After 5 days, the colony morphology and color were observed, and slides were prepared for observation of the morphological characteristics of conidia and conidiophores under an optical microscope.

[0043] 2.4.2 Molecular Biology Research

[0044] Five biocontrol bacteria mycelia (0.5 g each) were rapidly ground into a fine powder in liquid nitrogen. The frozen powder was immediately transferred to a 50 mL centrifuge tube, and 15 mL of extraction buffer was added. The mixture was gently swirled to mix. 1 mL of 20% sodium dodecyl sulfate (SDS) (pH 7.2) was added, and the mixture was incubated at 65°C for 20–30 min, with frequent gentle mixing. 5 mL of 5 mol / L potassium acetate (KAC) was added, and the mixture was incubated on ice for 20–30 min. The mixture was then centrifuged at 10,000 rpm at 4°C for 10 min. The supernatant was collected, and an equal volume of chloroform / isoamyl alcohol (24:1 volume ratio) was added. The mixture was incubated, and the mixture was centrifuged at 10,000 rpm at 4°C for 10 min. Collect the aqueous phase, accurately add 0.6 volumes of isopropanol, gently mix, incubate on ice for 10 min, centrifuge at 7000 rpm, 4°C for 10 min, wash the precipitate with 70% ethanol, centrifuge again, and dissolve in sterile double-distilled water. Add 30 μl of DNase-free RNase (10 mg / mL), incubate at 37°C for 30 min. Add an equal volume of phenol / chloroform, mix, centrifuge at 10000 rpm, 4°C for 10 min. Collect the aqueous phase, add 0.6 volumes of isopropanol to precipitate the DNA, wash with 70% ethanol, air dry slightly, and dissolve in TE buffer. Internal transcribed spacer (ITS) regions: ITS4: 5'-TCC TCC GCT TAT TGA TATGC-3', ITS5: 5'-GGA AGT AAA AGT CGT AAC AAG G-3'. Subsequently, send to Beijing Baojieluo Biotechnology Co., Ltd. for polymerase chain reaction (PCR) amplification and internal transcribed spacer (ITS) sequencing.

[0045] 2.4.3 Phylogenetic Analysis

[0046] To study the relationships between antimicrobial agents, a phylogenetic tree was constructed using the obtained ITS sequences along with other Trichoderma sequences downloaded from the NCBI GenBank database. The phylogenetic tree was constructed using the neighbor-joining method in the MEGA11 program. Our Trichoderma ITS sequences have been submitted to the NCBI (National Center for Biotechnology Information) GenBank database.

[0047] 2.5 Ferrocarrier Production Assessment

[0048] 2.5.1 Qualitative Assessment

[0049] The six isolated Trichoderma strains were cultured on PDA plates at 28°C for 7 days. CAS detection medium, cooled to below 60°C, was then poured onto the PDA plates where colonies had grown. The plates were left to stand for 24 hours, and the color changes on each plate were observed. Each treatment group was repeated three times.

[0050] 2.5.2 Quantitative Assessment

[0051] The strain preserved at 4℃ was inoculated onto PDA medium plates and cultured in a 28℃ biochemical incubator for 3-5 days. Then, mycelia were picked and transferred to 100 mL of PDB medium and cultured continuously at 28℃ and 120 r / min for 5 days. After filtration through four layers of lens paper, the culture was centrifuged at 5000 r / min for 10 min, and the supernatant was discarded. The bacterial cells were washed with sterile water and centrifuged at 5000 r / min for 10 min. The supernatant was discarded again. This washing process was repeated 3 times. The bacterial cells were collected to prepare a spore suspension.

[0052] The bacterial culture was inoculated into PDB medium at a 5% (v / v) inoculum and cultured at 28℃ and 120 rpm for 5 days. The supernatant was then obtained by centrifugation at 8000 rpm for 15 minutes. Several PC tubes were prepared, and 3 mL of CAS detection solution was added to each tube. The supernatant was then added to each tube, mixed thoroughly, and allowed to stand for 1 hour. The absorbance (A1) was measured at 630 nm. Separately, 3 mL of uninoculated PDB medium was thoroughly mixed with 3 mL of CAS detection solution, and the absorbance was measured using the same method as a reference value (A0). The formula for calculating the siderophore synthesis rate is:

[0053]

[0054] 2.6 Antagonistic effect of Trichoderma strains on Phytophthora mycelia

[0055] After culturing *Phytophthora capsici* on PDA plates at 28°C for 5 days, holes were punched at the edge of the colonies using a 5 mm radius punch. A 5 mm *Phytophthora capsici* cake was inoculated on the right side of the PDA plate. Symmetrically opposite to the *Phytophthora capsici* cake, *Trichoderma* strains were inoculated, with three replicates for each strain. The plates were incubated upside down at a constant temperature of 28°C for 4 days. The colony boundaries were then cut off with a sterile blade and observed and recorded under an optical microscope. The boundaries were collected and fixed in 1.5 mL centrifuge tubes. 1 mL of 2.5% glutaraldehyde solution was added, filling the centrifuge tubes completely to ensure the sample was fully submerged. The samples were rinsed three times with 0.1 M, pH 7.0 phosphate buffer for 15 min each time. The samples were then fixed with 1% osmium tetroxide solution for 1-2 h. The osmium tetroxide waste was carefully removed, and the samples were rinsed three times with 0.1 M, pH 7.0 phosphate buffer for 15 min each time. The samples were dehydrated using ethanol solutions of varying concentrations (30%, 50%, 70%, 80%, 90%, and 95%), with each concentration treated for 15 minutes. They were then treated twice with 100% ethanol, 20 minutes each time. The samples were then treated with a mixture of ethanol and isoamyl acetate (V / V = 1 / 1, volume ratio) for 30 minutes, followed by treatment with pure isoamyl acetate for 1 hour or overnight. After critical point drying and coating, the treated samples were observed using SEM.

[0056] 2.7 Biological control experiment on pepper fruit

[0057] Select disease-free, wound-free peppers of similar maturity and size. Soak them in a 2% sodium hypochlorite solution for 5 minutes, rinse three times with sterile water, and air dry. Make a 5mm diameter and 1mm deep wound at the waist of each fruit using a sterile punch. Inoculate the wound with Trichoderma biocontrol mycelium. Place absorbent paper soaked in sterile water on the wound, then place the fruit in a sterilized plastic basin and cover with a film to maintain warmth and moisture. After 24 hours of incubation at room temperature, remove the Trichoderma mycelium and inoculate the wound with Phytophthora mycelium for continued incubation. Observe and photograph daily, recording the length of diseased tissue on day 4. Each treatment is repeated three times. The Phytophthora treatment serves as a positive control, and the sterile water treatment as a negative control. The inhibition rate is calculated using the same method as in section 2.3.

[0058] 2.8 Preparation of Trichoderma fermentation broth

[0059] Five Trichoderma strains were activated on PDA plates at 28°C for 5 days, and then holes were punched at the edges of the colonies using a 5 mm radius punch. Five Trichoderma mycelial blocks were placed in Erlenmeyer flasks containing 100 mL of potato dextrose liquid (PDB) medium, and then placed in a shaker at 180 rpm and 28°C. After 7 days, the Erlenmeyer flasks were removed, filtered through eight layers of sterile gauze, and the filtrate was filtered using a sterile syringe and a sterile 0.22 μm filter membrane to obtain a sterile fermentation filtrate.

[0060] 2.9 Trichoderma fermentation broth inhibits Phytophthora in experiments

[0061] The fermentation filtrate was obtained according to method 2.8. The filtrate was mixed at a volume ratio of fermentation broth:PDA = 1:3, and poured into 20 mL sterile petri dishes to prepare agar plates. A fresh mycelial cake (0.5 cm in diameter) of *Phytophthora infestans* was inoculated at the center of each plate. An equal volume of PDA plate without added fermentation broth served as a control. Each treatment was repeated three times. The inoculated plates were placed in a 28°C incubator and incubated in the dark. After 4 days, the colony diameter for each treatment was measured using the cross-sectional method, and the inhibition rate was calculated. The calculation method was the same as in 2.3.

[0062] 2.10 Trichoderma fermentation broth on pepper growth promotion experiment

[0063] The growth-promoting effect of antagonistic bacteria was determined through seed germination experiments. Healthy, uniformly sized chili seeds were selected, disinfected with 5% NaClO for 5 minutes, rinsed thoroughly with sterile water, and blotted dry with sterile filter paper. The chili seeds were then placed in a fermentation broth diluted 5 times (obtained according to method 2.8). After 24 hours, the seeds were evenly placed in germination boxes with double-layered sterile germination paper, 50 seeds per dish, with 3 replicates. The seeds were incubated at 28℃ for 10 days with a sterile water control group. Germination potential, germination rate, fresh weight, hypocotyl and radicle length, and germination index were recorded.

[0064] Germination rate (%) = Number of seeds germinated in 10 days / Total number of seeds (1);

[0065] Germination potential (%) = Number of seeds that germinated in 5 days / Total number of seeds * 100% (1);

[0066]

[0067] Gt represents the number of sprouts per day, Dt represents the number of days of sprouting, and ∑ represents the total sum.

[0068] 2.10 Trichoderma IAA Production

[0069] To determine the production of IAA in the six isolated Trichoderma strains, the six strains were activated on PDA plates at 28°C for 5 days, and then holes were punched at the edges of the colonies using a 5 mm radius punch. Five Trichoderma mycelial blocks were placed in 100 ml of potato dextrose broth medium and shaken at 28°C at a speed of 180 rpm. After 7 days, the conical flasks were removed, and the cultures were filtered through 8 layers of sterile gauze. The concentration of IAA produced by Trichoderma was determined according to the Salkowski reagent (Zhang, S.; Gan, Y.; Xu, B. Mechanisms of the IAA and Acc-Deaminase Producing Strain of Trichoderma Longibrachiatum T6 in Enhancing Wheat Seedling Tolerance to NaCl Stress. BMC Plant Biology, 2019, 19(1):22.). The concentration of IAA was determined by comparison with a standard curve prepared in the IAA standard curve.

[0070] 2.11 Data Analysis

[0071] Data were statistically analyzed and organized using Excel 2019. One-way ANOVA was performed using SPSS 25. Duncan's multiple comparisons were used to analyze the significance of differences, with P < 0.05 indicating a significant difference. Graphs were generated using Origin 9.1 software.

[0072] 3. Results

[0073] 3.1 In vitro antagonistic activity of biocontrol bacteria against Phytophthora capsici

[0074] The antagonistic activity of isolates against *Phytophthora capsici* was evaluated using a plate confrontation experiment. Six biocontrol strains out of 60 isolated strains exhibited high antagonistic activity, and these six strains were used in a double culture experiment. In the control group, *Phytophthora capsici* strains showed uniform radial growth on PDAs. Figure 1a). In the Trichoderma treatment group, Phytophthora mycelia were inhibited by biocontrol agents, and the colony expansion stopped, while Trichoderma continued to grow until it completely covered the Phytophthora colony and the entire plate ( Figure 1 b) The results showed that the inhibition rate of these five biocontrol bacteria against Phytophthora infestans all exceeded 70%. Figure 1 d), strain 6311 showed the strongest antagonistic effect against *Phytophthora infestans* hyphae (82.22% ± 0.01). To investigate the mechanism of biocontrol bacteria antagonizing *Phytophthora infestans*, optical microscopy and scanning electron microscopy (SEM) were used to observe the parasitic entanglement of biocontrol bacteria hyphae on *Phytophthora infestans* hyphae. The biocontrol bacteria grew along the *Phytophthora infestans* hyphae, with numerous branches entwined around them. The extensive deformation of *Phytophthora infestans* indicated that its mycelium was attacked by strain 6311. Figure 1 c, e).

[0075] 3.2 Identification of biocontrol bacteria

[0076] like Figure 2 As shown, after 5 days of cultivation at 28℃, the biocontrol bacteria had completely covered the entire PDA plate. Simultaneously, conidia production was observed in the culture medium. 6311 exhibited well-developed aerial mycelium on the PDA plate, with colonies that were fluffy to felt-like, white, thick, and raised, forming distinct concentric circles. After 5 days, the PDA plate was covered with numerous dark green or yellowish-green spores, with a yellowish-brown reverse side. 7111 fungal colonies were white or light green, turning dark green after 5 days.

[0077] The ITS sequence obtained from fungal isolate 6311 was stored in the GenBank database with accession number SUB144343276311PP770685. Molecular identification of the isolate using ITS4 and ITS5 revealed them to be *Trichoderma harzianum*, *Trichoderma brevis*, and *Trichoderma viride*, respectively. Amplification of the internal transcribed spacer (ITS) region using primers ITS4 and ITS5, followed by a BlastN search, showed 100% identity with *T. brevicompactum* (KR094463.1) in NCBi GenBank.

[0078] 3.3 Control efficacy of detached fruit

[0079] To investigate the potential of different Trichoderma species for biocontrol of Phytophthora in postharvest pepper fruits, pepper fruits were inoculated with Trichoderma. After 24 hours, the Trichoderma mycelium cake was removed and replaced with Phytophthora mycelium cake. Five days later, no mycelial growth was observed in the control group (CK). Compared to the Phytophthora-treated groups (7.43±0.05 cm), the mycelial diameter in all six Trichoderma treatment groups was reduced, indicating that Trichoderma has an inhibitory effect on Phytophthora in pepper fruits. Figure 3 The average diameter of the bacterial strain on the pepper fruits in the 6311 treatment group was 5.23 ± 0.13 cm. The inhibition rate was approximately 29%. Figure 3 ).

[0080] 3.4 Effects of Trichoderma on Growth Promotion and Control

[0081] Observing the color changes of the five Trichoderma strains on double-layer plates, it was found that the plate of the 6311 treatment group had the darkest color. Figure 4 a) indicates the highest level of siderophores produced; among the different Trichoderma strains, Trichoderma 6311 had the highest relative concentration of siderophores (72.88%). Figure 4 b), followed by 7111 (50.47%). In contrast, 5111 and 6321 produced only small amounts of siderophores, with relative concentrations of 33.36% and 8.54%, respectively, while no siderophores were detected in Trichoderma harzianum 2221.

[0082] In the fermentation broth inhibition experiment, the five Trichoderma strains showed differences in their ability to inhibit Phytophthora mycelial growth. Figure 5 Among them, compared with the Phytophthora infestation treatment group ( Figure 5 b), 5111 and 6311 Figure 5 a) The fermentation broth of strain a) inhibited the mycelial growth of *Phytophthora infestans* by 100%. Fermentation broths of strains 6321 and 7111 also significantly reduced *Phytophthora infestans* mycelial growth, with inhibition rates of 69.72% and 27.52%, respectively. In contrast, the effect of treatment group 2221 was much weaker, with an inhibition rate of only 4.59%. Figure 5 c).

[0083] Based on the fermentation broth growth-promoting experiment, we found that the fermentation broths of six Trichoderma species promoted various growth indicators of seeds. In all Trichoderma treatment groups, the germination potential (40.67-57.33%) and germination rate (90.67-98.67%) of pepper seeds were greater than those of the control group (86.67%) and germination potential (38.00%). Among them, 6311 showed the best growth-promoting effect, with germination potential and germination rate reaching 55.33% and 94.67%, respectively. Subsequently, the effects of different Trichoderma species on the growth of the radicle and hypocotyl of pepper seedlings were observed. The results showed that the fermentation broths of all Trichoderma species had a significant growth-promoting effect on the radicle and hypocotyl. The fermentation broth of 6311 had the best effect; compared with the control group (1.25±0.46cm radicle and 1.54±0.72cm), the radicle and hypocotyl lengths in the 6311 treatment group increased by 2.45 times and 2.21 times, respectively. Figure 6 In terms of germination index, the germination index of the six Trichoderma treatment groups was significantly higher than that of the CK group (15%), with 6311 reaching 42.62%. Meanwhile, the fermentation broth of 6311 affected the fresh weight of the chili seedlings. Figure 6 Compared with the control group, the 6311 treatment group showed a 42.86% increase in fresh weight. The experiment demonstrated that the Trichoderma fermentation broth improved various physiological indicators of pepper seedlings, with Trichoderma short-density 6311 exhibiting a significant growth-promoting function.

[0084] 4 Discussion

[0085] Phytophthora is one of the most notorious pathogens among fungal diseases, severely impacting global crop yields, especially chili peppers. Chemical fungicides pose a serious threat to human health and environmental safety. With the increasing demands for sustainable agricultural development, biological control is considered an environmentally friendly and economical alternative to fungicides. Trichoderma is a biological control fungus found worldwide. Trichoderma has significant practical value and potential in the field of biological plant disease control. Research worldwide is investigating the ability of Trichoderma to control plant diseases. Studies have shown that Trichoderma can effectively inhibit approximately 30 plant pathogenic fungi, including Phytophthora. This invention isolated 60 strains from the rhizosphere soil of chili peppers collected from four sampling points in Hebei Province, China. Through a double-culture experiment, five biocontrol strains with strong antagonistic activity against Phytophthora were isolated. Among them, Trichoderma 6311 showed the highest inhibition percentage against Phytophthora mycelial growth, reaching 82.22%, while the other five Trichoderma strains also exhibited inhibition rates exceeding 70% against Phytophthora mycelial growth. Five *Trichoderma* strains were identified morphologically and molecularly: two *T. harzianum*, three *T. brevicompactum*, and one *T. virens*. Fungal parasitism is a key biocontrol mechanism for *Trichoderma*. *Trichoderma* can parasitize 18 different microorganisms, including those in the genera *Pythium*, *Phytophthora*, and *Rhizobium*. These fungi can invade or damage the mycelium, causing pathogen cells to enlarge, twist, and rupture. Optical and scanning electron microscopy observations of the pathogenic fungal mycelium at the boundary of the inhibition zone showed that *Trichoderma* 6311 exhibits a strong parasitic effect on *Phytophthora capsici* mycelium. This suggests that *Trichoderma* may attack the cell wall / cell membrane and inhibit *Phytophthora capsici* mycelial growth by producing antifungal substances and competing for space and nutrients. In fruit experiments, the reduction in mycelial diameter also demonstrates the ability of *Trichoderma* to inhibit *Phytophthora capsici* mycelium, with 6311 showing the most significant inhibition rate of 29%.

[0086] Previous reports indicate that *Trichoderma* produces various compounds with antagonistic properties, including a series of enzymes and metabolites such as cellulase, xylanase, pectinase, and chitinase. Fermentation broth can be used to study the antagonistic ability of *Trichoderma* metabolites. Fermentation broth from *Trichoderma* species can cause mycelial malformation, swelling, fragmentation, and twisting of pathogenic fungi. This invention found that the fermentation broth of *Trichoderma brevicaulis* 6311 can inhibit the growth of *Phytophthora infestans* mycelia with an inhibition rate of 100%, a result not previously observed. Simultaneously, *Trichoderma* can produce the growth hormone IAA, siderophores, and other plant growth-promoting substances. In this invention, *Trichoderma brevicaulis* 6311 was found to produce siderophores, exhibiting the strongest siderophore production capacity compared to five other strains, indicating its potential for inhibiting pathogens. Furthermore, this invention is the first to discover that fermentation broth inoculated with *Trichoderma* can significantly promote the development of pepper seedlings, with *Trichoderma brevicaulis* 6311 significantly increasing the radicle and hypocotyl length of pepper seedlings. Figure 6 Fresh weight () Figure 6 ), germination rate ( Figure 6 ), 5-day germination index ( Figure 6 This is a new discovery that no one had explored before. This is related to previous studies that reported that Trichoderma can promote the growth of seedlings of bitter melon, clove, Panax notoginseng, bayberry, and tomato.

[0087] 5. Conclusion

[0088] In summary, this invention isolated *Trichoderma 6311* from the rhizosphere soil of chili peppers and demonstrated that it can produce siderophores, secrete antibacterial substances, and exhibit hyperparasitism to inhibit *Phytophthora indicum*. Furthermore, 6311 can inhibit *Phytophthora indicum* mycelial growth on fruits. Its secreted IAA and metabolites can promote the growth of chili pepper seedlings and inhibit *Phytophthora indicum* mycelia, thereby improving the disease resistance of chili pepper seedlings. This invention provides a potential biocontrol agent for the biological control of chili pepper wilt and offers a possible perspective for understanding the interaction mechanism between biocontrol agents and pathogens.

[0089] SEQ ID NO.1: Gene sequence of Trichoderma 6311

[0090] TGGAAGTAAAAAAGCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGATTTCTGCCCCGGGCGCGTCGCAGCCCCGGACCAAGGCGCCCGCCG GAGGACCAATTTACAAACTCTTTTGTATATCCCATCGCGGATTCTTTACATTCTGAGCTTTCTCGGCGCTCCTAGCGAGCGTTTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT AATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGCACTTACCTGCCGGCCCCGAAATACA GTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACACTCGCACCGGGAGCGCGGCGCGTCCACGGCCGTAAAACAACCCAAACTTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAAAAGGGGGGAGGGAA

[0091] Although embodiments of the invention have been disclosed for illustrative purposes, those skilled in the art will understand that various substitutions, variations, and modifications are possible without departing from the spirit and scope of the invention and the appended claims. Therefore, the scope of the invention is not limited to the contents disclosed in the embodiments.

Claims

1. A strain of *Trichoderma 6311* with biocontrol capabilities against *Phytophthora capsici*, characterized in that: Its name is: 6311, and its classification name is: Trichoderma brevis ( Trichoderma brevicompactum The accession number is CGMCC No.41489, the accession date is August 13, 2024, and the depositary institution is the China General Microbiological Culture Collection Center, No.3, No.1 Beichen West Road, Chaoyang District, Beijing. The colony and cell characteristics of the strain are as follows: aerial mycelium is well-developed on PDA plates, the colony is fluffy to felt-like, white, thick and fluffy, raised, and in obvious concentric circles. After 5 days, the PDA plates are covered with a large number of dark green or yellowish-green spores, and the back is yellowish-brown. The strain has the potential for biocontrol. The fermentation broth of *Trichoderma 6311* can inhibit the growth of *Phytophthora* mycelia, with an inhibition rate of 100%. The *Trichoderma 6311* exhibits hyperparasitic activity against *Phytophthora capsici*. 6311 showed the highest activity in siderophore experiments and produced the growth hormone IAA at a yield of 14.56 mg / L, indicating its potential for disease suppression and growth promotion. In in vitro fruit experiments, 6311 inhibited the growth of *Phytophthora capsici* on pepper fruits. Furthermore, the fermentation broth of *Trichoderma 6311* demonstrated 100% inhibition of *Phytophthora capsici* mycelial growth on agar plates. Pepper seeds soaked in the 6311 fermentation broth showed improved germination rate, radicle and hypocotyl length, growth index, and fresh weight.

2. An application of Trichoderma 6311 as described in claim 1 in the preparation of biocontrol agents for Phytophthora capsici.

Images