A heart-targeted nano-liposome delivery carrier, a circular RNA drug for treating cardiovascular diseases and a preparation method and application thereof

Abstract

The application provides a heart-targeting nanoliposome delivery carrier, a circular RNA drug for treating cardiovascular diseases and a preparation method and application thereof, and belongs to the field of biomedical technologies. The heart-targeting nanoliposome delivery carrier comprises a nanoliposome particle in a capsule shape and a heart-targeting peptide CMP modified on the surface of the nanoliposome particle; and the amino acid sequence of the heart-targeting peptide CMP is shown in SEQ ID NO: 6. The heart-targeting nanoliposome delivery carrier has a good heart-targeting effect; the nanoliposome delivery carrier is used as a delivery tool to accurately deliver the circular RNA drug to a heart part, so that the effect of treating cardiovascular diseases (such as myocardial hypertrophy) is greatly improved, a new treatment mode is provided for clinically treating cardiovascular diseases, and the purpose of efficiently preventing and treating heart diseases is achieved.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to a cardiac-targeted nanoliposome delivery carrier, a circular RNA drug for treating cardiovascular diseases, its preparation method, and its application. Background Technology

[0002] Cardiovascular disease is the leading cause of death worldwide. Among these, myocardial ischemia-reperfusion injury and myocardial hypertrophy have high incidence rates and lack effective treatments. Currently, with technological advancements, the use of RNA molecules to treat human diseases has attracted widespread attention. Compared to linear mRNA, circRNA exhibits higher stability and tissue specificity, making it an ideal candidate for disease biomarkers and therapeutic targets.

[0003] To effectively and stably express RNA formulations in vivo, lipid nanoparticles (LNPs) are currently a commonly used method. Lipid nanoparticles are nanoscale carriers for drug delivery, composed of structural lipids and polyethylene glycol (PEG)-modified lipids. They prevent LNP aggregation and unwanted interactions with the biological environment, and are widely used for delivering small molecule and nucleic acid drugs. Typical LNPs consist of a single phospholipid outer layer enclosing an electron-dense core. The ionizable lipids aggregate into inverted micelles surrounding the trapped RNA molecule. Under acidic conditions in vivo, these ionizable lipids are protonated and can bind to negatively charged endosome membranes, causing endosome rupture and releasing the endosome. Currently, there are no reports on cardiac-targeted nanoliposome delivery carriers. Summary of the Invention

[0004] In view of this, the purpose of the present invention is to provide a cardiac-targeted nanoliposome delivery carrier, which achieves specific targeting of the heart by modifying the surface of the nanoliposome with the cardiac-targeting peptide CMP.

[0005] The present invention provides a cardiac-targeted nanoliposome delivery carrier, comprising sac-like nanoliposome particles and cardiac-targeting peptide CMP modified on the surface of the nanoliposome particles;

[0006] The amino acid sequence of the cardiac targeting peptide CMP is shown in SEQ ID NO:6.

[0007] Preferably, the nanoliposome particles comprise ionizable lipids, cholesterol, distearate phosphatidylcholine, DMG-PEG2K, and DSPE-PEG2K-carboxy-NHS in a molar ratio of 50:38.5:10:1.2:0.3. 。

[0008] Preferably, the molar ratio of the cardiac targeting peptide CMP to DSPE-PEG2K-carboxy-NHS is (10-100):1.

[0009] Preferably, the heart-targeting peptide CMP is coupled to the nanoliposome particles by forming an amide bond between the amino group and the NHS group in DSPE-PEG2K-carboxy-NHS.

[0010] The present invention provides a circular RNA drug for treating cardiovascular diseases, comprising the nanoliposome delivery carrier and a circular RNA molecule for treating cardiovascular diseases encapsulated within the nanoliposome delivery carrier.

[0011] Preferably, the circular RNA molecule includes Circ-UTRN;

[0012] The nucleotide sequence of the Circ-UTRN is shown in SEQ ID NO:5.

[0013] Preferably, the mass ratio of the circular RNA molecule to the nanoliposome delivery carrier is 5.67:1.

[0014] This invention provides a method for preparing the circular RNA drug, comprising the following steps:

[0015] Circular RNA molecules, ionizable lipids, cholesterol, distearate phosphatidylcholine, DMG-PEG2K, and DSPE-PEG2K-carboxy-NHS were mixed using microfluidic technology to obtain nanoliposomes encapsulating circular RNA molecules.

[0016] The nanoliposomes encapsulating the circular RNA molecules were mixed and stirred with the cardiac-targeting peptide CMP to obtain a circular RNA drug.

[0017] Preferably, during the microfluidic mixing process, the material flow rate is 4 ml / min;

[0018] The system temperature is 4°C during the mixing process; the mixing speed is 100 rpm.

[0019] This invention provides the use of the nanoliposome delivery carrier in the preparation of medicaments for the prevention and / or treatment of cardiovascular diseases.

[0020] This invention provides a cardiac-targeted nanoliposome delivery carrier, comprising encapsulated nanoliposome particles and a cardiac-targeting peptide CMP modified on the surface of the nanoliposome particles; the amino acid sequence of the cardiac-targeting peptide CMP is shown in SEQ ID NO:5. This invention modifies the surface of nanoliposomes with the cardiac-targeting peptide CMP to obtain cardiac-targeted nanoliposomes. Studies have shown that the cardiac-targeted nanoliposome delivery carrier has a good cardiac-targeting effect and can serve as a novel delivery tool system for cardiac-targeted therapy, providing a new means for nucleic acid drug delivery in cardiovascular diseases.

[0021] This invention also provides a circular RNA drug for treating cardiovascular diseases. The circular RNA molecule is loaded into a cardiac-targeted nanoliposome delivery carrier to obtain a circular RNA drug for treating cardiovascular diseases, exhibiting significant therapeutic effects on cardiovascular diseases (such as myocardial hypertrophy), providing a new treatment approach for clinical cardiovascular diseases. Simultaneously, this invention utilizes cardiac-targeted LNPs for targeted drug delivery, achieving the goal of highly efficient prevention and treatment of heart diseases. Attached Figure Description

[0022] Figure 1 Electrophoresis diagram of DNA template for in vitro transcribed circular RNA;

[0023] Figure 2 Electrophoresis diagram of in vitro transcribed circular RNA;

[0024] Figure 3 Results of qPCR detection of CT values ​​of UTRN after RNaseR digestion;

[0025] Figure 4 Sequencing results of the Circ-UTRN reverse splicing site;

[0026] Figure 5 The uptake of CON-LNP and CMP-LNP by AC16 cells, HEK293T cells, Beas-2b cells, and HepG2 cells, respectively; **p<0.01, ***p<0.005;

[0027] Figure 6 Flowchart of animal experiments using nanoliposome delivery of Circ-UTRN;

[0028] Figure 7 Results of in vivo fluorescence imaging detection of GFP protein expression in mouse hearts;

[0029] Figure 8 Results of qPCR detection of GFP expression levels in the heart and liver; **p<0.01, ***p<0.005

[0030] Figure 9 : Laser confocal microscopy was used to detect the expression of GFP protein in cardiac tissue sections; *p<0.05, ***p<0.005;

[0031] Figure 10 Schematic diagram of circular RNA encapsulated in nanoliposomes;

[0032] Figure 11 Results of the effect of Circ-UTRN on cardiomyocyte morphology;

[0033] Figure 12 : Expression of Circ-UTRN in AC16 cells; **p<0.01;

[0034] Figure 13 LDH assay results for the toxicity of LNP-Circ-UTRN to AC16;

[0035] Figure 14 Results of Circ-UTRN expression in mouse heart and liver;

[0036] Figure 15 Immunofluorescence staining results of the therapeutic effect of LNP-Circ-UTRN on PE-induced NRCM cell hypertrophy;

[0037] Figure 16 Immunofluorescence staining results of the therapeutic effect of LNP-Circ-UTRN on PE+ISO-induced NMCM cell hypertrophy; *p<0.05. Detailed Implementation

[0038] The present invention provides a cardiac-targeted nanoliposome delivery carrier comprising sac-like nanoliposome particles and a cardiac-targeting peptide CMP modified on the surface of the nanoliposome particles; the amino acid sequence of the cardiac-targeting peptide CMP is shown in SEQ ID NO:6.

[0039] In this invention, the particle size of the encapsulated nanoliposome particles is preferably 80-120 nm, and can be 100 nm. The encapsulated nanoliposome particles are hollow nanoparticles formed by liposome film, which can serve as drug delivery carriers, utilizing the hollow structure to encapsulate drug molecules. These nanoliposome particles, also known as cationic lipids or lipid compositions, are used in the field of drug delivery. "Lipid nanoparticles" or "LNPs" refer to nanoscale (e.g., 1-1000 nm) particles containing one or more types of lipid molecules. The LNP may contain at least one non-lipid payload molecule, for example, one or more nucleic acid molecules. The lipid component of the LNP contains at least one cationic lipid and at least one polyethylene glycol-modified lipid. It is anticipated that the cationic lipid can interact with the negatively charged payload molecule and promote payload incorporation and / or encapsulation into the LNP during LNP formation. The term "cationic lipid" refers to a lipid that carries a positive charge at any pH or hydrogen ion activity in its environment, or a lipid that can become positively charged in response to the pH or hydrogen ion activity of its environment (e.g., its intended use environment). Therefore, the term "cationic" encompasses both "permanently cationic" and "cationizable." The term "lipid," also known as "lipids," includes, but is not limited to, esters of fatty acids, and is characterized by generally poor solubility in water but soluble in many nonpolar organic compounds. Although lipids generally have poor solubility in water, certain classes of lipids (e.g., lipids modified with polar groups such as DMG-PEG2k) have limited water solubility and can dissolve in water under certain conditions. This also includes phospholipids, sphingolipids, glycolipids, steroids and sterols, and lipoproteins. The term "derived lipids," including simple lipid derivatives and complex lipid derivatives, possess the general properties of lipids. In one specific embodiment of the present invention, the components of the nanoliposome particles include ionizable lipids, DMG-PEG2K, cholesterol, DSPC, and DSPE-PEG2K-carboxy-NHS. The ionizable lipids include SM-102. The function of the ionizable lipids is that after the nanoliposome particles enter the body, under acidic conditions, the ionizable lipids are protonated and can bind to negatively charged endosomal membranes, causing the nanoliposome particles to rupture and release the loaded nucleic acid drug. The DMG-PEG2K has polar groups, which improve the water solubility of the nanoliposomes; the DSPC improves the rigidity and stability of the nanoliposomes. The cholesterol increases the stability of the nanoliposomes and helps cell membrane fusion. The DSPE-PEG2K-carboxy-NHS is used for subsequent conjugation of the cardiac-targeting peptide CMP.In this invention, the components of the nanoliposome particles preferably include ionizable lipids (SM-102), cholesterol, distearate phosphatidylcholine, DMG-PEG2K, and DSPE-PEG2K-carboxy-NHS in a molar ratio of 50:38.5:10:1.2:0.3. 。 The preferred molar ratio of the cardiac-targeting peptide CMP to DSPE-PEG2K-carboxy-NHS is (10–100):1, but it can be 20–80:1, 30–70:1, or 50:1. The cardiac-targeting peptide CMP is preferably coupled to the nanoliposome particles via an amide bond formed between its amino group and the NHS group in DSPE-PEG2K-carboxy-NHS. The cardiac-targeting peptide CMP possesses cardiac targeting properties, enabling the coupled nanoliposome delivery carrier to migrate towards the heart, increasing the uptake rate by cardiomyocytes, thereby improving the efficacy of the delivered drug.

[0040] In this invention, the method for preparing the nanoliposome particles preferably involves mixing ionizable lipids, cholesterol, distearate phosphatidylcholine, DMG-PEG2K, and DSPE-PEG2K-carboxy-NHS in a specific molar ratio using microfluidic technology to obtain nanoliposomes encapsulating cyclic RNA molecules.

[0041] In this invention, the microfluidic technology includes mixing using a microfluidic instrument. The flow rate of the microfluidic instrument is controlled at 4 ml / min. The mixing temperature is preferably room temperature, specifically 18–25°C, and can be 20°C.

[0042] The present invention provides a circular RNA drug for treating cardiovascular diseases, comprising the nanoliposome delivery carrier and a circular RNA molecule for treating cardiovascular diseases encapsulated within the nanoliposome delivery carrier.

[0043] In this invention, the nanoliposome delivery carrier comprises a circular RNA molecule partially or completely encapsulated within a liposome shell. The circular RNA molecule is a negatively charged molecule, such as in vitro transcribed circular RNA-Circ-UTRN. In one embodiment of this invention, the circular RNA molecule preferably comprises Circ-UTRN. The nucleotide sequence of the Circ-UTRN is shown in SEQ ID NO:3. The mass ratio of the circular RNA molecule to the nanoliposome delivery carrier is 5.67:1.

[0044] In this invention, the method for preparing Circ-UTRN preferably includes the following steps: amplifying the DNA fragment of Circ-UTRN using PCR; producing phosphorylated linear in vitro transcribed Circ-UTRN RNA using a T7 polymerase system in conjunction with a GMP system; and circularizing the linear RNA using a T4 DNA ligase system supplemented by DNA clips with complementary sequences at both ends of circ-UTRN to obtain the in vitro transcribed circular RNA-Circ-UTRN drug. The primers for PCR amplification of the Circ-UTRN DNA fragment include those shown in SEQ ID NO:1 and SEQ ID NO:2. The nucleotide sequence of the PCR-amplified Circ-UTRN DNA fragment is shown in SEQ ID NO:3. The nucleotide sequence of the DNA clips with complementary sequences at both ends of Circ-UTRN is shown in SEQ ID NO:4.

[0045] This invention provides a method for preparing the circular RNA drug, comprising the following steps:

[0046] Circular RNA molecules, ionizable lipids (SM-102), cholesterol, distearate phosphatidylcholine, DMG-PEG2K, and DSPE-PEG2K-carboxy-NHS were mixed using microfluidic technology to obtain nanoliposomes encapsulating circular RNA molecules.

[0047] The nanoliposomes encapsulating the circular RNA molecules were mixed and stirred with the cardiac-targeting peptide CMP to obtain a circular RNA drug.

[0048] In this invention, the microfluidic mixing is preferably performed in a microfluidic instrument. During microfluidic mixing, the flow rate of the material is preferably 3–15 ml / min, and can be 4 ml / min. During mixing and stirring, the system temperature is 3–5°C, and can be 4°C. The mixing and stirring speed is preferably 100–300 rpm, and can be 200 rpm.

[0049] This invention provides the use of the nanoliposome delivery carrier in the preparation of medicaments for the prevention and / or treatment of cardiovascular diseases.

[0050] In this invention, the cardiovascular disease includes heart failure and / or myocardial hypertrophy. The heart failure includes acute heart failure or chronic heart failure.

[0051] In this invention, the drug comprises at least one of the following routes of administration: injection, oral administration, transdermal administration, and nasal administration. Injection administration includes intravenous injection, intramuscular injection, or subcutaneous injection. Oral administration involves the drug being formulated into an oral preparation and absorbed into the bloodstream via the digestive tract. Lung administration: Transdermal administration allows the drug to be absorbed into the body through the skin. Nasal administration is administered via nasal sprays or similar forms and is suitable for brain or systemic administration.

[0052] The following detailed description, in conjunction with embodiments, illustrates a cardiac-targeted nanoliposome delivery carrier, a circular RNA drug for treating cardiovascular diseases, its preparation method, and its applications, but these should not be construed as limiting the scope of protection of this invention.

[0053] Example 1

[0054] A method for preparing in vitro transcribed circular RNA for treating cardiovascular diseases, comprising the following steps:

[0055] 1. Obtaining the DNA sequence of in vitro transcribed circular RNA (IVT-Circ-UTRN)

[0056] Using Circ-UTRN DNA as a template, the DNA sequence of the in vitro transcribed circular RNA was obtained by PCR amplification.

[0057] The primers used for PCR amplification are as follows:

[0058] IVT-Circ-UTRN-T7-G F: TAATACGACTCACTATATGGATCTCTTAGAG TTGAGT (SEQ IDNO: 1);

[0059] IVT-Circ-UTRN-T7-G R: AGGTATACAATATTCCACCA (SEQ ID NO: 2).

[0060] The nucleotide sequence of the Circ-UTRN DNA is as follows:

[0061] TGGATCTCTTAGAGTTGAGTACAACAAATGAAATTTTCAAACAGCACA

[0062] AGTTGAACCAAAATGACCAGCTCCTCAGTGTTCCAGATGTCATCAACTGTC

[0063] TGACAACAACTTATGATGGACTTGAGCAAATGCATAAGGACCTGGTCAAC

[0064] GTTCCACTCTGTGTTGATATGTGTCTCAATTGGTTGCTCAATGTCTATGACA

[0065] CGGGTCGAACTGGAAAAATTAGAGTGCAGAGTCTGAAGATTGGATTAATG

[0066] TCTCTCTCAAAGGTCTCTTGGAAGAAAAATACAGATATCTCTTTAAGGAA

[0067] GTTGCAGGGCCAACAGAAATGTGTGACCAGAGGCAGCTGGGCCTGTTACT

[0068] TCATGATGCCATCCAGATCCCCCGGCAGCTAGGTGAAGTAGCAGCTTTTGG

[0069] AGGCAGTAATATTGAGCCTAGTGTTCGCAGCTGCTTCCAACAGAATAACAA

[0070] TAAACCAGAAATAAGTGTGAAAGAGTTTATAGATTGGATGCATTTGGAACC

[0071] ACAGTCCATGGTTTGGCTCCCAGTTTTACATCGAGTGGCAGCAGCGGAGA

[0072] CTGCAAAACATCAGGCCAAATGCAACATCTGTAAAGAATGTCCAATTGTCG

[0073] GGTTCAGGTATAGAAGCCTTAAGCATTTTAACTATGATGTCTGCCAGAGTTG

[0074] TTTCTTTTCGGGTCGAACAGCAAAAGGTCACAAATTACATTACCCAATGGT

[0075] GGAATATTGTATACCT (SEQ ID NO: 3). The DNA sequence of Circ-UTRN was synthesized using conventional synthetic methods in the art. The synthesized sequence was then inserted into a pcDNA plasmid to obtain a recombinant plasmid containing the DNA sequence of Circ-UTRN.

[0076] The PCR reaction conditions are as follows:

[0077] Following the PCR reaction described in Table 1, add each reagent to a 0.1 mL eight-tube strip and perform the PCR reaction: first, heat-activate the Q5 high-fidelity polymerase at 98°C for 30 s; then, denature the DNA at 98°C for 5 s; anneal the DNA at 60°C for 10 s; and extend the DNA at 72°C for 1 min, for 35 cycles; finally, cool to 4°C after 2 minutes at 72°C. After PCR, the PCR products can be stored at -20°C for later use. The PCR system is as follows:

[0078] Table 1 PCR reaction system

[0079] RNAse-free water - Add to 25μl Add to 200μl Q5 High Fidelity 2x Master Mix 1× 12.5μl 100μl Primer 10 μM 5μM 2.5μl 20μl DNA template (1ng-10ng) 2μl 2μl total 25μl 200μl

[0080] The PCR product was a DNA fragment of in vitro transcribed circular RNA. Preliminary identification by agarose gel electrophoresis revealed the presence of the correctly sequenced target fragment, approximately 741 bp in length. Subsequently, the correctly identified product was recovered using an agarose gel extraction kit and used as a DNA template for in vitro transcription (see...). Figure 1 ).

[0081] 2. Production of phosphorylated linear in vitro transcribed Circ-UTRN RNA

[0082] The in vitro RNA transcription reaction system was prepared using the RiboMax Large RNA Production System (Promega). A 100 μl reaction mixture contained the following components: 5–10 μg of PCR-amplified T7 DNA template, 10 μl of T7 RNA polymerase mixture, 25 mM ATP, 25 mM CTP, 25 mM GTP, 20 mM GMP, and 5 mM MUTP. The prepared reaction mixture was incubated at 37°C for 2 h, followed by treatment with DNase I for 15 min to remove residual DNA template. Trizol RNA extraction was then performed, with 3 M NaOAc (pH 5.2) and isopropanol used to help precipitate the RNA. Finally, the RNA was washed with 70% ethanol and resuspended in RNase-free water, then stored at 4°C.

[0083] 3. Circularization of linear in vitro transcription

[0084] The circular RNA circularization process is as follows: linear RNA is circularized using a T4 DNA ligase system supplemented by DNA clips with complementary sequences at both ends of the circ-UTRN. Phosphorylated linear RNA and DNA clips are mixed together in a 100 μl reaction system at a molar ratio of 1:3, and then incubated at 37 °C for 2 h. The Trizol RNA extraction method is used, and during the RNA extraction process, 3M NaOAc (pH 5.2) and isopropanol are used to help precipitate RNA through in vitro transcription. Finally, the RNA is washed with 70% ethanol and then resuspended in RNase-free water and stored at -80 °C.

[0085] Table 2 Cycloning System

[0086] IVT-Circ-UTRN phosphorylated RNA 100μM DNA clip 300μM T4Ligasebuffer10x 10μl T4Ligase 10μl <![CDATA[ddH2O]]> Add to a total volume of 100 μl

[0087] The DNA clip sequences with complementary pairing at both ends of the circ-UTRN are as follows:

[0088] AAGAGATCCAAGGTATACAA (SEQ ID NO: 4).

[0089] 4. Identification of in vitro transcribed circular circ-UTRN

[0090] The prepared in vitro transcribed circular Circ-UTRN was added to RNA loading buffer and reacted in a metal bath at 70°C for 10 min. Afterward, it was placed on ice to cool naturally for RNA denaturation. The in vitro transcribed circular RNA was then identified by RNA agarose gel electrophoresis (results are shown in [link to results]). Figure 2 Subsequently, RNase R was used to digest the in vitro transcribed circular Circ-UTRN with exonuclease at 37°C for 10 min. It was found that the circularized Circ-UTRN was effectively resistant to RNase R digestion, while the linearized Circ-UTRN was largely degraded (see...). Figure 3 Finally, the in vitro transcribed circular Circ-UTRN was reverse transcribed, and the reverse splicing site of IVT-Circ-UTRN was successfully detected by Sanger sequencing (see...). Figure 4 ).

[0091] Meanwhile, the Circ-UTRN circular RNA nucleic acid sequence synthesized in this invention is as follows:

[0092] UGGAUCUCUUAGAGUUGAGUACAACAAAUGAAAUUUUCAAACAGC

[0093] ACAAGUUGAACCAAAAUGACCAGCUCCUCAGUGUUCCAGAUGUCAUCA

[0094] ACUGUCUGACAACAACUUAUGAUGGACUUGAGCAAAUGCAUAAGGACC

[0095] UGGGUCAACGUUCCACUCUGUGUUGAUAUGUGUCUCAAUUGGUUGCUCA

[0096] AUGUCUAUGACACGGGUCGAACUGGAAAAAAUAUAGAGUGCAGAGUCUGA

[0097] AGAUUGGAUUAAUGUCUCUCUCCAAAGGUCUCUUGGAAGAAAAAUACA

[0098] GAUAUCUCUUUAAGGAAGGUUGCAGGGCCAACAGAAAUGUGUGACCAGA

[0099] GGCAGCUGGGCCUGUUACUUCAUGAUGCCAUCCAGAUCCCCGGCAGC

[0100] UAGGUGAGUAGCAGCUUUUGGAGGCAGUAAAUAUUGAGCCUAGUGUUC

[0101] GCAGCUGCCUUCCAACAGAAUAACAAUAAACCAGAAAUAAGUGUGAAAG

[0102] AGUAUAAGAUUGGAUGCAUUUGGAACCACAGUCCAUGGGUUUGGCUCC

[0103] CAGUUUUACAUCGAGUGGCAGCAGCGGAGACUGCAAAACAUCAGGCCA

[0104] AAUGCAACAUCUGUAAGAAUGUCCAAUUGUCGGGUUCAGGUAUAGAA

[0105] GCCUUAAGCAUUUUAACUAUGAUGUCUGCCAGAGUUGUUCUUUCGG

[0106] GUCGAAACAGCAAAAGGUCACAAAUUACAUACCCAAUGGUGGAAUAUU

[0107] GUAUACCU (SEQ ID NO:5).

[0108] The above results indicate that an in vitro transcribed circular RNA with the same characteristics as the endogenous RNA was produced through in vitro transcription RNA synthesis.

[0109] Example 2

[0110] A method for preparing cardiac-targeted nanoliposomes includes the following steps:

[0111] 1. Preparation of RNA drugs for treating cardiovascular diseases

[0112] LNP-mod-GFP preparation method: LNP components, including ionizable lipids (SM-102), cholesterol, distearate phosphatidylcholine (DSPC), DMG-PEG2K (DMG-PEG2000), and DSPE-PEG2K-carboxy-NHS (DSPE-PEG2000-carboxy-NHS), were prepared in a molar ratio of 50:38.5:10:1.2:0.3. mod-GFP RNA (purchased from a commercial company) and LNP raw materials were prepared using a microfluidic LNP preparation instrument at a flow rate of 4 ml / min. The amount of mod-GFP RNA used was formulated according to a mass ratio of 5.67:1 between the circular RNA molecules and the total mass of the nanoliposome delivery carrier components. Subsequently, LNP-mod-GFP was obtained by ultrafiltration using a 100 kDa ultrafiltration tube at 4 °C and 1200 g.

[0113] 2. Cardiac-targeted LNP modification

[0114] The LNP-mod-GFP prepared above was added to 10 times the molar amount of CMP peptide (SEQ ID NO:6, WLSEAGPVVTVRALRGTGSW) of DSPE-PEG2K-carboxy-NHS, and stirred and incubated at 4°C for 24 h. Then, the excess peptide was removed by washing and filtration to obtain cardiac-targeting CMP-LNP-mod-GFP.

[0115] Finally, the RNA content was adjusted using a high-throughput multi-angle light scattering concentration analyzer, and the CMP-LNP-mod-GFP and LNP-mod-GFP were adjusted to an RNA concentration of 0.25 μg / μl, and stored at 4℃ for use.

[0116] 3. Investigation into the cardiac targeting function of CMP-LNP-mod-GFP at the cellular level

[0117] The prepared LNP-mod-GFP and CMP-LNP-mod-GFP were added to the wells of H9C2 cells, HepG2 cells, BEAS-2B cells, and HEK293T cells, respectively, at a volume of 500 ng, 2 μL per well. After 24 h of cell uptake, images were taken using a high-content cell imaging system to observe the cell uptake of CMP-LNP-mod-GFP and GFP protein expression. HepG2 cells, BEAS-2B cells, and HEK293T cells with CMP-LNP-mod-GFP uptake served as the control group.

[0118] See results Figure 5 . Figure 5 The results showed that CMP-LNP-mod-GFP (CMP-LNP) could be taken up by more H9C2 cells than LNP-mod-GFP (CON-LNP), while the uptake was reduced in HepG2, BEAS-2B and HEK293T cells.

[0119] 2. Investigation into the cardiac targeting function of CMP-LNP-mod-GFP at the animal level

[0120] Mice were injected via tail vein into each mouse with 200 μL of PBS and the same volume of the prepared LNP-mod-GFP and CMP-LNP-mod-GFP, respectively. The injection volume of LNP-mod-GFP and CMP-LNP-mod-GFP was recorded as 50 μg of mod-GFP RNA. Mice hearts were removed for fluorescence imaging after 24 h, 48 h, and 96 h, respectively. The flowchart is shown below. Figure 6 .

[0121] Compared to LNP-mod-GFP, in vivo imaging of mouse hearts showed that CMP-LNP-mod-GFP exhibited an enrichment trend in mouse hearts starting from 24 hours (see...). Figure 7 ).

[0122] RNA was extracted from mouse heart and liver tissues, and the relative quantitative expression of GFP RNA was detected using quantitative real-time PCR. The primer sequences for quantitative real-time PCR are as follows:

[0123] hsa-C-UTRN-div-F: GTCCAATTGTCGGGTTCAGG (SEQ ID NO: 7);

[0124] hsa-C-UTRN-div-R: CACAGAGTGGAACGTTGACC (SEQ ID NO: 8);

[0125] The reaction conditions for quantitative real-time PCR (qPCR) are as follows:

[0126] Following the qPCR reaction described in Table 2, each reagent was added to a 384-well real-time PCR plate for PCR. The PCR reaction consisted of 40 cycles: first, SYBR polymerase was thermally activated at 95°C for 30 seconds; then, DNA was denatured at 95°C for 5 seconds; followed by DNA annealing at 60°C for 10 seconds. After each cycle, the plate was cooled to 4°C. The qPCR system is shown in Table 3.

[0127] Table 3 qPCR reaction system

[0128] 2xchamQuniversalSYBRqPCRmastermix 2× 2.5μl Primer 10 μM 1μM 0.5μl cDNA template (10 ng) 2μl total 5μl

[0129] Compared to unmodified LNP, CMP-LNP effectively delivered mod-GFP RNA to the mouse heart at the 24-hour time point (see...). Figure 8 ).

[0130] Further analysis of mouse heart sections using laser confocal microscopy revealed GFP fluorescent protein expression. At both 24 and 48 hours, GFP protein expression was significantly higher in the CMP-LNP-mod-GFP group than in the LNP-mod-GFP group (see...). Figure 9 ).

[0131] The above results indicate that CMP-modified LNPs exhibit good targeting at both the cellular and animal levels. Therefore, CM-LNP is a promising cardiac-targeting LNP and can serve as a novel cardiac-targeting delivery tool.

[0132] Example 3

[0133] A method for preparing an RNA drug for treating cardiovascular diseases and its efficacy verification in animals.

[0134] 1. Preparation of LNP-Circ-UTRN nanoliposomes

[0135] LNP-Circ-UTRN was prepared as follows: Ionizable lipids (SM-102), cholesterol, distearate phosphatidylcholine (DSPC), DMG-PEG2K (DMG-PEG2000), and DSPE-PEG2K-carboxy-NHS (DSPE-PEG2000-carboxy-NHS) were mixed in a molar ratio of 50:38.5:10:1.2:0.3 to prepare LNP. The Circ-UTRN prepared in Example 1 and the LNP raw materials were then used in a microfluidic LNP preparation instrument at a flow rate of 4 ml / min to prepare LNP-Circ-UTRN. The mass ratio of Circ-UTRN to the total mass of the nanoliposome delivery carrier components was 5.67:1. Subsequently, LNP-Circ-UTRN was obtained by ultrafiltration and centrifugation using a 100 kDa ultrafiltration tube at 4 °C and 1200 g.

[0136] 2. Cardiac-targeted LNP-Circ-UTRN modification

[0137] The LNP-Circ-UTRN prepared above was added to 10 times the molar amount of CMP peptide in DSPE-PEG2K-carboxy-NHS, and incubated at 4°C with stirring for 24 h. Excess peptide was then removed by washing and filtration to obtain cardiac-targeting CMP-LNP-Circ-UTRN. Finally, the RNA concentration was adjusted using a high-throughput multi-angle light scattering analyzer to a final concentration of 0.25 μg / μl for both CMP-LNP-Circ-UTRN and LNP-Circ-UTRN, and stored at 4°C for use (see [link to product description]). Figure 10 ).

[0138] 3. Cytotoxicity validation of CMP-LNP-Circ-UTRN

[0139] AC16 cells were treated with PBS and the aforementioned prepared CMP-LNP-Circ-UTRN, with dosages of 100 ng and 500 ng of CMP-LNP-Circ-UTRN, respectively. After 24 h of cell uptake, cell morphology was observed using an inverted microscope. The results showed that CMP-LNP-Circ-UTRN had no effect on AC16 cell morphology (see [link to article]). Figure 11 ).

[0140] Subsequently, RNA was extracted from AC16 cells containing the prepared CMP-LNP-Circ-UTRN, and the expression of Circ-UTRN was detected. The prepared CMP-LNP effectively delivered Circ-UTRN to AC16 cells (see...). Figure 12 ).

[0141] Finally, LDH analysis was used to determine whether the viability of AC16 cells treated with the above-prepared CMP-LNP-Circ-UTRN was affected. The results showed that CMP-LNP-Circ-UTRN did not affect cell viability (see [link to LDH test]). Figure 13 ).

[0142] 4. CMP-LNP-Circ-UTRN protects against PE / ISO-induced cardiomyocyte hypertrophy in primary mice and rats.

[0143] Primary rat / mouse cardiomyocytes were isolated from newborn rats and mice aged 0-3 days. One day after isolation and culture, the cardiomyocytes were treated with PE / ISO (100 μM) and 500 ng of the above-prepared CMP-LNP-Circ-UTRN, respectively. After 48 h of treatment, the cells were fixed and actinin staining was performed to observe the size of the cardiomyocytes.

[0144] The results showed that CMP-LNP-Circ-UTRN could effectively inhibit pathological myocardial hypertrophy induced by PE / ISO (see...). Figure 14 and Figure 15 ).

[0145] 5. Animal-level delivery of CMP-LNP-Circ-UTRN

[0146] Mice were injected with PBS and the prepared CMP-LNP-Circ-UTRN via tail vein injection, with each mouse receiving the same dose of 200 μL. The amount of CMP-LNP-Circ-UTRN injected was 50 μg based on in vitro transcribed RNA. Twenty-four hours after injection, RNA was extracted from the heart and liver tissues of the mice, and the expression level of Circ-UTRN was detected.

[0147] Compared to the PBS group, CMP-LNP effectively delivered Circ-UTRN to the mouse heart at the 24-hour time point (see...). Figure 16 ).

[0148] In summary, the results indicate that CMP-LNP-Circ-UTRN can improve pathological hypertrophy of cardiomyocytes and successfully deliver in vitro transcribed Circ-UTRN in mouse hearts.

[0149] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A circular RNA drug for treating myocardial hypertrophy, characterized in that, It includes a nanoliposome delivery carrier and a circular RNA molecule for treating myocardial hypertrophy encapsulated within the nanoliposome delivery carrier; The nanoliposome delivery carrier comprises encapsulated nanoliposome particles and cardiac-targeting peptide CMP modified on the surface of the nanoliposome particles. The amino acid sequence of the cardiac targeting peptide CMP is shown in SEQ ID NO:6; The nanoliposome particles are composed of ionizable lipids, cholesterol, distearate phosphatidylcholine, DMG-PEG2K and DSPE-PEG2K-carboxy-NHS in a molar ratio of 50:38.5:10:1.2:0.

3. The cardiac-targeting peptide CMP is coupled to nanoliposome particles by forming an amide bond between the amino group and the NHS group in DSPE-PEG2K-carboxy-NHS. The circular RNA molecule is Circ-UTRN; The nucleotide sequence of the Circ-UTRN is shown in SEQ ID NO:

5.

2. The circular RNA drug for treating myocardial hypertrophy according to claim 1, characterized in that, The molar ratio of the cardiac-targeting peptide CMP to DSPE-PEG2K-carboxy-NHS is (10~100):

1.

3. The circular RNA drug for treating myocardial hypertrophy according to claim 1, characterized in that, The mass ratio of the circular RNA molecule to the nanoliposome delivery carrier is 5.67:

1.

4. A method for preparing the circular RNA drug according to any one of claims 1 to 3, characterized in that, Includes the following steps: Circular RNA molecules, ionizable lipids, cholesterol, distearate phosphatidylcholine, DMG-PEG2K, and DSPE-PEG2K-carboxy-NHS were mixed using microfluidic technology to obtain nanoliposomes encapsulating circular RNA molecules. The nanoliposomes encapsulating the circular RNA molecules were mixed and stirred with the cardiac-targeting peptide CMP to obtain a circular RNA drug.

5. The preparation method according to claim 4, characterized in that, During the mixing process using the microfluidic technology, the flow rate of the material is 4 ml / min; The system temperature is 4°C during the mixing process; the mixing speed is 100 rpm.

Images