A plant gene editing vector and a method for performing gene editing in a plant

Abstract

The present disclosure relates to a plant gene editing vector and a method for gene editing in plants, by inserting a specific plant intron sequence into a Cas gene, an iCas vector with high gene editing function is constructed, which significantly improves its expression level and genome editing efficiency in tobacco, and provides a new strategy for plant genome editing.

Description

Technical Field

[0001] This disclosure relates to the fields of plant molecular biology and genetic engineering, and more specifically, to a vector for plant gene editing and a method for gene editing in plants. Background Technology

[0002] The CRISPR / Cas system, as a highly efficient gene-editing tool, has been widely used in many biological fields, showing great potential in plant genome editing. However, in some plants, especially dicotyledonous plants such as tobacco, the editing efficiency of Cas12 nucleases is unsatisfactory, which greatly limits the application of this technology in complex plant genome editing. Due to their large molecular weight, Cas proteins are easily recognized as foreign proteins by plant cells, leading to degradation mechanisms and poor expression stability, severely hindering the improvement of gene editing efficiency and persistence. At the same time, gRNA or crRNA is also easily degraded in plant cells, which not only reduces the precision of editing but also significantly increases the risk of low editing efficiency. Furthermore, the expression levels of traditional Cas genes in plants are generally low, and the lack of intron optimization design fails to fully utilize the regulatory function of endogenous plant introns to enhance the transient expression level and stability of Cas proteins.

[0003] In addition, the insufficient compatibility of different promoters in plant genomes also presents a bottleneck. Most existing gene editing vectors cannot adapt to the specific promoter requirements of different plant species, making it difficult to optimize the expression of nucleases and gRNA or crRNA, thus affecting the editing effect. In summary, the degradation problems caused by the large size of Cas proteins, the instability of gRNA or crRNA, insufficient promoter compatibility, the lack of suitable endogenous intron optimization design, and low target specificity are among the multiple defects that pose significant challenges to improving the efficiency and stability of existing plant gene editing technologies.

[0004] Therefore, there is an urgent need for technological innovation and improvement to promote the widespread application of plant gene editing in agricultural improvement, functional gene research and bioengineering. Summary of the Invention

[0005] The purpose of this disclosure is to provide a vector and method with efficient gene editing capabilities, offering a new strategy for plant genome editing.

[0006] To achieve the above objectives, this disclosure provides a plant gene editing vector containing a Cas gene with an inserted exogenous intron, wherein the exogenous intron is at least one of the introns with nucleotide sequences as shown in SEQ ID NO. 1-9.

[0007] Optionally, the Cas gene includes at least one of Cas9, Cas12a, and Cas12i3.

[0008] Optionally, when the Cas gene is the Cas9 gene, the nucleotide sequence of the Cas gene with inserted exogenous introns is as shown in SEQ ID NO.10.

[0009] Optionally, when the Cas gene is the Cas12a gene, the nucleotide sequence of the Cas gene with inserted exogenous introns is as shown in SEQ ID NO.11.

[0010] Optionally, when the Cas gene is the Cas12i3 gene, the nucleotide sequence of the Cas gene with inserted exogenous introns is as shown in SEQ ID NO.12.

[0011] Optionally, the vector contains, in sequence, a promoter, a guide RNA insertion region, a Cas gene promoter, an NLS, the Cas gene with inserted exogenous introns, the NLS, and a UBQ terminator.

[0012] Optionally, the promoter includes a type II promoter and / or a type III promoter; the nucleotide sequence of the type II promoter is shown in SEQ ID NO.13; the nucleotide sequence of the type III promoter is shown in SEQ ID NO.14; The guide RNA insertion region includes a gRNA insertion region and / or a CrRNA insertion region; When the Cas gene is the Cas9 gene, the guide RNA insertion region is a gRNA insertion region, and the nucleotide sequence of the gRNA insertion region is shown in SEQ ID NO.15; When the Cas gene is the Cas12a gene, the guide RNA insertion region is the CrRNA insertion region, and the nucleotide sequence of the CrRNA insertion region is shown in SEQ ID NO.16; When the Cas gene is the Cas12i3 gene, the guide RNA insertion region is the CrRNA insertion region, and the nucleotide sequence of the CrRNA insertion region is shown in SEQ ID NO.17; The nucleotide sequence of the UBQ terminator is shown in SEQ ID NO.18.

[0013] On the other hand, this disclosure provides a method for gene editing in plants, the method comprising the following steps: (1) Insert the guide RNA coding sequence targeting the gene to be edited into the guide RNA insertion region of the above vector to obtain the gene editing vector; (2) The gene editing vector was introduced into Agrobacterium to obtain a transformant; (3) Infect the pre-cultured plant leaves with the transformant, and then culture the infected plant leaves in a culture medium containing hygromycin.

[0014] Optionally, when the Cas gene in the vector is the Cas9 gene, the nucleotide sequence of the guide RNA targeting the gene to be edited is shown in SEQ ID NO.19.

[0015] When the Cas gene in the vector is the Cas12a gene, the nucleotide sequence of the guide RNA targeting the gene to be edited is shown in SEQ ID NO. 20; When the Cas gene in the vector is the Cas12i3 gene, the nucleotide sequence of the guide RNA targeting the gene to be edited is shown in SEQ ID NO. 21.

[0016] Optionally, the plant includes at least one of monocotyledonous plants, dicotyledonous plants, algae, and bryophytes; The dicotyledonous plants include at least one of the following: tobacco, tomato, soybean, cotton, chili pepper, rapeseed, eggplant, Chinese cabbage, lettuce, kale, potato, peanut, cucumber, watermelon, sunflower, strawberry, radish, citrus, alfalfa, poplar, Arabidopsis thaliana, sesame, quinoa, sesame, grape, apple, pear, kiwi, chrysanthemum, dandelion, wintergreen, phalaenopsis orchid, and Dendrobium officinale; The monocotyledonous plants include at least one of rice, wheat, corn, sorghum, wild rice, millet, sugarcane, bamboo, onion, leek, ginger, banana, and lily; The algae and bryophytes include at least one of the following: green algae, blue-green algae, Euglena, golden algae, dinoflagellates, brown algae, red algae, liverwort, gourd bryony, fine-leaved feathery bryony, golden bryony, true bryony, and large gray bryony; Preferably, the plant is tobacco.

[0017] Through the above technical solution, this disclosure provides a vector and method for plant gene editing. By inserting specific plant intron sequences into the Cas gene, an iCas vector with efficient gene editing function is constructed, which significantly improves its expression level and genome editing efficiency in tobacco, providing a new strategy for plant genome editing.

[0018] Other features and advantages of this disclosure will be described in detail in the following detailed description section. Attached Figure Description

[0019] The accompanying drawings are provided to further illustrate the present disclosure and form part of the specification. They are used together with the following detailed description to explain the present disclosure, but do not constitute a limitation thereof. In the drawings: Figure 1 This is a schematic diagram of a gene editing vector containing an intron-containing Cas nuclease.

[0020] Figure 2 This study compares the expression levels of ordinary Cas9 and intronic Cas nuclease (iCas9) with the efficiency of homozygous gene editing.

[0021] Figure 3 This study provides a comparative analysis of intron MAD7 (iMAD7) and regular MAD7 in tobacco genome editing.

[0022] Figure 4 Comparison of PDS gene editing efficiency of codon-optimized nCas12i3 and intronic Cas12i3 (iCas12i3) in transient transformation of Nicotiana benthamiana.

[0023] Figure 5 A comparison of the genome editing efficiency of nCas12i3 and iCas12i3 in stable tobacco transformation.

[0024] Figure 6 To analyze the compatibility and editing efficiency of intronic Cas nucleases with different promoter-driven guide sequences. Detailed Implementation

[0025] The specific embodiments of this disclosure will be described in detail below with reference to the accompanying drawings. It should be understood that the specific embodiments described herein are for illustration and explanation only and are not intended to limit this disclosure.

[0026] The first aspect of this disclosure provides a plant gene editing vector containing a Cas gene with an inserted exogenous intron, wherein the exogenous intron is at least one of the introns whose nucleotide sequences are shown in SEQ ID NO. 1-9.

[0027] This disclosure provides introns 15-23 of the Arabidopsis LRR-RLK receptor kinase ERECTA as exogenous introns, which are inserted into the Cas gene to construct a vector with highly efficient gene editing function. The nucleotide sequences of these 15-23 introns are shown in SEQ ID NO. 1-9. These nine introns differ in their sequence structure, length, and nucleotide composition, which leads to different characteristics in their interaction with the Cas gene and their function in plant cells. This provides a diverse range of options for selecting appropriate exogenous introns based on different plant species, editing targets, and experimental requirements.

[0028] Optionally, the Cas gene includes at least one of Cas9, Cas12a, and Cas12i3.

[0029] In constructing plant gene editing vectors, this disclosure allows for the selection and combined application of one or more Cas genes from Cas9, Cas12a, and Cas12i3, based on factors such as the specific plant species, gene editing target, experimental conditions, and desired editing effect, to optimize the gene editing process and improve success rate and effectiveness.

[0030] Preferably, when the Cas gene is the Cas9 gene, the nucleotide sequence of the Cas gene with inserted exogenous introns is as shown in SEQ ID NO.10; When the Cas gene is the Cas12a gene, the nucleotide sequence of the Cas gene with inserted exogenous introns is shown in SEQ ID NO.11; When the Cas gene is the Cas12i3 gene, the nucleotide sequence of the Cas gene with inserted exogenous introns is shown in SEQ ID NO.12.

[0031] In the above preferred embodiment, this disclosure selects specific exogenous introns for insertion into specific Cas genes, thereby achieving multi-faceted optimization of plant gene editing.

[0032] Optionally, the vector contains, in sequence, a promoter, a guide RNA insertion region, a Cas gene promoter, an NLS, the Cas gene with inserted exogenous introns, the NLS, and a UBQ terminator.

[0033] The promoter, a specific DNA sequence located upstream of the gene, plays a crucial "switch" role in gene expression, determining when, where, and to what extent the gene editing system begins transcription and synthesis of the corresponding RNA within plant cells. Guide RNA recognizes and specifically binds to the target DNA sequence during gene editing, guiding the Cas protein to accurately locate the genomic site requiring editing. The guide RNA insertion region is a specific area reserved for inserting pre-designed gRNAs and / or CrRNAs, allowing researchers to flexibly insert appropriate gRNAs and / or CrRNAs that target specific gene sequences according to different plant gene editing goals. This enables precise editing of different plant genes, greatly increasing the targeting specificity and flexibility of the gene editing system. The Cas gene is the core execution element in the gene editing system. Its encoded Cas proteins (such as Cas9 and Cas12a) have the key function of cutting DNA, ensuring that there is a sufficient and appropriate amount of Cas protein at the cell and stage requiring gene editing to complete the cutting and other editing operations of the target DNA, while avoiding off-target risks caused by overexpression. NLS guides the accurate recognition and transport of Cas proteins into the nucleus during intracellular transport, ensuring that subsequent gene editing activities can proceed smoothly within the nuclear environment where the genome resides. The UBQ terminator marks the end of the entire gene transcription process related to gene editing, allowing transcription to terminate at the appropriate location. This ensures that the generated RNA has the correct length and structure, preventing the transcription process from continuing indefinitely and producing abnormal RNA transcripts. Consequently, it ensures that subsequent gene expression activities such as translation based on this RNA can proceed normally and orderly, guaranteeing the correct expression and function of all components of the gene editing system.

[0034] Optionally, the promoter includes a type II promoter and / or a type III promoter; the nucleotide sequence of the type II promoter is shown in SEQ ID NO.13; the nucleotide sequence of the type III promoter is shown in SEQ ID NO.14; The guide RNA insertion region includes a gRNA insertion region and / or a CrRNA insertion region; When the Cas gene is the Cas9 gene, the guide RNA insertion region is a gRNA insertion region, and the nucleotide sequence of the gRNA insertion region is shown in SEQ ID NO.15; When the Cas gene is the Cas12a gene, the guide RNA insertion region is the CrRNA insertion region, and the nucleotide sequence of the CrRNA insertion region is shown in SEQ ID NO.16; When the Cas gene is the Cas12i3 gene, the guide RNA insertion region is the CrRNA insertion region, and the nucleotide sequence of the CrRNA insertion region is shown in SEQ ID NO.17; The nucleotide sequence of the UBQ terminator is shown in SEQ ID NO.18.

[0035] On the other hand, this disclosure provides a method for gene editing in plants, the method comprising the following steps: (1) Insert the guide RNA coding sequence targeting the gene to be edited into the guide RNA insertion region of the above vector to obtain the gene editing vector; (2) The gene editing vector was introduced into Agrobacterium to obtain a transformant; (3) Infect the pre-cultured plant leaves with the transformant, and then culture the infected plant leaves in a culture medium containing hygromycin.

[0036] Optionally, when the Cas gene in the vector is the Cas9 gene, the nucleotide sequence of the guide RNA targeting the gene to be edited is shown in SEQ ID NO. 19; When the Cas gene in the vector is the Cas12a gene, the nucleotide sequence of the guide RNA targeting the gene to be edited is shown in SEQ ID NO. 20; When the Cas gene in the vector is the Cas12i3 gene, the nucleotide sequence of the guide RNA targeting the gene to be edited is shown in SEQ ID NO. 21.

[0037] Optionally, the plant includes at least one of monocotyledonous plants, dicotyledonous plants, algae, and bryophytes; The dicotyledonous plants include at least one of the following: tobacco, tomato, soybean, cotton, chili pepper, rapeseed, eggplant, Chinese cabbage, lettuce, kale, potato, peanut, cucumber, watermelon, sunflower, strawberry, radish, citrus, alfalfa, poplar, Arabidopsis thaliana, sesame, quinoa, sesame, grape, apple, pear, kiwi, chrysanthemum, dandelion, wintergreen, phalaenopsis orchid, and Dendrobium officinale; The monocotyledonous plants include at least one of rice, wheat, corn, sorghum, wild rice, millet, sugarcane, bamboo, onion, leek, ginger, banana, and lily; The algae and bryophytes include at least one of the following: green algae, blue-green algae, Euglena, golden algae, dinoflagellates, brown algae, red algae, liverwort, gourd bryony, fine-leaved feathery bryony, golden bryony, true bryony, and large gray bryony; Preferably, the plant is tobacco.

[0038] The present invention will be further described in detail below through examples.

[0039] Example 1 This embodiment provides the construction and application of a gene editing vector containing intron Cas9 (iCas9).

[0040] Nine intron sequences of the LRR-RLK receptor kinase were sequentially inserted into specific locations in the Cas9 gene to generate an iCas9 sequence containing introns (SEQ ID NO. 10). The iCas9 sequence was synthesized by a commercial synthesis company (BGI Genomics) and stored for future use. Using an enzyme digestion and ligation method, the synthesized iCas9 gene replaced the NcoI to BamHI restriction enzyme region in the pDC40 vector (vector information can be found in patent ZL202110786304.5). After vector construction, the correctness of the vector was confirmed by electrophoresis and enzyme digestion. The correct vector was named pDC40-iCas9. The vector structure provided in this disclosure is as follows: Figure 1 As shown.

[0041] The sgRNA sequence GAGGCAAGAGATGTCCTAGG (SEQ ID NO.23) for the tobacco-targeting gene PDS was designed and inserted into the pDC40 and pDC40-iCas9 vectors, respectively. The corresponding vector sequences containing the tobacco PDS target were named pDC40-PDS and pDC40-iCas9-PDS. The vectors were introduced into Agrobacterium EH105 via heat shock transformation. The three binary vectors pDC40, pDC40-PDS, and pDC40-iCas9-PDS with correct sequencing were transformed into Agrobacterium EH105 and stored at -80℃ for later use. The optimized leaf disc transformation method was used to infect the leaves of wild-grown tobacco 'Red Flower Big Golden Yuan' (HD), as follows: First, the leaves of well-grown sterile seedlings were cut into 1.0×1.0 cm leaf discs. After removing the leaf edges, the discs were placed in MS medium and pre-cultured for 2 days at 28℃, 16 h / d light, and 2000 LX light intensity. The preserved Agrobacterium tumefaciens culture was then cultured in LB medium containing 50 mg / L kanamycin and 10 mg / L rifampin until the OD600 reached approximately 1.0. The culture was centrifuged at 4000 rpm for 10 minutes to collect the cells, which were then resuspended in MS liquid medium until the OD600 reached 0.6. 20 mg / L acetylsyl syringone was added and the discs were allowed to stand for 30 minutes to 2 hours in preparation for infection. The pre-cultured leaf discs were then immersed in the Agrobacterium tumefaciens infection solution and gently shaken for 5 minutes. After infection, the leaves were blotted dry on sterile filter paper and placed on MS medium containing 1 mg / L 6-BA and 0.1 mg / L IBA. The discs were then co-cultured in the dark for 3 days in an artificial climate chamber at 26℃ and 40% humidity.

[0042] After co-culture, the leaves were transferred to S1 differentiation medium (MS medium containing 1 mg / L 6-BA, 0.1 mg / L NAA and 8 mg / L hygromycin), with 6-8 leaves placed in each dish. After culturing in the dark for 2 days, the leaves were transferred to light conditions until 0.5 cm bud clusters emerged from the leaf margins. The bud clusters were then transferred to S2 differentiation medium (MS medium containing 1 mg / L 6-BA, 0.1 mg / L NAA and 10 mg / L hygromycin) and cultured under light conditions for another 1-2 weeks to allow the bud clusters to develop into young plants. The average number of albino seedlings per leaf disc was then counted. The results showed that no albino seedlings were found in the regenerated seedlings transformed with the empty vector pDC40. Unlike the pDC40-transformed seedlings, approximately 0.6 albino seedlings were obtained per explant in the pDC40-PDS-transformed material, while approximately 1.85 albino seedlings were found per explant in the pDC40-iCas9-PDS-transformed material, which is more than three times more efficient than the pDC40-PDS vector. This indicates that the Cas9 (hereinafter abbreviated as iCas9) containing nine intron sequences of the receptor kinase constructed in this embodiment has a more efficient editing efficiency in the tobacco genome. To further understand the reason why introns enhance Cas9 editing efficiency, this example further extracted 5-8 pDC40, pDC40-PDS, and pDC40-iCas9-PDS cells from shoots at the same time. RNA was extracted from different transformant lines using the Kangwei Century OminiPlant RNA Extraction Kit (Kangwei Century, CW2598S). The corresponding cDNAs were synthesized using the Accurate Biology qHS qPCR Kit (Accurate Biology, AG11728, China) according to the manufacturer's instructions. The expression level of Cas9 in tobacco callus was determined by qRT-PCR, with the Ntubc2 gene used as an internal control gene. The expression levels of candidate genes were analyzed using a 2-1... −ΔΔCT The method was quantified. The qRT-PCR internal reference gene Ntubc2 forward primer (5'-3'): CTGACATCTCCCGCACTCTTA (SEQ ID NO. 24) and reverse primer (5'-3'): CATAGTCCATTCGTAGTTGAGCA (SEQ ID NO. 25); the Cas9 gene forward primer (5'-3'): CGAGAGAATGAAGCGGATCGA (SEQ ID NO. 26) and Cas9 reverse primer (5'-3'): CCTGAGGCACGATATGGTCC (SEQ ID NO. 27). The results showed that the expression level of Cas9 containing the kinase intron was increased by more than 2-fold, specifically as follows... Figure 2 As shown.

[0043] Example 2 This embodiment provides the construction of a gene editing vector containing introns Cas12 (iMAD7).

[0044] Based on the above-mentioned discovery that intron sequences enhance the expression level of class II Cas nuclease Cas9 and improve its editing efficiency in the tobacco genome, this embodiment further verifies that this kinase intron sequence can also enhance class V Cas nuclease family Cas12, and selects MAD7 as the research object.

[0045] MAD7, also known as ErCas12a, is a nuclease protein belonging to the Type Va CRISPR-Cas system, developed by INCRIPTA in the United States. It originates from Eubacterium rectale. MAD7 belongs to the same family of homologous proteins as LbCpf1 from Trichophyton, FnCpf1 from Francisella, and AsCpf1 from Aminococcus, but the amino acid homology is very low. It is a novel Cas12a nuclease. The MAD7 protein contains 1263 amino acids and has a mass of approximately 148 kDa. INCRIPTA has optimized MAD7 to make it widely applicable in various systems and has made the patent rights for this nuclease available.

[0046] First, intron sequences 15 through 23 were sequentially and evenly inserted into the MAD7 gene, dividing the original MAD7 gene into small fragments of 180-620 bp, thus creating iMAD7 (see appendix for the specific sequence). The iMAD7 sequence was synthesized by a commercial synthesis company (BGI Genomics) and stored for later use. Homologous recombination adapters were designed, and forward primers (5'-3') containing the adapters were synthesized: atctcacaacagtggccatggccccaaagaagaagc (SEQ ID NO.28) and reverse primers (5'-3'): ttgataagagtctctggatcctcacttcttcttcttagcttg (SEQ ID NO.29). The synthesized iMAD7 template was amplified, and the recovered fragments were inserted into the NcoI and BamHI double-digested linearized vector of the pDC45 vector using a homologous recombination kit (ClonExpress II One Step Cloning Kit, Novizan, C112-01). The reaction is as follows:

[0047] Gently mix the reaction solution and react at 37°C for 30 min; then cool to 4°C or immediately on ice. Add 4 μL of the ligation product to 50 μL of DH5α competent cells, incubate on ice for 30 min, heat shock at 42°C for 45 sec, then immediately cool on ice for 2-3 min. Add 600 μL of LB liquid medium (without antibiotics), and incubate at 37°C for 1 h (220 rpm). Spread approximately 500 μL of the bacterial culture evenly on a plate containing 50 mg / L kanamycin using a sterile spreader. Incubate overnight at 37°C with the plate inverted position. Pick 4 clones and sequence them using 1300-gRNA-F2 primers. Name the correctly sequenced plasmid 1300-iMAD7 and store it at -20°C for subsequent experiments.

[0048] The guide sequence (SEQ ID NO. 16) of the MAD7 nuclease driven by the Arabidopsis type III promoter AtU6-26 was synthesized. Forward primers (5'-3') containing adapters were synthesized: gccagtgccaagcttcctaggcattcggagtttttgtatctt (SEQ ID NO. 30) and reverse primers (5'-3'): Aacaatgaatctattcctgcagggtcacgctgcactcaaaaa (SEQ ID NO. 31). The synthesized fragment was amplified. The gel-returned fragment was inserted into the linearized 1300-iMAD7 vector, which was double-digested with AvrII and SbfI, using a homologous recombination kit (ClonExpress II One Step Cloning Kit, Novizan, C112-01). The final structure of the pDC-iMAD7 vector was constructed as follows: Figure 1 As shown.

[0049] The original, intronless MAD7 was inserted between the NcoI and BamHI linearized sites of the pDC-iMAD7 vector using the same method to construct the pDC-MAD7 vector.

[0050] Designed forward primers (5'-3') for the PDS target site in cultivated tobacco: agatgtagtagcgactccatggg (SEQ ID NO.32) and reverse primers (5'-3'): ggcccccatggagtcgctactac (SEQ ID NO.33). Take 5 μL of 10 μM PDS forward primer and reverse primer respectively, add 40 μL of 0.5 x TE buffer, mix well, and place in a PCR instrument. Heat at 98℃ for 4 min, then directly remove the PCR tube and cool to room temperature to obtain double-stranded DNA at the target site with sticky ends. Simultaneously, the pDC-MAD7 and pDC-iMAD7 vectors were linearized using BsaI, and the linearized vectors were ligated with double-stranded PDS-gRNA via T4 ligation, resulting in MAD7-PDS_sg and iMAD7-PDS_sg. The three binary vectors (pDC-iMAD7 (empty), MAD7-PDS_sg, and iMAD7-PDS_sg) with correct sequencing results were transformed into Agrobacterium tumefaciens EH105 and stored at -80℃ for later use. The optimized leaf disc transformation method was then used to infect wild-flowered *Hypericum perforatum* (HD). The leaves were genetically transformed using the method described in Example 1. The albino seedlings of regenerated shoots from 20 explants at stage S2 were statistically analyzed. No albino seedlings were found in pDC-iMAD7 and MAD7-PDS_sg without the target site, indicating that the original MAD7 vector could not achieve high-frequency homozygous editing. Conversely, when using iMAD7 containing introns, approximately 0.3 albino (or chimeric white) regenerated shoots were found, indicating that the intron-based MAD7 designed in this example can significantly improve the editing efficiency of MAD7. Specifically, as shown in Example 1... Figure 3 As shown.

[0051] Example 3 In this embodiment, a gene editing vector containing introns Cas12 (iCas12i3) was constructed and used for gene editing in tobacco. The results showed that the vector significantly improved the editing efficiency of transient expression and stable tobacco genome.

[0052] To further confirm that the LRR-RLK kinase introns designed in this disclosure enhance the editing efficiency of Cas nucleases, this embodiment tested the proprietary V-type Cas12 nuclease Cas12i3. Cas12i3 nuclease can achieve relatively efficient gene editing in rice (Ping Lv et al., 2024; Zhiqiang Duan et al., 2024). In this embodiment, utilizing the codon bias of tobacco, the sequence in the literature was optimized to synthesize a new Cas12i3 (nCas12i3), as shown in SEQ ID NO. 22. In addition, the 15th to 23rd intron sequences were sequentially and evenly inserted into the nCas12i3 gene, dividing the original nCas12i3 gene into small fragments of 180-430 bp, designing iCas12i3 (as shown in SEQ ID NO. 12). The iCas12i3 sequence was synthesized by a commercial synthesis company (BGI Genomics) and stored for future use.

[0053] Design homologous recombination adapters and synthesize forward primers (5'-3') containing adapters: Atctcacaacagtggccatggggccaaagaagaagcg (SEQ ID NO.34) and reverse primers (5'-3'): ttgataagagtctctggatccttaacctcttgcacgtt (SEQ ID NO.35). Amplify the synthesized iCas12i3 template. The recovered fragments are inserted into the NcoI and BamHI double-digested linearized vector of the pDC45 vector using a homologous recombination kit (ClonExpress II One Step Cloning Kit, Novizan, C112-01). See Example 2 for specific procedures. The correctly sequenced plasmids were named 1300-nCas12i3 and 1300-iCas12i3. A guide sequence driven by the type III promoter AtU6-26 of iCas12i3 was artificially synthesized (SEQ ID NO. 16). Forward primers (5'-3') containing the adapter were synthesized: gccagtgccaagcttcctaggcattcggagtttttgtatctt (SEQ ID NO. 36) and reverse primers (5'-3'): Aacaatgaatctattcctgcagggtcacgctgcactcaaaaa (SEQ ID NO. 37). The synthesized fragments were amplified, and the gel-returned fragments were inserted into the 1300-nCas12i3 plasmid using a homologous recombination kit (ClonExpress II One Step Cloning Kit, Novizan, C112-01). The nCas12i3 and 1300-iCas12i3 vectors were linearized by double digestion with AvrII and SbfI, ultimately forming the pDC-nCas12i3 and pDC-iCas12i3 vectors. To clarify the improvement in intron editing efficiency of the Cas12i3 nuclease, this embodiment utilizes the transient expression system of *N. benthamiana*. First, the *N. benthamiana* NbPDS target sequence was designed, with forward primer (5'-3'): aacacgtagtagcgactccatgggg (SEQ ID NO.38) and reverse primer (5'-3'): ggccccccatggagtcgctactac (SEQ ID NO.39). 5 μL of 10 μM NbPDS forward and reverse primers were taken, and 40 μL of 0.5 x TE buffer was added. After mixing, the mixture was placed in a PCR instrument and heated at 98°C for 4 min. Then, the PCR tube was directly removed and cooled to room temperature to obtain the double-stranded DNA of the target site with sticky ends.Simultaneously, pDC-nCas12i3 and pDC-iCas12i3 were linearized using BsaI, and the linearized vectors were ligated with double-stranded NbPDS-gRNA via T4 ligation, ultimately forming nCas12i3-PDS_sg and iCas12i3-PDS_sg. The three binary vectors—pDC-nCas12i3 (empty), nCas12i3-PDS_sg, and iCas12i3-PDS_sg—were correctly sequenced and transformed into Agrobacterium EH105. Single clones of Agrobacterium EH105 containing the above-mentioned strain were picked and cultured overnight in the corresponding antibiotic. 1 ml of the culture was inoculated into 50 ml of LB medium containing the corresponding antibiotic and cultured overnight. Agrobacterium was precipitated by centrifugation at 5000 rpm and the OD value of the enriched Agrobacterium was adjusted to 0.5 using a resuspension solution (100 mM magnesium chloride, 10 mM morpholine ethanesulfonic acid, 0.1 mM acetylsuccinone). The leaves on the back of Nicotiana benthamiana were injected using a 1 ml syringe. Leaves from the injection area were collected about 3 days after injection. Leaves injected with the same vector were mixed into one tube for every 3-5 leaves. The DNA of the edited material was extracted using the EasyPure® Plant Genomic DNA Kit (EasyPure®, EE111-12). High-throughput sequencing was used to determine the editing status of different vectors. The forward primer for amplification was: ggagtgagtacggtgtgctgggaactgaaagtcaagatg (SEQ ID NO.40), and the reverse primer was: gagtggatgctggatggcctccaaatagttaactgtattgtc (SEQ ID NO.41). The amplified fragments were sent to the Hitom high-throughput sequencing platform of the Rice Research Institute for sequencing analysis, and the results are as follows. Figure 4 As shown.

[0054] The process of stabilizing the transformation efficiency of iCas12i3 involves transferring the iCas12i3 vector containing specific plant introns into Agrobacterium, and then infecting tobacco (such as *Agrobacterium tumefaciens*) leaves using an optimized leaf disc transformation method. After editing, the albino seedlings of regenerated buds at the S2 stage were statistically analyzed. The results showed that iCas12i3 significantly improved the knockout efficiency of the target gene compared to Cas12 without introns. No albino / chimeric tobacco edited seedlings were found in nCas12i3, but a high proportion of albino / chimeric edited seedlings were found in S2 using iCas12i3. Figure 5 As shown, the intron-optimized iCas12i3 vector exhibits higher stable expression efficiency in gene editing. This improvement makes iCas12i3 an effective tool for plant functional gene research and crop breeding.

[0055] Example 4 This embodiment is used to determine the strong compatibility of iCas nuclease with gRNA and crRNA.

[0056] The iCas nucleases disclosed herein all use type III promoters as the driving promoters for gRNA or crRNA, achieving good editing results. To further confirm the compatibility of iCas nucleases with type II promoters, it is necessary to determine whether the presence of two type II promoters (iCas nucleases are driven by type II promoters) affects the editing efficiency.

[0057] This embodiment constructs the following carrier, pDC45A-iCas9, with the structure as follows: Figure 1 As shown, the specific operation is as follows: The company synthesized a tRNA-sgRNA-EU terminator driven by the 35S promoter, and added SpeI and SbfI restriction endonuclease sites at the 5' and 3' ends, respectively. Using an enzyme digestion and ligation method, the above sequence was inserted between the SpeI and SbfI sites of pDC40-iCas9, finally forming the pDC45A-iCas9 vector. The sgRNA sequence GAGGCAAGAGATGTCCTAGG (SEQ ID NO. 42) of the tobacco targeting gene PDS was designed and inserted into the BsaI-linearized pDC45A-iCas9 vector, forming pDC45A-iCas9-PDS_sg. Transformation into HD leaves was performed using the leaf disc method, and the number of albino seedlings was counted to evaluate gRNA compatibility and editing efficiency. It was found that driving gRNA and iCas9 with type II promoters resulted in higher editing efficiency than driving with type III promoters.

[0058] To further investigate the compatibility of iCas12i3 with type II promoter-driven crRNA, this embodiment synthesized a 2X35S promoter-driven tRNA, named 35S::tRNA-DR-HDV-EU (SEQ ID NO.45). Using a forward primer (5'-3') with adapters: gccagtgccaagcttactagttacggaggtcaaa (SEQ ID NO.43) and a reverse primer (5'-3'): aacaatgaatctattcctgcagtcataactgtagaaa (SEQ ID NO.44), the synthesized template was amplified. The recovered fragment was inserted into the AvrII and SbfI double-digested linearized vector of the iCas12i3-PDS_sg vector using a homologous recombination kit (ClonExpress II One Step Cloning Kit, Novizan, C112-01). The final vector was named pDC65-iCas12i3-PDS_sg.

[0059] In subsequent leaf disc conversion experiments, the number of albino seedlings from HD tobacco leaves was counted to evaluate the editing efficiency of iCas12i3. The results are as follows: Figure 6 As shown, iCas12i3 maintains high editing efficiency under 35S driver system crRNA and exhibits strong crRNA compatibility, enabling it to retain efficient editing capabilities under different promoter systems. This achievement further establishes the broad adaptability of iCas12i3 in plant genome editing and provides a reliable and efficient tool for complex genome editing.

[0060] The preferred embodiments of this disclosure have been described in detail above with reference to the accompanying drawings. However, this disclosure is not limited to the specific details of the above embodiments. Within the scope of the technical concept of this disclosure, various simple modifications can be made to the technical solutions of this disclosure, and these simple modifications all fall within the protection scope of this disclosure.

[0061] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, this disclosure will not describe the various possible combinations separately.

[0062] Furthermore, various different embodiments of this disclosure can be combined in any way, as long as they do not violate the spirit of this disclosure, they should also be regarded as the content disclosed in this disclosure.

Claims

1. A vector for plant gene editing, characterized in that, The vector contains a Cas gene with an inserted exogenous intron; The Cas gene is Cas9, Cas12a, or Cas12i3; When the Cas gene is the Cas9 gene, the nucleotide sequence of the Cas gene with inserted exogenous introns is shown in SEQ ID NO.10; When the Cas gene is the Cas12a gene, the nucleotide sequence of the Cas gene with inserted exogenous introns is shown in SEQ ID NO.11; When the Cas gene is the Cas12i3 gene, the nucleotide sequence of the Cas gene with inserted exogenous introns is shown in SEQ ID NO.

12.

2. The carrier according to claim 1, wherein, The vector contains, in sequence, a promoter, a guide RNA insertion region, a Cas gene promoter, an NLS, a Cas gene with an inserted exogenous intron, an NLS, and a UBQ terminator.

3. The carrier according to claim 2, wherein, The promoter includes a type II promoter and / or a type III promoter; the nucleotide sequence of the type II promoter is shown in SEQ ID NO.13; the nucleotide sequence of the type III promoter is shown in SEQ ID NO.14; The guide RNA insertion region includes a gRNA insertion region and / or a CrRNA insertion region; When the Cas gene is the Cas9 gene, the guide RNA insertion region is a gRNA insertion region, and the nucleotide sequence of the gRNA insertion region is shown in SEQ ID NO.15; When the Cas gene is the Cas12a gene, the guide RNA insertion region is the CrRNA insertion region, and the nucleotide sequence of the CrRNA insertion region is shown in SEQ ID NO.16; When the Cas gene is the Cas12i3 gene, the guide RNA insertion region is the CrRNA insertion region, and the nucleotide sequence of the CrRNA insertion region is shown in SEQ ID NO.17; The nucleotide sequence of the UBQ terminator is shown in SEQ ID NO.

18.

4. A method for gene editing in plants, characterized in that, The method includes the following steps: (1) Insert a guide RNA coding sequence targeting the gene to be edited into the guide RNA insertion region of the vector according to claim 3 to obtain a gene editing vector; (2) The gene editing vector was introduced into Agrobacterium to obtain a transformant; (3) Infect the pre-cultured plant leaves with the transformant, and then culture the infected plant leaves in a culture medium containing hygromycin; The plant in question is tobacco.

5. The method according to claim 4, wherein, When the Cas gene in the vector is the Cas9 gene, the nucleotide sequence of the guide RNA targeting the gene to be edited is shown in SEQ ID NO. 19; When the Cas gene in the vector is the Cas12a gene, the nucleotide sequence of the guide RNA targeting the gene to be edited is shown in SEQ ID NO. 20; When the Cas gene in the vector is the Cas12i3 gene, the nucleotide sequence of the guide RNA targeting the gene to be edited is shown in SEQ ID NO. 21.

Images