InDel molecular marker for identifying seed-use pumpkin defeng seed 1 hybrid and application and method of primer thereof
Patent Information
- Application Number
- CN202510045092.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-10
- Publication Date
- 2026-09-18
- Estimated Expiration
- 2045-01-10
AI Technical Summary
田间形态鉴定成本较高,周期较长,且鉴定结果还会受到环境因素的影响;同工酶鉴定准确性高,但由于其具有组织和器官特异性,应用常常受到限制
[0046] 1. This invention develops a pair of molecular markers and primers that can be used to identify the purity of hybrid seeds of Indian pumpkin 'Defengzi No. 1'. These molecular markers can quickly distinguish between true and false hybrids, and have high specificity and genetic stability. They can be quickly applied to molecular marker-assisted breeding screening for pumpkin purity.
Smart Images

Figure CN119753221B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular marker and assisted breeding technology, and specifically relates to the application and method of InDel molecular markers and their primers for identifying the seed-producing Indian pumpkin hybrid Defengzi No. 1. Background Technology
[0002] Indian squash (Cucurbita moschata D.), a herbaceous plant belonging to the genus Cucurbita in the Cucurbitaceae family, originated in the Americas and is an important horticultural vegetable crop widely cultivated globally. Indian squash has multiple uses, including for seeds, meat, and rootstock. During the hybridization and seed production process of Indian squash, incomplete or untimely removal of male flowers from the female parent during pollination can lead to pollen landing on the stigma of the female parent, resulting in self-pollination and the formation of false hybrids. This reduces the genetic purity of the seeds, causing significant economic losses. Therefore, the rapid and accurate identification of the purity of superior F1 hybrids has become one of the most pressing problems to be solved in Indian squash production.
[0003] Common methods for seed purity identification include field morphological identification, isozyme identification, and molecular marker identification. Field morphological identification is costly and time-consuming, and the results are affected by environmental factors. Isozyme identification is highly accurate, but its application is often limited due to its tissue and organ specificity. Molecular marker technology can reveal subtle genetic differences between offspring and parents at the DNA level, and is unaffected by growing season, environmental conditions, and cultivation practices, greatly shortening the identification time. Among them, InDel markers have advantages such as high polymorphism, large number, good stability, and ease of detection, and are widely used in purity identification and molecular marker-assisted breeding.
[0004] In recent years, the seed-producing Indian pumpkin variety 'Defengzi No. 1' has become increasingly popular among consumers due to its seeds being rich in crude fat, unsaturated fatty acids, amino acids, minerals, vitamins, and sugars. As its cultivation area expands, the demand for its seeds is also increasing. To prevent the formation of false hybrids through self-pollination of the female parent during artificial seed production, it is urgent to determine a method for identifying the purity of 'Defengzi No. 1' hybrid seeds, providing technical support for the purity identification of Indian pumpkins. Summary of the Invention
[0005] To address the gaps in the aforementioned fields, this invention aims to provide an InDel molecular marker for identifying the purity of hybrid seeds of Indian pumpkin 'Defengzi No. 1'; and a PCR detection kit for identifying the purity of hybrid seeds of Indian pumpkin 'Defengzi No. 1'. By applying the InDel marker to identify the authenticity or seed purity of hybrid Indian pumpkin 'Defengzi No. 1', DNA can be extracted during the seedling stage without waiting for individual pumpkin plants to mature to observe morphological characteristics. The amplified fragments can then be used to distinguish between true and false hybrids, effectively identifying hybrid purity.
[0006] The above-mentioned objective of the present invention is achieved through the following technical solution:
[0007] The InDel molecular marker 5482813 used to identify the seed-producing Indian pumpkin 'Defengzi No. 1' hybrid is characterized in that the characteristic sequence of the InDel molecular marker 5482813 in the female parent of the Indian pumpkin 'Defengzi No. 1' hybrid has an additional insertion sequence GAAGACGAAGAAGAA at positions 94-108 compared to the characteristic sequence of the InDel molecular marker 5482813 in the male parent of the Indian pumpkin 'Defengzi No. 1' hybrid.
[0008] The sequence of the upstream primer 5482813-F for detecting the InDel molecular marker 5482813 is shown in SEQ ID NO.3, and the sequence of the downstream primer 5482813-R is shown in SEQ ID NO.4.
[0009] The characteristic sequence of the InDel molecular marker in the genome of the maternal parent 'DF-M3' of the seed-producing Indian squash 'Defengzi No. 1' is shown in SEQ ID NO. 1;
[0010] Preferably, the characteristic sequence of the InDel molecular marker in the genome of the paternal parent 'DF-F2' of the seed-producing Indian squash 'Defengzi No. 1' hybrid is as shown in SEQ ID NO. 2;
[0011] Preferably, the characteristic sequences of the InDel molecular marker in the seed-producing Indian squash 'Defengzi No. 1' hybrid are as shown in SEQ ID NO. 1 and SEQ ID NO. 2, respectively.
[0012] The use of upstream primer 5482813-F with sequence as shown in SEQ ID NO.3 and downstream primer 5482813-R with sequence as shown in SEQ ID NO.4 in the detection and identification of seed-growing Indian squash 'Defengzi No. 1' hybrid.
[0013] The upstream primer 5482813-F, as shown in SEQ ID NO.3, and the downstream primer 5482813-R, as shown in SEQ ID NO.4, were used to detect the characteristic sequences of the seed-growing Indian pumpkin hybrid 'Defengzi No. 1', as shown in SEQ ID NO.1 and SEQ ID NO.2, respectively.
[0014] The upstream primer 5482813-F, as shown in SEQ ID NO.3, and the downstream primer 5482813-R, as shown in SEQ ID NO.4, were used to detect the characteristic sequences of the female parent of the Indian pumpkin 'Defengzi No. 1' hybrid seed, as shown in SEQ ID NO.1.
[0015] The upstream primer 5482813-F, as shown in SEQ ID NO.3, and the downstream primer 5482813-R, as shown in SEQ ID NO.4, were used to detect the characteristic sequences of the male parent of the seed-growing Indian pumpkin 'Defengzi No. 1' hybrid, as shown in SEQ ID NO.2.
[0016] A method for molecular identification of seed-producing Indian squash 'Defengzi No. 1' hybrid, characterized in that the candidate squash material is subjected to PCR using primers of the InDel molecular marker 5482813 used for identifying seed-producing Indian squash 'Defengzi No. 1' hybrid.
[0017] The primers used to identify the InDel molecular marker 5482813 of the seed-producing Indian squash 'Defengzi No. 1' hybrid include: the upstream primer 5482813-F with the sequence shown in SEQ ID NO. 3 and the downstream primer 5482813-R with the sequence shown in SEQ ID NO. 4;
[0018] Preferably, the PCR system comprises: 0.75 ng / μl DNA template, 5 ng / μl each of forward and reverse primers, and 0.5 μL / μl 2×3G Taq Master Mix for PAGE (Red Dye);
[0019] Preferably, the PCR system is as follows: 7.5 ng DNA template, 50 ng each of forward and reverse primers, 5 μL 2×3G TaqMaster Mix for PAGE (Red Dye), and double-distilled water to 10 μL;
[0020] Preferably, the PCR program includes: pre-denaturation at 95°C for 3 minutes; 35 cycles consisting of denaturation at 95°C for 15 seconds, annealing at 55°C for 15 seconds, and extension at 72°C for 30 seconds; and incubation at 72°C for 5 minutes.
[0021] Preferably, the DNA template refers to the DNA of the candidate pumpkin material.
[0022] The identification results are determined based on the electrophoresis or sequencing results of the PCR products.
[0023] Candidate pumpkin material whose electrophoresis results show two characteristic bands or whose sequencing results simultaneously detect two sequences as shown in SEQ ID NO.1 and SEQ ID NO.2 is the seed-producing Indian pumpkin 'Defengzi No. 1' hybrid;
[0024] Preferably, the electrophoresis refers to separating the PCR products using a 6% non-denaturing polyacrylamide gel.
[0025] Preferably, the electrophoresis conditions are 150V constant power electrophoresis separation for 1 hour and 30 minutes, followed by silver staining for color development.
[0026] This invention provides the InDel molecular marker 5482813 and its primer pairs 5482813-F and 5482813-R, which are mainly used in the identification and auxiliary identification of pumpkin hybrid seeds, the screening of pumpkin hybrid seeds for purity, and the molecular marker-assisted breeding of pumpkin.
[0027] Another aspect of the present invention is to provide a PCR detection kit for verifying the authenticity of a hybrid of the seed-producing Indian squash variety 'Defengzi No. 1' or identifying the purity of 'Defengzi No. 1' hybrid seeds. The PCR detection kit includes: dNTPs, Taq enzyme, a PCR primer pair consisting of a forward primer and a reverse primer, an amplification buffer, and sterile water; wherein the PCR primer is the InDel molecular marker 5482813 described above.
[0028] Another aspect of the present invention is to provide a method for identifying the authenticity or seed purity of the seed-producing Indian squash variety 'Defengzi No. 1': by applying the InDel marker, PCR amplification, and detection by 6% non-denaturing polyacrylamide gel electrophoresis, the polymorphism between different individuals can be displayed, thereby achieving the purpose of identification.
[0029] Specifically, this invention provides a method for identifying the seed purity of the seed-producing Indian squash variety 'Defengzi No. 1' based on the InDel marker, the method comprising:
[0030] (1) Extract genomic DNA from the pumpkin seed sample to be tested;
[0031] (2) Using the extracted genomic DNA of the sample as a template, PCR amplification reaction was carried out using the upstream and downstream primers 5482813-F and 5482813-R shown in SEQ ID No.3 and SEQ ID No.4 to obtain PCR products;
[0032] (3) The PCR amplification products from step (2) were detected by polyacrylamide gel electrophoresis.
[0033] (4) Analyze the electrophoresis results of step (3). If the band pattern of each amplification product is simultaneously the band pattern of the parents of the 'Defengzi No. 1' hybrid, then the pumpkin variety to be tested is the 'Defengzi No. 1' hybrid; if the band pattern of any amplification product is not simultaneously the band pattern of the parents of the 'Defengzi No. 1' hybrid, then the pumpkin variety to be tested is not the 'Defengzi No. 1' hybrid.
[0034] (5) Calculate the ratio of the actual number of 'Defengzi No. 1' hybrid seeds to the total number of tested seeds to obtain the seed purity of 'Defengzi No. 1' hybrid seeds.
[0035] The PCR system includes: 0.75 ng / μl DNA template, 5 ng / μl each of forward and reverse primers, and 0.5 μL / μl 2×3G Taq Master Mix for PAGE (Red Dye);
[0036] Preferably, the PCR system is as follows: 7.5 ng DNA template, 50 ng each of forward and reverse primers, 5 μL 2×3G TaqMaster Mix for PAGE (Red Dye), and double-distilled water to 10 μL;
[0037] The DNA template consists of the genomic DNA of individual seedlings of the maternal parent 'DF-M3', the paternal parent 'DF-F2', and 'Defengzi No. 1'.
[0038] Preferably, the PCR program is as follows: pre-denaturation at 95°C for 3 minutes; one cycle consists of denaturation at 95°C for 15 seconds, annealing at 55°C for 15 seconds, and extension at 72°C for 30 seconds, for a total of 35 cycles; incubation at 72°C for 5 minutes.
[0039] Preferably, the detection further includes: electrophoresis of the PCR products;
[0040] The electrophoresis refers to the separation of PCR products using a 6% non-denaturing polyacrylamide gel.
[0041] Preferably, the electrophoresis conditions are: constant power electrophoresis at 150V for 1 hour and 30 minutes, followed by silver staining for color development.
[0042] Preferably, if the band pattern of each amplification product simultaneously possesses the band pattern of the 'Defengzi No. 1' hybrid parent, then the pumpkin variety to be tested is the 'Defengzi No. 1' hybrid; if the band pattern of any amplification product does not simultaneously possess the band pattern of the 'Defengzi No. 1' hybrid parent, then the pumpkin variety to be tested is not the 'Defengzi No. 1' hybrid.
[0043] Preferably, purity calculation refers to the percentage of hybrid seeds out of the total number of seeds in the tested sample;
[0044] The female parent of the seed-producing Indian pumpkin hybrid 'Defengzi No. 1' is 'DF-M3', and the male parent of the pumpkin hybrid 'Defengzi No. 1' is 'DF-F2'. The F1 hybrid plants all refer to individual plants of the 'Defengzi No. 1' hybrid.
[0045] The beneficial effects of this invention are:
[0046] 1. This invention develops a pair of molecular markers and primers that can be used to identify the purity of hybrid seeds of Indian pumpkin 'Defengzi No. 1'. These molecular markers can quickly distinguish between true and false hybrids, and have high specificity and genetic stability. They can be quickly applied to molecular marker-assisted breeding screening for pumpkin purity.
[0047] 2. Using the primers and methods of this invention, only genomic DNA needs to be extracted from pumpkin seedling leaves, followed by PCR amplification and polyacrylamide gel electrophoresis, to quickly and effectively identify the purity of 'Defengzi No. 1' hybrid seeds. No field observation is required. This method is fast, accurate, low-cost, and has high commercial value.
[0048] 3. The method of this invention demonstrates high specificity and accuracy in identifying the purity of hybrid pumpkin seeds, consistent with field seed survey results, with an accuracy rate of up to 100%. Using the 5482813 molecular marker and primers provided by this invention, the identification method can rapidly and accurately detect 'Defengzi No. 1' hybrid seeds and their parent seeds during the seedling stage. The molecular marker developed in this invention can be applied to the field production and seed production of Indian pumpkin 'Defengzi No. 1' hybrid seeds. Attached Figure Description
[0049] Figure 1 Electrophoretic patterns of the parents and 'Defengzi No. 1' (Marker, 750bp; maternal parent 'DF-M3', paternal parent 'DF-F2'; the remaining bands are 'Defengzi No. 1' hybrid bands; the maternal parent band is SEQ ID No. 1; the paternal parent band is SEQ ID No. 2). Detailed Implementation
[0050] The present invention will be further described in detail below with reference to specific embodiments, but this does not limit the scope of the invention. Unless otherwise specified, the operations used in the following embodiments are conventional methods, and the reagents used are commercially available.
[0051] Sources of biomaterials
[0052] I. The experimental materials used in Experimental Examples 1 and 2 of this invention: the female parent 'DF-M3' and the male parent 'DF-F2' are pumpkin strains owned by the applicant's laboratory. The applicant promises to distribute the seeds of the above-mentioned pumpkin strains to the public within 20 years from the date of application to verify the effect of this invention;
[0053] Second, the hybrid 'Defengzi No. 1' used in Experimental Example 2 of this invention is a well-known and widely used pumpkin variety that can be commercially purchased.
[0054] Main reagents
[0055] PCR experiments were performed using 2×3G Taq Master Mix for PAGE (Red Dye) from Vazyme; gel electrophoresis was performed using 40% non-denaturing polyacrylamide from Beijing Coolplay Technology Co., Ltd., diluted to 6% before use. Sequencing was performed at Beijing Sangon Biotech Co., Ltd.
[0056] Group 1 Examples, INDEL molecular marker 5482813 of the present invention
[0057] This set of embodiments provides the InDel molecular marker 5482813 for identifying the seed-producing Indian pumpkin 'Defengzi No. 1' hybrid. All embodiments in this set share the following common feature: the characteristic sequence of the InDel molecular marker 5482813 in the female parent of the Indian pumpkin 'Defengzi No. 1' hybrid contains an additional insertion sequence GAAGACGAAGAAGAA at positions 94-108 compared to the characteristic sequence of the InDel molecular marker 5482813 in the male parent of the Indian pumpkin 'Defengzi No. 1' hybrid.
[0058] In a further embodiment, the upstream primer 5482813-F sequence of the InDel molecular marker 5482813 is shown as SEQ ID NO.3, and the downstream primer 5482813-R sequence is shown as SEQ ID NO.4.
[0059] In a specific embodiment, the characteristic sequence of the InDel molecular marker in the genome of the maternal parent 'DF-M3' of the seed-producing Indian squash 'Defengzi No. 1' hybrid is as shown in SEQ ID NO. 1;
[0060] Preferably, the characteristic sequence of the InDel molecular marker in the genome of the paternal parent 'DF-F2' of the seed-producing Indian squash 'Defengzi No. 1' hybrid is as shown in SEQ ID NO. 2;
[0061] Preferably, the characteristic sequences of the InDel molecular marker in the seed-producing Indian squash 'Defengzi No. 1' hybrid are as shown in SEQ ID NO. 1 and SEQ ID NO. 2, respectively.
[0062] Group 2 Examples, Detection Applications of the Primers of the Present Invention
[0063] This set of embodiments provides the use of upstream primer 5482813-F with the sequence shown in SEQ ID NO.3 and downstream primer 5482813-R with the sequence shown in SEQ ID NO.4 in detecting and identifying seed-growing Indian squash 'Defengzi No. 1' hybrid.
[0064] In a specific embodiment, the upstream primer 5482813-F with the sequence shown in SEQ ID NO.3 and the downstream primer 5482813-R with the sequence shown in SEQ ID NO.4 are used to detect the characteristic sequences of the seed-growing Indian pumpkin hybrid 'Defengzi No. 1', as shown in SEQ ID NO.1 and SEQ ID NO.2, respectively.
[0065] In other embodiments, the upstream primer 5482813-F with the sequence shown in SEQ ID NO.3 and the downstream primer 5482813-R with the sequence shown in SEQ ID NO.4 detect the characteristic sequences of the female parent of the seed-growing Indian pumpkin 'Defengzi No. 1', as shown in SEQ ID NO.1, respectively.
[0066] In some embodiments, the upstream primer 5482813-F with the sequence shown in SEQ ID NO.3 and the downstream primer 5482813-R with the sequence shown in SEQ ID NO.4 detect the characteristic sequences of the male parent of the seed-growing Indian pumpkin 'Defengzi No. 1' hybrid, as shown in SEQ ID NO.2, respectively.
[0067] Group 3 Examples, Molecular Identification Method of the Present Invention
[0068] This set of embodiments provides a method for molecular identification of seed-producing Indian squash 'Defengzi No. 1' hybrid. All embodiments in this set share the following common feature: PCR is performed on candidate squash materials using primers for the InDel molecular marker 5482813 described in any of the embodiments of the first set for identifying seed-producing Indian squash 'Defengzi No. 1' hybrid.
[0069] In some embodiments, the primers for identifying the InDel molecular marker 5482813 of the seed-growing Indian squash 'Defengzi No. 1' hybrid include: an upstream primer 5482813-F with the sequence shown in SEQ ID NO. 3 and a downstream primer 5482813-R with the sequence shown in SEQ ID NO. 4;
[0070] Preferably, the PCR system comprises: 0.75 ng / μl DNA template, 5 ng / μl each of forward and reverse primers, and 0.5 μL / μl 2×3G Taq Master Mix for PAGE (Red Dye);
[0071] Preferably, the PCR system is as follows: 7.5 ng DNA template, 50 ng each of forward and reverse primers, 5 μL 2×3G TaqMaster Mix for PAGE (Red Dye), and double-distilled water to 10 μL;
[0072] Preferably, the PCR program includes: pre-denaturation at 95°C for 3 minutes; 35 cycles consisting of denaturation at 95°C for 15 seconds, annealing at 55°C for 15 seconds, and extension at 72°C for 30 seconds; and incubation at 72°C for 5 minutes.
[0073] Preferably, the DNA template refers to the DNA of the candidate pumpkin material.
[0074] In a further embodiment, the identification result is determined based on the electrophoresis result or sequencing result of the PCR product;
[0075] Candidate pumpkin material whose electrophoresis results show two characteristic bands or whose sequencing results simultaneously detect two sequences as shown in SEQ ID NO.1 and SEQ ID NO.2 is the seed-producing Indian pumpkin 'Defengzi No. 1' hybrid;
[0076] Preferably, the electrophoresis refers to separating the PCR products using a 6% non-denaturing polyacrylamide gel.
[0077] Preferably, the electrophoresis conditions are 150V constant power electrophoresis separation for 1 hour and 30 minutes, followed by silver staining for color development.
[0078] Experimental Example 1: Screening of Specific Molecular Markers
[0079] Using pumpkin InDel primers and the whole genome DNA of the maternal parent 'DF-M3' and paternal parent 'DF-F2' as templates, polymorphic primers were screened among the parents. Finally, a codominant differential marker between the parents was identified and named 5482813, with the following sequence:
[0080] 5482813-F:CAACACGAACCCAGATGCAA(SEQ ID NO.3)
[0081] 5482813-R: CTCTCTCACACGGCGAAATG (SEQ ID NO. 4);
[0082] The marker banding pattern was clear and reproducible. Primer 5482813 amplified a specific 218-nucleotide fragment of the maternal 'DF-M3' and a specific 203-nucleotide fragment of the paternal 'DF-F2' (see [link to primer]). Figure 1 ).
[0083] Experimental Example 2: Purity Identification of 'Defengzi No. 1' Indian Pumpkin Hybrid
[0084] 1. Identification Methods
[0085] 1.1 Extraction of leaf genomic DNA
[0086] Seeds of the parent plants (maternal 'DF-M3' and paternal 'DF-F2') and sample seeds were simultaneously sown in 50-cell trays and watered regularly until two true leaves emerged. Leaves were taken from individual plants of the paternal, maternal, and 100 hybrid sample seeds. Genomic DNA was extracted from each plant using the standard CTAB method.
[0087] (1) Take about 0.2g of fresh leaves into a 2ml centrifuge tube, put it into liquid nitrogen, and then quickly grind it into powder with a glass rod;
[0088] (2) Add 800 μl of 2% CTAB preheating buffer;
[0089] (3) 65℃ water bath for 1.0h (during which the centrifuge tube is slowly shaken up and down once every 10min to ensure that the dry powder sample and CTAB are fully mixed);
[0090] (4) After cooling to below 15°C at room temperature, add an equal volume (800 μl) of 24:1 chloroform / isoamyl alcohol, mix well for 10 min to ensure that the sample and chloroform are fully mixed, and centrifuge for 10 min (13000 rpm / min).
[0091] (5) Transfer 600 μl of the supernatant to a new 1.5 ml centrifuge tube and repeat step (4);
[0092] (6) Take 400 μl of the supernatant into another 1.5 ml centrifuge tube, add 800 μl of anhydrous ethanol that has been pre-cooled in the refrigerator, mix well, and let stand in the -20℃ refrigerator for 30 min.
[0093] (7) Centrifuge at 13000 rpm for 10 min, discard the supernatant and collect the precipitate;
[0094] (8) Add 500ul of 70% ethanol, wash twice, and let stand at room temperature for 5-10 minutes;
[0095] (9) Centrifuge at 7500 rpm for 5 min, discard the supernatant, and place the open end in a clean bench to dry.
[0096] (10) Add 100 μl ddH2O to dissolve the DNA.
[0097] 1.2 PCR amplification and detection analysis
[0098] Using the genomic DNA described in 1.1 as a template and 5482813 as a primer, PCR amplification was performed.
[0099] The PCR reaction system consisted of 10 μL of reaction mixture, 3 μL of DNA (5.0 ng·μL-1), 1 μL each of forward and reverse primers (50 ng·μL-1), and 5 μL of 2×3G Taq Master Mix for PAGE (Red Dye) (Vazyme product).
[0100] The PCR amplification program was as follows: 95℃ pre-denaturation for 3 minutes; 95℃ denaturation for 15 seconds, 55℃ annealing for 15 seconds, 72℃ extension for 30 seconds, 35 cycles; 72℃ incubation for 5 minutes, storage at 10℃.
[0101] PCR products were separated using a 6% non-denaturing polyacrylamide gel electrophoresis with 0.5×TBE as the electrophoresis buffer. Electrophoresis was performed at a constant power of 150V for 1 h 30 min. After electrophoresis, silver staining was performed, and the band patterns were statistically analyzed.
[0102] If the band pattern of each amplification product simultaneously possesses the band pattern of the 'Defengzi No. 1' hybrid parents, then the pumpkin variety to be tested is the 'Defengzi No. 1' hybrid. Those lacking any characteristic band from either parent or having a non-parental specific band are false hybrids.
[0103] 2. Results Analysis
[0104] The purity of the 'Defengzi No. 1' hybrid was determined by PCR amplification and electrophoresis using InDel primer 5482813. The results are shown in [Figure number missing]. Figure 1 ,from Figure 1 It can be clearly seen that a specific band of 218 bp was amplified in the maternal parent 'DF-M3' and a specific band of 203 bp was amplified in the paternal parent 'DF-F2'. Among the tested seeds, 100 lane electrophoresis patterns were identical to those of the 'Defengzi No. 1' hybrid, resulting in a pumpkin hybrid purity of 100.0%, consistent with the field seed purity survey results, with an accuracy rate of 100%. The electrophoresis patterns of 100 'Defengzi No. 1' seeds are shown below. Figure 1 As shown.
[0105] The aforementioned field seed purity survey refers to distinguishing the seed purity of specific pumpkin plants based on their field morphology (primarily fruit shape). Plants with flattened, round fruits correspond to 'Defengzi No. 1' seeds, while plants with oblong fruits correspond to non-'Defengzi No. 1' seeds. This field seed purity survey method is a commonly used approach in this field for identifying the purity of 'Defengzi No. 1' seeds.
[0106] Although the present invention has been described in detail above through general description and specific embodiments, some modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention are within the scope of protection claimed by the present invention.
Claims
1. The InDel molecular marker 5482813 used to identify the seed-producing Indian squash hybrid Defeng Seed No. 1, characterized in that, The characteristic sequence of the InDel molecular marker 5482813 in the female parent of the Indian pumpkin Defeng Seed No. 1 hybrid has an additional insertion sequence GAAGACGAAGAAGAA at positions 94-108 compared to the characteristic sequence of the InDel molecular marker 5482813 in the male parent of the Indian pumpkin Defeng Seed No. 1 hybrid; the characteristic sequences of the InDel molecular marker in the seed-grade Indian pumpkin Defeng Seed No. 1 hybrid are shown in SEQ ID NO. 1 and SEQ ID NO. 2, respectively.
2. The InDel molecular marker 5482813 for identifying the seed-producing Indian squash hybrid Defeng Seed No. 1 as described in claim 1, characterized in that, The sequence of the upstream primer 5482813-F for detecting the InDel molecular marker 5482813 is shown in SEQ ID NO.3, and the sequence of the downstream primer 5482813-R is shown in SEQ ID NO.
4.
3. The InDel molecular marker 5482813 for identifying the seed-producing Indian squash hybrid Defeng Seed No. 1 as described in claim 1, characterized in that, The characteristic sequence of the InDel molecular marker in the genome of the maternal parent 'DF-M3' of the seed-producing Indian squash hybrid Defeng Seed No. 1 is shown in SEQ ID NO. 1; And / or, the characteristic sequence of the InDel molecular marker in the genome of the paternal parent 'DF-F2' of the seed-producing Indian squash hybrid Defeng Seed No. 1 is shown in SEQ ID NO.
2.
4. The use of the upstream primer 5482813-F with the sequence shown in SEQ ID NO.3 and the downstream primer 5482813-R with the sequence shown in SEQ ID NO.4 in the detection and identification of seed-grade Indian squash hybrid Defeng Seed No. 1, characterized in that, The upstream primer 5482813-F with the sequence shown in SEQ ID NO.3 and the downstream primer 5482813-R with the sequence shown in SEQ ID NO.4 are used to detect the characteristic sequences of the seed-producing Indian pumpkin hybrid Defengzi No. 1, as shown in SEQ ID NO.1 and SEQ ID NO.2, respectively.
5. The use of the upstream primer 5482813-F with the sequence shown in SEQ ID NO.3 and the downstream primer 5482813-R with the sequence shown in SEQ ID NO.4, according to claim 4, in detecting and identifying the seed-grade Indian squash hybrid Defeng Seed No. 1, characterized in that, The upstream primer 5482813-F with the sequence shown in SEQ ID NO.3 and the downstream primer 5482813-R with the sequence shown in SEQ ID NO.4 were used to detect the characteristic sequence of the female parent of the Indian pumpkin hybrid Defeng Seed No. 1, as shown in SEQ ID NO.
1.
6. The use of the upstream primer 5482813-F with the sequence shown in SEQ ID NO.3 and the downstream primer 5482813-R with the sequence shown in SEQ ID NO.4, according to claim 4, in detecting and identifying the seed-grade Indian squash hybrid Defeng Seed No. 1, characterized in that, The upstream primer 5482813-F, as shown in SEQ ID NO.3, and the downstream primer 5482813-R, as shown in SEQ ID NO.4, were used to detect the characteristic sequence of the male parent of the seed-producing Indian pumpkin hybrid Defengzi No. 1, as shown in SEQ ID NO.
2.
7. A method for molecular identification of the seed-growing Indian pumpkin hybrid Defeng Seed No. 1, characterized in that, The candidate pumpkin material was subjected to PCR using the InDel molecular marker 5482813 described in any one of claims 1-3 for identifying the seed-producing Indian pumpkin hybrid Defengzi No.
1. The characteristic sequences of the seed-producing Indian pumpkin hybrid Defengzi No. 1, detected by the upstream primer 5482813-F with the sequence shown in SEQ ID NO. 3 and the downstream primer 5482813-R with the sequence shown in SEQ ID NO. 4, are shown in SEQ ID NO. 1 and SEQ ID NO. 2, respectively.
8. The method for molecular identification of the Indian pumpkin hybrid Defengzi No. 1 according to claim 7, characterized in that, The primers used to identify the InDel molecular marker 5482813 of the seed-producing Indian squash Defengzi No. 1 hybrid include: an upstream primer 5482813-F with the sequence shown in SEQ ID NO. 3 and a downstream primer 5482813-R with the sequence shown in SEQ ID NO. 4; And / or, the PCR system comprises: 0.75 ng / μl DNA template, 5 ng / μl each of forward and reverse primers, and 0.5 μL / μl 2×3G Taq Master Mix for PAGE; And / or, the PCR system is: 7.5 ng DNA template, 50 ng each of forward and reverse primers, 5 μL 2×3G TaqMaster Mix for PAGE, and double-distilled water to 10 μl; And / or, the PCR program includes: pre-denaturation at 95°C for 3 minutes; 35 cycles consisting of denaturation at 95°C for 15 seconds, annealing at 55°C for 15 seconds, and extension at 72°C for 30 seconds; and incubation at 72°C for 5 minutes. And / or, the DNA template refers to the DNA of the candidate pumpkin material.
9. A method for molecular identification of the seed-grade Indian pumpkin hybrid Defeng Seed No. 1, as described in claim 7 or 8, characterized in that, The identification results are determined based on the electrophoresis or sequencing results of the PCR products. Candidate pumpkin material whose electrophoresis results show two characteristic bands or whose sequencing results simultaneously detect two sequences as shown in SEQ ID NO.1 and SEQ ID NO.2 is the seed-producing Indian pumpkin Defengzi No. 1 hybrid; And / or, the electrophoresis refers to the separation of PCR products using a 6% non-denaturing polyacrylamide gel. And / or, the electrophoresis conditions are 150V constant power electrophoresis separation for 1 hour and 30 minutes, followed by silver staining.
Citation Information
Patent Citations
Primers and method for purity identification of cucurbita maxima 'Danhong No.3' hybrid seeds
CN106520934A
Molecular marker for identifying purity of hybrid seed of winter squash Yinhui No.3 and applications thereof
CN106916897A