Silicate bacteria, microbial preparation and preparation method and application thereof

Abstract

The invention relates to silicate bacteria, a microbial preparation as well as a preparation method and application of the silicate bacteria and the microbial preparation, the bacterial strain number is HZSB180823, and the silicate bacteria are preserved in the China General Microbiological Culture Collection Center (CGMCC) with the preservation number of CGMCC No.31167. The silicate bacteria HZSB180823 is utilized to prepare a microbial preparation for rice, the microbial preparation has good effects on crop growth, yield increase and quality improvement, and after the silicate bacteria HZSB180823 and bacillus velezensis are combined, the silicate bacteria HZSB180823 and the bacillus velezensis have obvious superposition and complementary effects in the aspect of rice yield increase; the yield increasing effect on rice is obviously higher than that of single use of silicate bacteria HZSB180823, the acre yield of rice can be remarkably increased, the yield is increased by 7.5%-8.5% compared with that of conventional fertilization, and the remarkable level is achieved; and meanwhile, the composition of soil ecological microorganisms is improved, the production cost is greatly saved, and good market application prospects are achieved.

Description

Technical Field

[0001] The present invention relates to the field of microorganisms, and in particular to silicate bacteria, microbial preparations, and preparation methods and applications thereof. Background Art

[0002] Rice is a silicon-loving crop. The ability of the soil to provide effective silicon restricts the quality and yield of rice to a certain extent. Therefore, it is particularly important to increase the effective silicon content in the soil. In existing agricultural production, the soil silicon supply capacity is mainly improved by applying chemical silicon fertilizers. However, the large-scale application of chemical silicon fertilizers will cause a series of ecological and environmental documents, such as soil structure damage, decreased organic matter content, and serious groundwater and surface pollution, which pose a threat and challenge to the sustainable development of agriculture.

[0003] In response to the above problems, in order to improve the soil's silicon nutrition supply to plants, people began to transform the soil directly or indirectly from the perspectives of plants and microorganisms to achieve the purpose of increasing silicon nutrition supply and improving crop yields, thereby accelerating the development of ecological agriculture. For example, Xu Wenping et al. (2008) showed that biological silicon fertilizer can increase the number of soil microorganisms, and the activities of soil catalase, urease and invertase have also been significantly improved.

[0004] Furthermore, silicate bacteria are a type of beneficial bacteria that can decompose minerals in the soil and release mineral elements such as potassium, silicon, phosphorus, iron, and aluminum that can be used by plants. The silicate bacteria agent made by fermentation and cultivation using modern bioengineering technology is an ideal biological silicon fertilizer that can be widely used in agricultural production and is suitable for a variety of crops such as rice, cotton, tobacco, peanuts, sweet potatoes, potatoes, watermelons, tomatoes, etc. It has the effects of strengthening seedlings, preventing diseases, and increasing production, and the effect is more obvious in poor soil. For example, the Chinese invention patent with application number CN201711184781.4 (publication number CN108101683A) and the Chinese invention patent with application number CN201010588684.3 (publication number CN102153420A) disclose the contents of the patents.

[0005] However, there are still many problems in the application of silicate bacterial preparations in agricultural production, such as unstable effects, and the lag in basic research on strain screening, production application, quality inspection, etc. of silicate bacterial fertilizers. These factors restrict the development of silicate bacterial fertilizer production and application. Among them, the selection of strains with excellent performance is the core link in exerting the efficacy of microorganisms. It is necessary to screen out strains or strain groups that can decompose silicate minerals efficiently and stably, so as to enrich the strain resources of microbial fertilizers and exert the agricultural utilization efficiency of silicate mineral decomposing bacteria. Summary of the invention

[0006] The first technical problem to be solved by the present invention is to provide a silicate bacterium that is beneficial to increasing rice yield and improving rice quality in view of the existing technology.

[0007] The second technical problem to be solved by the present invention is to provide a silicate bacteria which is beneficial to increase rice yield, improve rice quality and improve soil quality in view of the existing technology.

[0008] The third technical problem to be solved by the present invention is to provide a microbial preparation containing the above-mentioned silicate bacteria in view of the prior art.

[0009] The fourth technical problem to be solved by the present invention is to provide a preparation method of the above-mentioned microbial preparation in view of the existing technology.

[0010] The fifth technical problem to be solved by the present invention is to provide an application of silicate bacteria in view of the prior art.

[0011] The sixth technical problem to be solved by the present invention is to provide an application of the above-mentioned microbial preparation in view of the existing technology.

[0012] The technical solution adopted by the present invention to solve at least one of the above technical problems is: a silicate bacterium (Silicate bactenria), the strain number is HZSB180823, and it is preserved in the General Microbiological Center of China Microbiological Culture Collection Administration, and the preservation number is: CGMCC No.31167.

[0013] The technical solution adopted to further solve the third technical problem is: a microbial preparation, characterized in that it includes the silicate bacteria HZSB180823 as described above.

[0014] Furthermore, it also includes at least one of the following components: Bacillus Velez, a nutrient carrier or anhydrous magnesium sulfate.

[0015] Further, the following components and their mass percentages are included:

[0016] Silicate bacteria HZSB180823 0.5-50%, Bacillus Velez 0.5-40%, nutrient carrier 0.5-60%, anhydrous magnesium sulfate 0.5-40%.

[0017] Furthermore, the silicate bacteria are added in the form of concentrated spore liquid, with an effective live bacteria count of 60 million / g to 6 billion / g, and the Velez Bacillus is added in the form of spore powder, with an effective live bacteria count of 500 million / g to 40 billion / g.

[0018] Furthermore, the nutrient carrier includes at least one of fulvic acid, amino acids, glucose, sucrose or alginic acid.

[0019] The technical solution adopted to further solve the fourth technical problem is: a method for preparing the microbial preparation as described above, characterized in that it comprises the following steps:

[0020] (1) inoculating the silicate bacteria HZSB180823 into a culture medium for liquid fermentation, and concentrating the fermentation liquid to obtain a concentrated microbial spore liquid;

[0021] (2) mixing Bacillus Velez, a nutrient carrier and anhydrous magnesium sulfate uniformly according to the above mass percentages to obtain a carrier composition;

[0022] (3) Spraying the concentrated microbial spore fluid onto the carrier composition at a low temperature of 30 to 35° C. in the form of a spray to mix the microbial spore fluid and the carrier composition thoroughly and evenly to prepare a microbial preparation containing the silicate bacteria HZSB180823.

[0023] The technical solution adopted to further solve the sixth technical problem is: an application of the silicate bacteria as described above in rice cultivation.

[0024] Furthermore, the silicate bacteria are used at a concentration of 1×10 8 ~1×10 9 cfu / g.

[0025] The technical solution adopted to further solve the fifth technical problem is: application of the microbial preparation as described above in rice cultivation.

[0026] Compared with the prior art, the advantages of the present invention are: the silicate bacteria HZSB180823 screened and obtained by the present invention is deposited in the General Microbiology Center of China Microbiological Culture Collection Committee, with the deposit number: CGMCC No.31167, the deposit address: No. 3, Yard No. 1, Beichen Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, and the deposit date is: May 4, 2024.

[0027] Furthermore, the present invention utilizes the above-mentioned silicate bacteria HZSB180823 to prepare a microbial preparation for rice. The microorganisms contained in the microbial preparation have low requirements for nutritional conditions and are highly adaptable to environmental conditions. On the one hand, the organic acids produced by the growth and metabolism of the silicate bacteria HZSB180823 can dissolve the insoluble potassium and phosphorus in potassium-containing minerals such as feldspar, mica, apatite, and phosphate rock powder in the soil for use by rice and the bacteria themselves, and the potassium rich in the bacteria is absorbed by the crops after the bacteria die; on the other hand, the hormones, amino acids, polysaccharides and other substances produced by the silicate bacteria HZSB180823 can promote the growth of crops. At the same time, the silicate bacteria HZSB180823 reproduces in the soil and can inhibit the growth of other pathogens. All of the above aspects have a good effect on crop growth, yield increase and quality improvement.

[0028] Field tests have confirmed that among the microbial preparations obtained by the present invention, the combination of silicate bacteria HZSB180823 and Bacillus Velezii has obvious superposition and complementary effects in increasing rice yield, and the yield-increasing effect on rice is significantly higher than that of using silicate bacteria HZSB180823 alone, and can significantly increase the per-acre yield of rice, increasing the yield by 7.5% to 8.5% compared with conventional fertilization, reaching a significant level; at the same time, it improves the composition of soil ecological microorganisms, greatly saves production costs, and has good market application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 The colony morphology of the silicate bacteria strain HZSB180823 in Example 1 of the present invention;

[0030] Figure 2 This is an antagonism test between the silicate bacteria strain HZSB18082 and Bacillus Velezii in Example 1 of the present invention. DETAILED DESCRIPTION

[0031] The present invention is further described in detail below with reference to the accompanying drawings.

[0032] The main raw materials involved in the following examples are:

[0033] Silicate bacteria fermentation medium: sucrose 12.0 g, calcium sulfate dihydrate 2.0 g, calcium carbonate 5.0 g, starch 10.0 g, ammonium sulfate 3.5 g, potassium hydrogen phosphate 3.0 g, yeast powder 0.8 g, pH 7.0; deionized water 1000 mL.

[0034] Alexander Roth medium was prepared according to the method in "Microbiological Experiment Guide".

[0035] Oxygen depleting agent: 5.0 g of sodium sulfite, 5.0 g of sodium bicarbonate, 1.0 g of reduced iron powder, and 2.2 mL of water are required for each liter of volume in the closed culture chamber.

[0036] Rice variety tested: Yongyou 15, bred by Ningbo Seed Co., Ltd.

[0037] Example 1: Collection of indigenous microorganisms and isolation, morphological observation and identification of strains

[0038] 1.1 Test methods

[0039] 1.1.1 Collection of original soil samples

[0040] On March 24, 2022, soil samples at a depth of 10 to 15 cm were collected from the rice fields of Jiangshan Guiben Rice Farm in Yinzhou, Ningbo City, Zhejiang Province using an inoculating shovel, placed in kraft paper bags, and stored after air drying.

[0041] 1.1.2 Isolation and purification of the strain

[0042] Take 1.0g of the test soil sample, add it to a test tube containing 9.0mL of sterile water, shake it thoroughly, let it stand, take 1.0mL of the supernatant and add it to another test tube containing 9.0mL of sterile water, and then add it to the test tube containing 9.0mL of sterile water. -3 ~10 -8 Gradient dilution, take 1.0mL from each soil dilution and apply it to the Alexander Rove medium plate, place the plate in a large plate with a diameter of 150mm with sufficient oxygen consumption agent, and culture at a constant temperature of 28℃. After 5 days, select the strains that meet the morphology of silicate bacteria colonies, gently pick up a little of the selected colony and puncture it into the Alexander Rove medium for further culture, and store it in a refrigerator at 4℃ after 5 days of culture. At the same time, transfer the selected strains to the Alexander Rove medium for streaking to test purity.

[0043] 1.1.3 Colony morphology observation

[0044] Gently scrape a small amount of bacterial cells of the test strain from the activated strain slope, add them to 10 mL of sterile water and mix well. -2 , 10 -3 , 10 -4 , 10 -5 Take 10 dilutions at different levels. -4 , 10 -5 0.2 mL of the two dilution gradients were coated on Alexander Roth medium plates, which were then inverted and cultured in an incubator for 3-5 days. After a single colony grew, it was observed. The strain isolated from the paddy field soil was cultured in an environment with sufficient oxygen depletion agents.

[0045] 1.1.4 Physiological and biochemical determination of strains

[0046] According to the contents and methods of genus and species identification in the Manual of Systematic Identification of Common Bacteria, the aerobic requirement of the strains, diacetyl (VP) test, nitrate reduction test, indole test, starch hydrolysis test, catalase test, glucose fermentation test, mannitol fermentation test, xylose fermentation test, maltose fermentation test, lactose fermentation test, sucrose fermentation test, fructose fermentation test, methyl red test, phenylalanine deaminase test, lecithinase test, gelatin liquefaction test, citrate utilization test, casein hydrolysis test, urease test, etc. were carried out.

[0047] 1.1.5 Identification of strains

[0048] Principle: Using molecular biology methods to clarify the taxonomic relationship between microbial populations from the perspective of genetic evolution is a commonly used identification method in microbial taxonomy research. 16SrDNA analysis of bacteria is performed.

[0049] Test method: Refer to "6.5" in NY / T 1736-2009.

[0050] 1.2 Results and Analysis

[0051] like Figure 1 As shown, the colonies of the silicate bacteria strain HZSB180823 of the present invention are all round protrusions, with complete edges, moist and smooth surfaces, colorless and transparent, glass beads, and the colonies are sticky and elastic. When picked up, they can be pulled into very long threads, which conforms to the single colony characteristics of typical silicate bacteria. The physiological and biochemical test results of the silicate bacteria strains are shown in Table 1.

[0052] Table 1 Physiological and biochemical test results of silicate bacteria strain HZSB180823

[0053] Test Name Physiological and biochemical characteristics of strains Test Name Physiological and biochemical characteristics of strains Aerobic test Facultative anaerobic VP test — Nitrate reduction test + Indole test + Starch hydrolysis test + Catalase test + Glucose fermentation test + Mannitol fermentation test + Xylose fermentation test + Maltose fermentation test + Lactose fermentation test + Sucrose fermentation test + Fructose fermentation test + Methyl red test — Phenylalanine deaminase test — Lecithinase test — Gelatin liquefaction test + Citrate utilization test + Casein hydrolysis test — Urease test —

[0054] The specific gene fragment of the silicate bacteria strain HZSB180823 of the present invention was amplified by PCR, and the amplification primers are as follows:

[0055] 27F (SEQ ID No. 2): AGAGTTTGATCCTGGCTCAG; 1492R (SEQ ID No. 3): ACGGCTACCTTGTTACGACTT, the amplified product was recovered and sequenced, and the sequence was compared with the sequence registered in the GenBank database for homology. The homology of the 16SrDNA sequence of the strain and silicate bacteria (Silicate bactenria) reached 99.79%. The 16SrDNA sequence (SEQ ID No. 1) of the silicate bacteria strain HZSB180823 of the present invention is as follows:

[0056]

[0057] 1.3 Antagonism test between silicate bacteria strain HZSB180823 and Bacillus velez

[0058] (1) First, dilute the silicate bacterial strain HZSB18082 (B) and the Velez subtilis strain (C) with sterile water to prepare 1×10 6 / ml of bacterial solution;

[0059] (2) Cut the filter paper into 0.25 square centimeters, sterilize by high pressure, and dry before use;

[0060] (3) Pour LB medium into a 9 cm culture dish, draw a line in the middle of the culture dish with sterile water, and then stick filter paper on both sides of the line. Drop 10 ul of silicate bacterial strain HZSB18082 (B) and Bacillus velezensis strain (C) on the filter paper. Incubate in a 25°C incubator for three days, take photos and record, and observe whether the experimental group has an inhibition zone.

[0061] (4) Figure 2 As shown, the experimental results show that there is no inhibition zone between the silicate bacteria strain HZSB18082 (B) and the Velez subtilis strain (C), and they can grow together.

[0062] Example 2: Preparation of a microbial preparation containing silicate bacteria strain HZSB180823

[0063] 2.1 Preparation of spore fluid of silicate bacteria strain HZSB180823

[0064] (1) Seed culture

[0065] Culture medium: Refer to A.6 culture medium in "Technical conditions for culture medium for microbial fertilizer experiments (NY / T 1114-2006)", as described in Table 2.

[0066] Table 2 shows the composition of the medium used for seed culture

[0067]

[0068]

[0069] Add an appropriate amount of the prepared culture medium to a 250 mL Erlenmeyer flask, pick a single colony of the silicate bacteria strain HZSB180823 and inoculate it into the Erlenmeyer flask, and culture it at 34°C and 180 rpm for 16 hours to obtain a liquid fermentation seed solution;

[0070] (2) Add silicate bacteria fermentation medium to a 50L liquid fermentation tank, sterilize at 121°C for 30 minutes, and cool to room temperature; the silicate bacteria fermentation medium consists of: 360.0g sucrose, 60.0g calcium sulfate dihydrate, 150.0g calcium carbonate, 300.0g starch, 105.0g ammonium sulfate, 90.0g potassium hydrogen phosphate, 24g yeast powder, and 30L water;

[0071] (3) Inoculation step (1) 500 mL of liquid fermentation seed solution was cultured at 34° C. and 280 rpm for 16 hours to obtain a fermentation solution of silicate bacteria strain HZSB180823;

[0072] (4) The fermentation broth is concentrated by conventional concentration technology to obtain concentrated microbial spore fluid.

[0073] 2.2 Preparation of microbial preparations containing silicate bacteria

[0074] Bacillus Velezii (purchased from Tianjin Development Zone Kunhe Biotechnology Co., Ltd., the same below) beneficial to the strain, nutrient carrier, anhydrous magnesium sulfate, etc. are added in proportion and mixed evenly to obtain a carrier composition; under a low temperature of 30 to 35° C., the concentrated microbial spore fluid is sprayed onto the above-mentioned carrier composition in the form of a spray, so that the microbial spore fluid and the carrier composition are fully and evenly mixed to prepare a microbial preparation containing the above-mentioned silicate bacteria HZSB180823.

[0075] The microbial preparation prepared in this example contains the following components:

[0076] The mass percentage of silicate bacteria concentrate is 15% and the effective viable bacteria count is 2 billion / gram; the mass percentage of Bacillus Velez powder is 25% and the effective viable bacteria count is 25 billion / gram; the mass percentage of nutrient carrier (mineral source potassium humate) is 40%; and the mass percentage of anhydrous magnesium sulfate is 20%.

[0077] Example 3: Preparation of a microbial preparation containing silicate bacteria strain HZSB180823

[0078] The preparation of the microbial preparation in this example is the same as that in Example 2 except that Bacillus Velezii is not added during the preparation of the carrier composition. The microbial preparation prepared in this example contains the following components:

[0079] The mass percentage of the silicate bacteria concentrate is 15% and the effective viable bacteria count is 2 billion / gram; the mass percentage of the nutrient carrier (mineral source potassium humate) is 60%; and the mass percentage of anhydrous magnesium sulfate is 25%.

[0080] Example 4: Rice production test

[0081] In March 2022, the microbial preparation prepared by the present invention was commissioned to Ningbo Academy of Agricultural Sciences to conduct field tests in Xinzhangyu Village, Jiangshan Town, Yinzhou District, Ningbo City, Zhejiang Province and Lijiangan Village, Jiangshan Town, Yinzhou District, Ningbo City, Zhejiang Province. The specific process of the test is as follows:

[0082] 4.1 Field trial in Xinzhangyu Village, Jiangshan Town, Yinzhou District, Ningbo City, Zhejiang Province

[0083] 4.1.1 Test location

[0084] The test site is located in Xinzhangyu Village, Jiangshan Town, Yinzhou District, Ningbo City, Zhejiang Province. The soil type is loam with excellent fertility. Convenient transportation and drainage and irrigation. The test soil organic matter is 46.74g / kg, total nitrogen is 3.09g / kg, alkaline nitrogen is 186.90mg / kg, available phosphorus is 42.75mg / kg, available potassium is 330.6mg / kg, and pH is 5.05.

[0085] 4.1.2 Trial crops and varieties

[0086] Experimental crops: rice.

[0087] Crop variety: Yongyou 15, bred by Ningbo Seed Co., Ltd.

[0088] 4.1.3 Test fertilizers

[0089] The microbial preparation prepared in Example 2 and the microbial preparation prepared in Example 3 were provided by Ningbo Huize Biotechnology Co., Ltd. in the form of granules.

[0090] 4.1.4 Experimental treatment design

[0091] The experiment set up 4 treatment groups, namely:

[0092] Treatment group 1: microbial preparation (Example 2) + conventional fertilization (nitrogen: 21 kg / mu, phosphorus pentoxide: 4.5 kg / mu, potassium oxide: 5.7 kg / mu; purchased from the market; the same below). Before rice planting, 5 kg per mu of fertilizer was evenly applied; in the early stage of tillering, 3 kg per mu of fertilizer was evenly applied; in the heading stage, 3 kg per mu of fertilizer was evenly applied, and at other times, fertilizer was applied according to the average fertilizer amount, fertilizer quality and fertilizer method of the local area in the previous three years.

[0093] Treatment group 2: microbial preparation (Example 3) + conventional fertilization, the operation is the same as that of treatment group 1.

[0094] Treatment group 3: conventional fertilization, fertilization was carried out according to the average amount, quality and method of fertilizer applied in the local area in the previous three years.

[0095] Treatment group 4: blank control, no fertilizer treatment.

[0096] The experiment was repeated three times with a randomized block design. Protected rows were set up around the experimental site, and the plot area was 30m 2 .

[0097] 4.1.5 Test process

[0098] Apply base fertilizer on March 15, 2022, direct seeding of early rice on April 11, tillering fertilizer on May 16, and panicle fertilizer on June 8. The sowing rate is 15 jin / mu.

[0099] 4.1.6 Survey methods and harvesting yield measurement

[0100] The number of rice tillers was investigated on June 8, 2022, during the rice tillering period. The rice was harvested on July 9, 2022, and the wet grain yield of the plot was investigated. Ten rice plants were taken from each plot to investigate the plant height, number of effective panicles, number of grains per panicle, 1000-grain weight, and fruit setting rate.

[0101] Pest and disease surveys are conducted every 14 days to observe the occurrence of crop pests and diseases;

[0102] After the experiment, soil samples were taken to measure the soil microbial flora of each treatment.

[0103] 4.1.7 Impact on other organisms

[0104] During the test, observe the beneficial or adverse effects of the test fertilizer on other pests, diseases, weeds and other non-target organisms.

[0105] 4.1.8 Results and Analysis

[0106] 4.1.8.1 Effects of different treatments on rice yield and output value

[0107] From the results of Table 3 and Table 4, it can be seen that the application of the microbial preparation (Example 2) can increase the rice yield per mu by 838.20 kg, an increase of 71.25 kg per mu compared with the conventional control (CK1), an increase of 9.32%, and an increase of 379.10 yuan per mu in income; an increase of 105.40 kg per mu compared with the blank control (CK2), an increase of 14.38%, and an increase of 433.93 yuan per mu in income.

[0108] The application of the microbial preparation (Example 3) increased the rice yield per mu to 777.06 kg, an increase of 10.38 kg per mu compared with the conventional control (CK1), an increase of 1.35%, and an increase of 62.25 yuan per mu in income; an increase of 44.1 kg per mu compared with the blank control (CK2), an increase of 11.82%, and an increase of 264.58 yuan per mu in income.

[0109] Table 3 Effects of different treatments on rice yield results

[0110]

[0111] Table 4 Economic Benefit Analysis

[0112]

[0113] 4.1.8.2 Results of production statistics analysis

[0114] The variance analysis of the measured yield of rice under different treatments showed (Table 5) that the differences among treatments were extremely significant, while there were no significant differences among the blocks. Duncan's new multiple range method was used to further compare the yield results (Table 6), indicating that the rice yield of the test fertilizer + conventional fertilization treatment was extremely significantly different from that of the conventional control and the no-fertilizer control (P<0.01).

[0115] Table 5 Variance analysis table of yield results

[0116] Sources of variation Degrees of Freedom sum of squares Mean Square F-number <![CDATA[F0 .05 ]]> <![CDATA[F 0.01 ]]> Interval Group 2 1.511 0.756 0.164 5.14 10.92 Processing room 3 35.074 11.691 11.730 4.76 9.78 error 6 6.462 1.077 Total variation 11 443.048

[0117] Table 6 Determination of the significance of yield differences (Duncan's new multiple range method)

[0118]

[0119] 4.1.8.3 Effects of different treatments on rice biological traits

[0120] The test results are shown in Table 7. Among all the treatments, the plant height, tiller number and effective ear number of the microbial preparation (Example 2) + conventional fertilization treatment were higher than those of the other treatments. The plant height increased by 6.3 cm compared with CK1 and 11.8 cm compared with CK2; the tiller number increased by 1.3 compared with CK1 and 3.9 compared with CK2; the effective ear number increased by 6 compared with CK1 and 8 compared with CK2; the number of grains per ear increased by 15.48 compared with CK1 and 22.65 compared with CK2; the fruit setting rate increased by 6.58% compared with CK1 and 11.58% compared with CK2; and the thousand-grain weight increased by 5.23 g compared with CK1 and 6.35 g compared with CK2.

[0121] The plant height, tiller number and effective ear number of the microbial preparation (Example 3) + conventional fertilization treatment were higher than those of the other treatments. The plant height increased by 4.9 cm compared with CK1 and 10.4 cm compared with CK2; the tiller number increased by 0.5 compared with CK1 and 3.1 compared with CK2; the effective ear number increased by 3 compared with CK1 and 85 compared with CK2; the number of grains per ear increased by 7.07 compared with CK1 and 14.24 compared with CK2; the fruit setting rate increased by 1.41% compared with CK1 and 6.41% compared with CK2; and the thousand-grain weight increased by 0.5 g compared with CK1 and 1.62 g compared with CK2.

[0122] The above results show that the biological properties of rice treated with the microbial preparation of the present invention (Example 2) + conventional fertilization are the best.

[0123] Table 7 Effects of different treatments on rice biological traits

[0124]

[0125] 4.1.9 Effects of different treatments on rice diseases

[0126] No related rice diseases were observed during the trial.

[0127] 4.1.10 Effects of different treatments on rice soil microbial flora

[0128] Table 8 shows the plate count results of rhizosphere microorganisms bacteria, fungi and actinomycetes. The application of the microbial preparation (Example 2) increased the number of bacteria and actinomycetes compared with the control, and decreased the number of fungi compared with the control. The number of bacteria / fungi increased by 400 compared with CK1 and increased by 910 compared with CK2.

[0129] The application of the microbial preparation (Example 3) increased the number of bacteria and actinomycetes compared with the control, and decreased the number of fungi compared with the control. The number of bacteria / fungi increased by 40 compared with CK1 and increased by 550 compared with CK2.

[0130] The above results show that the application of the microbial preparation of the present invention can effectively improve the soil microbial flora structure.

[0131] Table 8 Effects of different treatments on rice soil microbial flora

[0132]

[0133] 4.1.11 Security

[0134] No adverse effects on crops or other beneficial organisms were found during the trial.

[0135] 4.1.12 Test conclusion

[0136] Under the conventional cultivation and management conditions in the eastern Zhejiang region, the use of the applicant's microbial preparation (Example 2, Example 3) can increase rice yield, improve the biological properties of rice, and improve the soil microbial flora. In particular, after using the microbial preparation in Example 2 of the present invention, the per mu yield of rice can reach 838.20 kg, an increase of 8.53% over conventional fertilization, an increase of 379.10 yuan per mu in benefits, and a significant difference in increasing yield and efficiency.

[0137] 4.2 Experiment in Lijiangan Village, Jiangshan Town, Yinzhou District, Ningbo City, Zhejiang Province

[0138] 4.2.2.1 Test location

[0139] The test site is located in Lijiang'an Village, Jiangshan Town, Yinzhou District, Ningbo City, Zhejiang Province. The soil type is loam with excellent fertility. Convenient transportation and drainage and irrigation. The test soil organic matter is 42.44g / kg, total nitrogen is 3.12g / kg, alkaline nitrogen is 115.50mg / kg, available phosphorus is 112.62mg / kg, available potassium is 484.70mg / kg, and pH is 5.64.

[0140] 4.2.2.2 Trial crops and varieties

[0141] Experimental crops: rice.

[0142] Crop variety: Yongyou 15, bred by Ningbo Seed Co., Ltd.

[0143] 4.2.2.3 Test fertilizers

[0144] The microbial preparation prepared in Example 2 and the microbial preparation prepared in Example 3 were provided by Ningbo Huize Biotechnology Co., Ltd. in the form of granules.

[0145] 4.2.2.4 Experimental treatment design

[0146] The experiment has four treatments:

[0147] Treatment 1: Microbial preparation (Example 2) + conventional fertilization. Before rice is planted, 5 kg of fertilizer is evenly applied per mu; in the early stage of tillering, 3 kg of fertilizer is evenly applied per mu; in the heading stage, 3 kg of fertilizer is evenly applied per mu. During the rest of the time, fertilizer is applied according to the average amount, quality and method of fertilizer applied in the local area in the previous three years.

[0148] Treatment 2: microbial preparation (Example 3) + conventional fertilization, the operation is the same as treatment 1.

[0149] Treatment 3: Conventional fertilization, applying fertilizer according to the average amount, quality and method of fertilizer applied in the local area in the previous three years.

[0150] Treatment 4: blank control, no fertilizer treatment.

[0151] The experiment was repeated three times with a randomized block design. Protected rows were set up around the experimental site, and the plot area was 30m 2 .

[0152] 4.2.2.5 Test process

[0153] Base fertilizer was applied on March 12, 2022, early rice was sown on March 21, early rice was transplanted on April 18, tillering fertilizer was applied on May 14, ear fertilizer was applied on June 3, and the yield was harvested and measured on July 14. The sowing rate is 13 jin / mu.

[0154] 4.2.2.6 Survey methods and harvesting yield measurement

[0155] The number of rice tillers was investigated on June 8, 2022, during the rice tillering period. The rice was harvested on July 14, 2022, and the wet grain yield of the plot was investigated. Ten rice plants were taken from each plot to investigate the plant height, number of effective panicles, number of grains per panicle, 1000-grain weight, and fruit setting rate.

[0156] Pest and disease surveys are conducted every 14 days to observe the occurrence of crop pests and diseases;

[0157] After the experiment, soil samples were taken to measure the soil microbial flora of each treatment.

[0158] 4.2.2.7 Impact on other organisms

[0159] During the test, observe the beneficial or adverse effects of the test fertilizer on other pests, diseases, weeds and other non-target organisms.

[0160] 4.2.3 Results and analysis

[0161] 4.2.3.1 Effects of different treatments on rice yield and output value

[0162] 4.2.3.1.1 Effects of different treatments on rice yield and output value

[0163] From the results of Tables 9 and 10, it can be seen that the application of the microbial preparation (Example 2) can increase the rice yield per mu by 787.28 kg, an increase of 55.06 kg per mu compared with the conventional control (CK1), an increase of 7.52%, and an increase in income of 324.82 yuan per mu; compared with the blank control (CK2), the yield per mu increased by 105.09 kg, an increase of 15.40%, and an increase in income of 477.42 yuan per mu.

[0164] Application of the microbial preparation (Example 3) resulted in a rice yield of 765.2 kg per mu, an increase of 32.98 kg per mu, 4.5% and an increase of 147.88 yuan per mu compared with the conventional control (CK1); an increase of 83.01 kg per mu, 12.17% and an increase of 300.5 yuan per mu compared with the blank control (CK2).

[0165] Table 9 Effects of different treatments on rice yield results

[0166]

[0167] Table 10 Economic Benefit Analysis

[0168]

[0169] 4.2.3.1.2 Results of production statistics analysis

[0170] The variance analysis of the measured yield of rice under different treatments showed that the differences between treatments were extremely significant (Table 11), while there were no significant differences between blocks. Duncan's new multiple range method was used to further compare the yield results (Table 12), indicating that the rice yield of the test fertilizer + conventional fertilization treatment was extremely significantly different from that of the conventional control and the no-fertilizer control (P<0.01).

[0171] Table 11 Variance analysis table of yield results

[0172] Sources of variation Degrees of Freedom sum of squares Mean Square F-number <![CDATA[F0 .05 ]]> <![CDATA[F 0.01 ]]> Interval Group 2 0.005 0.003 0.000 5.14 10.92 Processing room 3 37.997 12.666 11.481 4.76 9.78 error 6 8.821 1.470 Total variation 11 46.822

[0173] Table 12 Determination of the significance of yield differences (Duncan's new multiple range method)

[0174]

[0175] 4.2.3.2 Effects of different treatments on rice biological traits

[0176] The test results are shown in Table 13. Among all the treatments, the plant height, tiller number and effective ear number of the microbial preparation (Example 2) + conventional fertilization treatment were higher than those of the other treatments. Among them, the plant height increased by 3.8 cm compared with CK1 and 3.9 cm compared with CK2, the tiller number increased by 5.7 compared with CK1 and 6.7 compared with CK2; the effective ear number increased by 4 compared with CK1 and 8 compared with CK2; the number of grains per ear increased by 32.2 compared with CK1 and 47.6 compared with CK2; the fruit setting rate increased by 8.00% compared with CK1 and 9.58% compared with CK2, and the thousand-grain weight increased by 1.85 g compared with CK1 and 2.11 g compared with CK2.

[0177] The plant height, tiller number and effective ear number of the microbial preparation (Example 3) + conventional fertilization treatment were higher than those of CK1 and CK2, but lower than those of the microbial preparation (Example 2) + conventional fertilization treatment. Among them, the plant height increased by 2.3 cm compared with CK1 and 2.6 cm compared with CK2, the tiller number increased by 3.4 compared with CK1 and 4.4 compared with CK2; the effective ear number increased by 2 compared with CK1 and 6 compared with CK2; the number of grains per ear increased by 11.4 compared with CK1 and 26.8 compared with CK2; the fruit setting rate increased by 6.66% compared with CK1 and 8.24% compared with CK2, and the thousand-grain weight increased by 1.02 g compared with CK1 and 1.28 g compared with CK2.

[0178] The above results show that the biological properties of rice treated with the microbial preparation of the present invention (Example 2) + conventional fertilization are the best.

[0179] Table 13 Effects of different treatments on rice biological traits

[0180]

[0181] 4.2.3.3 Effects of different treatments on rice diseases

[0182] No related rice diseases were observed during the trial.

[0183] 4.2.3.4 Effects of different treatments on rice soil microbial flora

[0184] Table 14 shows the plate count results of rhizosphere microorganisms bacteria, fungi, and actinomycetes. The application of microbial preparation (Example 2) increased the number of bacteria and actinomycetes compared with the control, and decreased the number of fungi compared with the control. The bacteria / fungi increased by 540 compared with CK1 and increased by 680 compared with CK2. The application of microbial preparation (Example 3) increased the number of bacteria and actinomycetes compared with the control, and decreased the number of fungi compared with the control. The bacteria / fungi increased by 80 compared with CK1 and increased by 220 compared with CK2.

[0185] The above results show that the application of the microbial preparation of the present invention can effectively improve the soil microbial flora structure.

[0186] Table 14 Effects of different treatments on rice soil microbial flora

[0187]

[0188] 4.2.3.6 Security

[0189] No adverse effects on crops or other beneficial organisms were found during the trial.

[0190] 4.2.4 Test conclusion

[0191] Under the conventional cultivation and management conditions in the eastern Zhejiang region, the use of the microbial preparations produced by the applicant (Example 2, Example 3) can increase rice yield, improve the biological properties of rice, and improve the soil microbial flora. In particular, after using the microbial preparation in Example 2 of the present invention, the per mu yield of rice can reach 787.28 kg, which is 7.52% higher than that of conventional fertilization, and the per mu benefit increases by 324.82 yuan, with significant differences in increasing yield and efficiency.

Claims

1. A silicate bacterium, strain number HZSB180823, deposited in the General Microbiological Center of China Microbiological Culture Collection Administration, with the deposit number: CGMCC No.31167.

2. A microbial preparation, characterized in that: It comprises the silicate bacteria HZSB180823 as described in claim 1.

3. The microbial preparation according to claim 2, characterized in that Also included is at least one of the following components: Bacillus Velez, a nutrient carrier, or anhydrous magnesium sulfate.

4. The microbial preparation according to claim 3, characterized in that Includes the following components and their mass percentages: Silicate bacteria HZSB180823 0.5-50%, Bacillus Velez 0.5-40%, nutrient carrier 0.5-60%, anhydrous magnesium sulfate 0.5-40%.

5. The microbial preparation according to claim 4, characterized in that The silicate bacteria are added in the form of concentrated spore liquid, with an effective live bacteria count of 60 million to 6 billion per gram; the Velez Bacillus is added in the form of spore powder, with an effective live bacteria count of 500 million to 40 billion per gram.

6. The microbial preparation according to claim 3, 4 or 5, characterized in that: The nutrient carrier includes at least one of fulvic acid, amino acids, glucose, sucrose or alginic acid.

7. A method for preparing a microbial preparation according to any one of claims 2 to 6, characterized in that The following steps are involved: (1) inoculating the silicate bacteria HZSB180823 into a culture medium for liquid fermentation, and concentrating the fermentation liquid to obtain a concentrated microbial spore liquid; (2) mixing Bacillus Velez, a nutrient carrier and anhydrous magnesium sulfate uniformly according to the above mass percentages to obtain a carrier composition; (3) Spraying the concentrated microbial spore fluid onto the carrier composition at a low temperature of 30 to 35° C. in the form of a spray to mix the microbial spore fluid and the carrier composition thoroughly and evenly to prepare a microbial preparation containing the silicate bacteria HZSB180823.

8. Use of the silicate bacteria according to claim 1 in rice cultivation.

9. The use of silicate bacteria in rice planting according to claim 8, characterized in that: The silicate bacteria were used at a concentration of 1×10 8 ~1×10 9 cfu / g.

10. Use of the microbial preparation according to any one of claims 2 to 6 in rice cultivation.

Images