Transposon molecular marker for regulating heading date advance of sorghum and application

Abstract

The application discloses a transposon molecular marker for regulating the heading date advance of sorghum and application. The SbDTH2 gene for regulating the heading date of sorghum has a functional allelic variation of 7416 bp transposon insertion at a promoter 2622 bp away from an upstream of a start codon, which is named as Sbdth2 variation type. The functional allelic variation causes the heading date advance of sorghum, and a molecular marker for high-throughput detection is developed according to the functional allelic variation, which has the advantages of flexibility, high efficiency, high-throughput, low cost and the like. The molecular marker can efficiently detect the distribution of the variation in sorghum varieties, screen sorghum germplasm resources containing or not containing the allelic variation, and be used for crop improvement; meanwhile, the marker assisted selection can be carried out in a breeding population, and new sorghum varieties with suitable heading dates in different regions are bred, which has important significance for expanding the regional planting of sorghum and improving the yield.

Description

Technical Field

[0001] This invention relates to the field of crop genetics and breeding, specifically to a transposon molecular marker for regulating the earlier heading date of sorghum and its application. Background Technology

[0002] The heading period, referring to the time interval between sowing and heading, is one of the important agronomic traits of crops. It is a key factor in crop adaptation to the external environment and a crucial trait determining crop yield, planting season, and regional adaptability. It plays a decisive role in the quantity and quality of crop production and is influenced by both genes and the environment. When environmental conditions change, the heading period of crops also changes. Generally, when crops are moved from short-day to long-day regions, the heading period and vegetative growth period are prolonged. This extension mechanism allows all tissues and parts of the crop to develop fully, gradually forming a complete and robust plant, providing sufficient nutrient transport for later reproductive growth and ultimately increasing biomass. However, extending the heading period beyond a certain point restricts later reproductive growth, preventing further yield increases and even severely reducing yield. Therefore, research on the genetic basis of the heading period can help crops head at the appropriate time, maximizing the utilization of temperature and light resources and thus maximizing yield. This is of great significance for breeding crop varieties suitable for specific planting environments.

[0003] Sorghum is the world's fifth largest cereal crop and a versatile crop. Since its domestication in Ethiopia and Sudan many years ago, it has been widely cultivated in different climate zones around the world, used as food, feed, fuel, and fiber. Sorghum is a typical photoperiod-sensitive plant. Generally, when sorghum is transferred from its original domestication environment to a new one, the photoperiod changes, making it difficult for the sorghum to flower and hindering its normal growth. Different types of sorghum also have different photoperiod sensitivities; bioenergy sorghum is highly sensitive to photoperiod, while sorghum genotypes used for food production are generally insensitive. Therefore, the utilization of sorghum in food and biomass production in temperate regions mainly depends on controlling its flowering time.

[0004] Flowering time is one of the main objectives selected by sorghum in adapting to different geographical environments, and it is a key agronomic trait determining whether sorghum can be used as a food crop or a biomass crop. Although flowering time is crucial to sorghum agronomy, little is known about the molecular mechanisms regulating sorghum flowering. Currently, genetic analysis has identified only six maturation sites (named Ma1-Ma6) that alter photoperiod sensitivity. Under long-day conditions, these maturation sites delay sorghum flowering. Among them, Ma1 was identified as SbPRR7, a pseudo-response regulatory homolog of rice OsPRR37, which inhibits flowering under long-day conditions. Ma3 encodes phytochrome B (PHYB), while Ma6 corresponds to SbGhd7, a homolog of the rice flower suppressor Ghd7. In addition, studies have identified sorghum flowering site T (SbFT) genes. Among 19 PEBP genes, SbFT1, SbFT8, and SbFT10 have been identified by various methods as potential candidate genes encoding flowering-promoting genes.

[0005] With the dwindling global reserves of non-renewable energy sources such as coal, oil, and natural gas, the development and utilization of biomass energy has attracted the attention of scientists worldwide. Compared to traditional sorghum breeding methods, which are time-consuming, labor-intensive, easily affected by environmental factors, and lack accuracy, new sorghum varieties obtained by using specific molecular markers to assist selection and adjust the heading date based on base differences in target genes are poised to become indispensable raw materials for biomass energy due to their advantages such as high biomass yield, strong resistance to adverse conditions, wide planting range, and high ethanol conversion rate. However, current research on sorghum is still in its early stages, and a thorough analysis of the vast gene network regulating the heading date of sorghum remains a significant challenge. Therefore, we need to obtain as much data as possible related to the heading date, conduct more in-depth and extensive research on the genes regulating the heading date of sorghum, and cultivate high-yielding, stable-yielding, and widely adaptable sorghum varieties. Summary of the Invention

[0006] To address the above-mentioned technical shortcomings, this invention provides a transposon molecular marker and its application for regulating the earlier heading stage of sorghum.

[0007] This invention is achieved through the following technical solution:

[0008] This invention provides a molecular marker for a novel functional allelic variant of the sorghum heading time gene SbDTH2, namely Sbdth2. The molecular marker is used to mark a novel functional allelic variant of the sorghum heading time gene SbDTH2, namely Sbdth2, in which a transposon is inserted 2622 bp before the promoter ATG of the sorghum chromosome 9 gene SbDTH2. The allelic variant Sbdth2 has an earlier heading time.

[0009] Preferably, the number of bases in the transposon is 7416 bp.

[0010] Preferably, the molecular marker comprises forward primers 1F and 2F; the reverse primer is 2R;

[0011] The primer DTH2-F-1, labeled Sbdth2, has the sequence number SEQ ID NO.1 and the sequence is as follows:

[0012] 5'TGTCCGGCTGTGATACAAAA 3';

[0013] The primer DTH2-F-2 has the sequence number SEQ ID NO.2 and the sequence is as follows:

[0014] 5'TTCTTGCTGCGACGATAATG 3';

[0015] The DTH2-R-2 sequence number is SEQ ID NO.3, and the sequence is as follows:

[0016] 5'ACATTGTCCAACCATGCTCA 3'. Sequence number SEQ ID NO.2, sequence as follows:

[0017] Preferably, the molecular marker can identify the allelic variant Sbdth2;

[0018] Amplification using 2F and 2R yielded 7416 bp of the Sbdth2 genotype;

[0019] Amplification was performed using 1F and 2R, and the deletion of 7416bp resulted in the SbDTH2 genotype.

[0020] The molecular markers can be used to detect whether sorghum varieties, lines, or germplasm resources are of the Sbdth2 genotype.

[0021] The molecular markers can be used to detect the distribution of key functional allelic variations in Chinese sorghum germplasm resources.

[0022] The molecular markers can be used for marker-assisted selection breeding of genes during the heading stage of sorghum.

[0023] The beneficial effects of this invention are as follows: This invention, through QTL mapping, discovered a variant site regulating the heading time of sorghum—a transposon insertion in the SbDTH2 gene—and developed it into a molecular marker. Developing molecular markers closely linked to the heading time of sorghum for early (low generation) selection in breeding plays an important role in reducing breeding time, improving the sorghum's broad-spectrum breeding, and ultimately increasing economic benefits.

[0024] This invention provides a gene regulating the heading stage of sorghum.

[0025] A novel variant of SbDTH2 provides a high-throughput molecular marker for detecting genes related to sorghum heading date, which has significant value in breeding. This marker allows for rapid, flexible, efficient, and high-throughput detection of key variants within the SbDTH2 gene that alter sorghum heading date. It can be used to detect the distribution of key functional allelic variants in sorghum germplasm resources, efficiently screen sorghum germplasm resources with ideal heading dates, and apply to marker-assisted selection breeding based on sorghum heading date genes.

[0026] SbDTH2 has significant value in expanding the planting range of sorghum. Attached Figure Description

[0027] Figure 1 The diagram shows the phylogenetic tree of SbDTH2.

[0028] Figure 2 The diagram illustrates the subcellular localization of SbDTH2.

[0029] Figure 3 This is a schematic diagram of the SbDTH2 transposon.

[0030] Figure 4 These are amplification gel images of Tx430 and P898012 transposons, where T indicates the presence of transposon insertion and P indicates the absence of transposon insertion.

[0031] Figure 5 It is a statistical analysis of the presence or absence of transposons in different groups and the heading period.

[0032] Figure 6 This is a gel image of F2 population genotyping, where A is primer 1F / 2R; B is a gel image of primer 2F / 2R amplification.

[0033] Figure 7 This is a gel image of the Sbdth2 / SbDTH2 genotyping in a natural population, where A is a gel image of primer 1F / 2R; B is a gel image of primer 2F / 2R amplification. Figure 8 This is a gel image of the Sbdth2 / SbDTH2 genotyping in a natural population, where A is a gel image of primer 1F / 2R; B is a gel image of primer 2F / 2R amplification. Detailed Implementation

[0034] Example 1: Bioinformatics Analysis of SbDTH2

[0035] The SbDTH2 protein encodes 745 amino acids and is most closely related to maize. This protein is a non-transmembrane, hydrophilic protein with a molecular weight of 80.4 kDa and an isoelectric point of 9.07. It lacks temperature-responsive PolyQ repeat sequences and PrD domains (see [link to relevant documentation]). Figure 1 , 2 ).

[0036] Example 2: Subcellular localization of SbDTH2

[0037] To understand the subcellular localization of SbDTH2, an expression vector SbDTH2-pBI121 with a GFP tag was constructed and transformed into Agrobacterium GV3101. Agrobacterium was then transferred into the lower epidermis of leaves from approximately 5-week-old *Nicotiana Bunsenata* plants. After injection, the plants were cultured for another 2 days, using pBI121-GFP as a control. Leaf fluorescence was observed using a two-photon laser confocal microscope (Zeiss, Germany). Subcellular localization results showed that the empty pBI121-GFP vector fluoresced in the cell membrane, cytoplasm, and nucleus, while the SbDTH2 gene fluoresced only in the nucleus (see...). Figure 3 This indicates that SbDTH2 is a nuclear protein.

[0038] Example 3: SbDTH2 Polymorphism Analysis

[0039] To analyze the polymorphism of the SbDTH2 gene, we performed sequence alignment of the gene at lengths 3000 bp upstream and 3600 bp downstream of the ATG in the published genomes of the varieties Tx430, P898012, RIO, and Tx623 (heading stage). A total of 31 polymorphic sites were found: 23 in the promoter, 2 in the exon, and 6 in the intron. Among these, only one site, located at 2622p upstream of the ATG, contained a 7416 bp insertion (…). Figure 4 Structural analysis revealed that it belongs to the Gypsy transposon and is only present in the early-flowering varieties Tx430 and Tx623, while it is absent in the late-flowering varieties P898012 and RIO. It is speculated that the transposon is a functional mutation.

[0040]

[0041] Note: "." represents missing characters.

[0042] Table 1. Statistics on polymorphic sites of various nucleotides

[0043] The genotype with transposon insertion is named Sbdth2; the genotype without transposon insertion is named SbDTH2.

[0044] Example 4: Transposon conversion to molecular marker

[0045] We designed two pairs of primers for transposons, including forward primers 1F and 2F; and a reverse primer 2R.

[0046] The primer sequence for labeling Sbdth2 is as follows:

[0047] DTH2-F-1 (SEQ ID NO.1)

[0048] 5'TGTCCGGCTGTGATACAAAA 3';

[0049] DTH2-F-2 (SEQ ID NO.2)

[0050] 5'TTCTTGCTGCGACGATAATG 3';

[0051] DTH2-R-2 (SEQ ID NO.3)

[0052] 5'ACATTGTCCAACCATGCTCA 3';

[0053] Amplification using 1F and 2R methods revealed that the Tx430 strain could amplify an 8022bp fragment, while the P898012 strain amplified a 606bp fragment, indicating a 7416bp deletion in the P898012 strain (see [link to relevant documentation]). Figure 5 P898012 is the SbDTH2 genotype.

[0054] Amplification using 2F and 2R methods revealed a 533bp target band on Tx430, while P898012 showed no target band (see [link to data]). Figure 5 Tx430 is the Sbdth2 genotype;

[0055] Example 5: Determination of Functional Variation

[0056] Using molecular markers to statistically analyze the heading date and the presence or absence of transposons in different populations, it was found that in the F2 population (Tx430 / Hongyingzi) and the natural population, varieties with transposon insertions had an average heading date earlier than varieties without transposon insertions. Figure 6 The results indicate that the SbDTH2 gene regulates the heading period of sorghum, and the insertion of the transposon is a functional mutation.

[0057] Example 6: Genotyping of Recombinant Inbred Line Population

[0058] The population consisted of 192 F2 generation plants from a recombinant inbred line population constructed using Tx430(Sbdth2) / Red Tassel (SbDTH2). The heading time was statistically analyzed as follows: Figure 7 As shown in the figure, 38 materials were of the Sbdth2 genotype, 43 materials were of the SbDTH2 genotype, and 117 materials were heterozygous. The segregation ratio of materials was 1:2:1, which meets the segregation ratio. The results are as follows. Figure 7 As shown

[0059] Example 7: Identification of the presence or absence of transposons in sorghum varieties from different sources

[0060] The experimental materials used for transposon identification included 161 sorghum varieties from China and Africa. The heading time of these 161 varieties was statistically analyzed. Figure 8 As shown.

[0061] The presence or absence of transposons in 161 sorghum varieties from China and Africa was determined by 1% agarose gel electrophoresis. 100 varieties contained transposons, while 61 varieties did not.

[0062] The above description is only a preferred embodiment of this patent. It should be noted that for those skilled in the art, several improvements and substitutions can be made without departing from the technical principles of this patent, and these improvements and substitutions should also be considered within the scope of protection of this patent.

Claims

1. A method for detecting the allelic variant Sbdth2 of the sorghum heading stage gene SbDTH2, characterized in that, The method described: Amplification reaction was performed using specific primer pairs: (a) A first primer pair, wherein the forward primer has the sequence shown in SEQ ID NO.1 and the reverse primer has the sequence shown in SEQ ID NO.3; and / or, (b) A second primer pair, wherein the forward primer has the sequence shown in SEQ ID NO.2 and the reverse primer has the sequence shown in SEQ ID NO.3; If a 606bp amplified fragment is obtained when using the first primer pair, it indicates that the sample does not contain a 7416bp transposon insertion and is of the SbDTH2 genotype. If a 533bp amplified fragment is obtained when using the second primer pair, it indicates that the sample contains a 7416bp transposon insertion, which is the Sbdth2 genotype. The allelic variant Sbdth2 headed earlier.

2. The method according to claim 1, characterized in that, Simultaneously, amplification was performed using both the first primer pair and the second primer pair.

3. A method for identifying or assisting in the identification of sorghum genotypes at the heading stage, characterized in that, The method uses the following primer pairs for amplification: a) Amplification was performed using the first primer pair with forward primer SEQ ID NO.1 and reverse primer SEQ ID NO.3; b) Amplification was performed using a second primer pair with forward primer SEQ ID NO.2 and reverse primer SEQ ID NO.3; If reaction a) produces a 606bp amplification product and reaction b) does not produce a 533bp amplification product, then the genotype of the sample is determined to be SbDTH2 homozygous. If reaction a) does not produce a 606bp amplification product and reaction b) produces a 533bp amplification product, then the genotype of the sample is determined to be Sbdth2 homozygous. If reaction a) produces a 606bp amplification product and reaction b) also produces a 533bp amplification product, then the genotype of the sample is determined to be SbDTH2 / Sbdth2 heterozygous. The Sbdth2 homozygous variety heads earlier.

4. The method according to claim 3, characterized in that, The method is used for marker-assisted selection breeding of sorghum.

5. The method according to claim 4, characterized in that, The purpose of the molecular marker-assisted selection breeding is to select sorghum varieties with a target heading date.

6. The application of a detection reagent in the preparation of a product for identifying the genotype of sorghum at the heading stage, characterized in that, The detection reagent uses specific primer pairs for amplification reaction: (a) A first primer pair, wherein the forward primer has the sequence shown in SEQ ID NO.1 and the reverse primer has the sequence shown in SEQ ID NO.3; and / or, (b) A second primer pair, wherein the forward primer has the sequence shown in SEQ ID NO.2 and the reverse primer has the sequence shown in SEQ ID NO.3; If a 606bp amplified fragment is obtained when using the first primer pair, it indicates that the sample does not contain a 7416bp transposon insertion and is of the SbDTH2 genotype. If a 533bp amplified fragment is obtained when using the second primer pair, it indicates that the sample contains a 7416bp transposon insertion, which is the Sbdth2 genotype. The allelic variant Sbdth2 heads earlier.

Images