An elastin peptide fusion protein, its preparation method and application

Abstract

This invention relates to the field of bioengineering technology, and discloses an elastin peptide fusion protein, its preparation method, and its applications. Based on elastin with the amino acid sequence as shown in SEQ ID NO.8, this invention achieves high-yield expression of elastin using Pichia pastoris GS115. The elastin of this invention is fused with bovine lactoferrin peptide, which has natural antibacterial functions. By fusing bovine lactoferrin N-leaf peptide and bovine lactoferrin peptide with the elastin peptide shown in SEQ ID NO.8, the fusion protein is endowed with more functions while ensuring a high expression level. This allows the fusion protein to be applied in cosmetics, medical devices such as artificial blood vessels, and other products. The elastin of this invention exhibits good biocompatibility and natural antiseptic properties.

Description

Technical Field

[0001] This invention relates to the field of bioengineering technology, and in particular to an elastin peptide fusion protein, its preparation method, and its application. Background Technology

[0002] Elastin is the most stable protein in the extracellular matrix and an important structure found in many connective tissues. Synthesized and secreted by fibroblasts and keratinocytes, it possesses excellent elasticity and unique physiological functions. Although elastin accounts for only 2-4% of the total protein content of the skin, it is crucial for maintaining skin structure. Elastin is rich in nonpolar amino acids such as glycine, proline, alanine, leucine, and valine, and typically forms a flexible and stable structure through repetitive sequences of 3-9 amino acids.

[0003] Elastin plays a vital role in maintaining skin elasticity, moisturizing, promoting wound healing, maintaining vascular health, and protecting the skin barrier, and is widely used in skincare products, pharmaceuticals, and food processing. Currently, most elastin raw materials in the industry are extracted from biological tissues rich in elastic fibers, such as arterial walls, ligaments, and skin. The supply of biological tissue raw materials is affected by various factors, such as animal epidemics and environmental policies; instability in raw material supply can lead to increased production costs.

[0004] In the cosmetics industry, the addition of elastin to skincare products makes skin more hydrated and elastic. However, the addition of chemical preservatives in skincare products can lead to skin irritation, allergies, inflammation, and potential safety risks. Furthermore, chemical preservatives can cause cumulative chronic harm to the body, such as forming an unhealthy stratum corneum and accelerating skin aging. Therefore, finding a natural antibacterial agent to replace chemical preservatives is extremely urgent. Summary of the Invention

[0005] To address the problem of elastin preparation, this invention provides an elastin peptide fusion protein, its preparation method, and its applications.

[0006] The specific technical solution of this invention is as follows: In a first aspect, the present invention provides an elastin peptide fusion protein, the fusion protein comprising bovine lactoferrin N-leaf peptide, bovine lactoferrin peptide, and elastin peptide, the amino acid sequence of the fusion protein being shown in SEQ ID NO.1.

[0007] Based on elastin with an amino acid sequence such as SEQ ID NO. 8, this invention constructs a fusion protein. The elastin of this invention is fused with bovine lactoferrin peptide, which has natural antibacterial function. By fusing bovine lactoferrin N-leaf peptide, bovine lactoferrin peptide with the elastin peptide encoded by the nucleotide sequence SEQ ID NO. 3, the fusion protein is endowed with more functions while maintaining a high expression level. This allows the fusion protein to be applied in cosmetics and medical devices such as artificial blood vessels. The elastin of this invention exhibits good biocompatibility and natural antiseptic properties.

[0008] Secondly, the present invention provides the encoding gene of the above-mentioned fusion protein.

[0009] Preferably, the nucleotide sequence of the fusion protein is shown in SEQ ID NO.2.

[0010] Thirdly, the present invention provides a recombinant vector comprising the aforementioned coding gene.

[0011] Preferably, the vector is the pPIC9K plasmid.

[0012] Fourthly, the present invention provides a genetically engineered bacterium containing the above-described coding gene or the above-described recombinant vector.

[0013] Preferably, the genetically engineered strain is Pichia pastoris GS115.

[0014] Fifthly, the present invention provides a method for preparing the above-mentioned fusion protein, comprising the following steps: linking the bovine lactoferrin N-leaf peptide gene Lfcin, the bovine lactoferrin peptide gene LFcinB, and the elastin peptide gene ElT into the pPIC9K plasmid to obtain the recombinant plasmid pPIC9K-Lfcin-LfcinB-ElT, and then electroporating the recombinant plasmid pPIC9K-Lfcin-LfcinB-ElT into Pichia pastoris GS115 for fermentation expression.

[0015] Sixthly, based on the above, the present invention provides the application of the above-mentioned fusion protein in skin care products.

[0016] Seventhly, based on the above, the present invention provides the application of the above-mentioned fusion protein in the preparation of artificial blood vessels.

[0017] Compared with the prior art, the present invention has the following technical effects: During the expression of exogenous proteins, *E. coli* readily forms inactive inclusion bodies, posing a risk of plasmid shedding during long-term passage. Furthermore, *E. coli* has a simple structure and lacks post-translational modification capabilities, making it unsuitable for expressing proteins requiring complex modifications, such as fusion proteins. Based on elastin with an amino acid sequence like SEQ ID NO. 8, this invention achieves high-yield expression of elastin using *Pichia pastoris* GS115.

[0018] The elastin of this invention is fused with bovine lactoferrin peptide, which has natural antibacterial function. By fusing bovine lactoferrin N-leaf peptide and bovine lactoferrin peptide with elastin peptide with an amino acid sequence as shown in SEQ ID NO.8, the fusion protein is endowed with more functions while ensuring a high expression level. This allows the fusion protein to be applied in cosmetics, medical devices such as artificial blood vessels, etc. The elastin of this invention has good biocompatibility and natural antiseptic function. Attached Figure Description

[0019] Figure 1 The image shows the recombinant plasmid pPIC9K-Lfcin-LfcinB-ElT, which encodes the recombinant elastin peptide fusion protein of this invention. Figure 2 This is an agarose gel image of a positive transformant of Escherichia coli DH5α transformed by the recombinant plasmid pPIC9K-Lfcin-LfcinB in Example 1 of this invention. Figure 3 This is an agarose gel image of a positive transformant of Escherichia coli DH5α transformed by the recombinant plasmid pPIC9K-Lfcin-LfcinB-ElT in Example 2 of this invention. Figure 4 This is an agarose gel image of a positive transformant of Pichia pastoris GS115 transformed with the recombinant plasmid pPIC9K-Lfcin-LfcinB-ElT in Example 3 of the present invention. Figure 5 This is an SDS-PAGE analysis diagram of the expression of elastin peptide fusion protein in an embodiment of the present invention. Channels 1, 2, and 3 refer to the parallel groups in the three shake flasks, and the control is the Pichia pastoris GS115 strain containing an empty plasmid. Detailed Implementation

[0020] The present invention will be further described below with reference to embodiments. Those skilled in the art will be able to implement the present invention based on these descriptions. Furthermore, the embodiments of the present invention described below are generally only some, not all, of the embodiments of the present invention. Therefore, all other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort should fall within the scope of protection of the present invention.

[0021] In this embodiment of the invention, the Pichia pastoris GS115 strain and the expression vector pPIC9K were both purchased from Invitrogen, USA.

[0022] In this embodiment of the invention, the nucleotide sequences of the bovine lactoferrin N-leaf peptide gene (Lfcin gene), the bovine lactoferrin peptide gene (LFcinB gene), and the elastin peptide gene (ElT gene) are shown in SEQ ID NO.3, SEQ ID NO.4, and SEQ ID NO.5, respectively; the amino acid sequences of the bovine lactoferrin N-leaf peptide, the bovine lactoferrin peptide, and the elastin peptide are shown in SEQ ID NO.6, SEQ ID NO.7, and SEQ ID NO.8, respectively. The amino acid sequence of the fusion protein is shown in SEQ ID NO.1, and the nucleotide sequence of the fusion protein is shown in SEQ ID NO.2.

[0023] In this embodiment of the invention, the culture medium formulations used are as follows: LB medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride (solid medium containing 2% agar); YPD medium: 10 g / L yeast extract, 20 g / L glucose, 20 g / L peptone (solid medium containing 2% agar); MD medium: 20 g / L glucose, 10 g / L ammonium sulfate, 3.4 g / L amino-free yeast nitrogen source (solid medium containing 2% agar); BMG medium: 3 g / L dipotassium hydrogen phosphate, 11.8 g / L potassium dihydrogen phosphate, 3.4 g / L amino-free yeast nitrogen source, 10 g / L ammonium sulfate, 10 g / L glycerol, autoclaved at 115°C for 30 min, and after cooling, 2 ml of biotin is added in a clean bench; BMM medium: 3 g / L dipotassium hydrogen phosphate, 11.8 g / L potassium dihydrogen phosphate, 3.4 g / L amino-free yeast nitrogen source, 10 g / L ammonium sulfate, 10 g / L glycerol ... Ingredients: 10 g / L glycerol, 10 g / L, autoclaved at 115℃ for 30 min, and after cooling, 2 mL biotin and 1% methanol were added to the clean bench.

[0024] In this embodiment of the invention, the sequence information of the primers used is shown in Table 1.

[0025] Table 1 Primer Information Primer name Primer sequence Lfcin-F CACCATCATCACCACCATTAATACGT Lfcin-R GCGGCTTTTGTTTTTGCCA LfcinB-F TTTAAATGCCGCCGCTGG LfcinB-R AAACGCGCGGCGCAC LF-F CACCATCATCACCACCATTAATACGT LF-R AAACGCGCGGCGCAC ElT-F ATGGCGGGCCTGACCG ElT-R CGGCAGGCCATAGCCGC α-F TACTATTGCCAGCATTGCTGCT 3AOX GCAAATGGCATTCTGACATCC Example 1: Construction of pPIC9K-Lfcin-LfcinB cloning vector This embodiment constructs a cloning vector for a recombinant elastin peptide fusion expression gene. The full-length recombinant elastin peptide fusion expression gene consists of 294 amino acids, and the encoding gene sequence of this recombinant elastin peptide fusion protein is shown in SEQ ID NO. 5. The construction method of the recombinant elastin peptide fusion expression gene cloning vector is carried out according to the following steps: 1. The gene sequences of bovine lactoferrin N-leaf peptide (Lfcin), elastin peptide (ElT), and bovine lactoferrin peptide (LfcinB) were ligated into the multiple cloning site of the pPIC9K plasmid using EcoRI and Not I double digestion methods, respectively, to obtain recombinant plasmids pPIC9K-Lfcin, pPIC9K-ElT, and pPIC9K-LfcinB. Gene synthesis was performed by Nanjing Genscript Biotech Co., Ltd.

[0026] 2. PCR amplification of pPIC9K-Lfcin was performed using Lfcin-F and Lfcin-R primers. The amplified PCR product was digested with DpnI enzyme to remove the original template interference. The digested PCR product was then purified using a purification kit (purchased from Shanghai Sangon Biotech Co., Ltd.; specific operation was performed according to the kit instructions). PCR amplification of pPIC9K-LfcinB was performed using LfcinB-F and LfcinB-R primers. The amplified PCR product was digested with DpnI enzyme to remove the original template interference. The digested PCR product was then purified using a purification kit (purchased from Shanghai Sangon Biotech Co., Ltd.; specific operation was performed according to the kit instructions). The purified product was ligated into a circular compound using a one-step cloning kit (purchased from Nanjing Novizan Biotechnology Co., Ltd.; specific operation was performed according to the kit instructions) to obtain the recombinant product pPIC9K-Lfcin-LfcinB, which was stored at -20℃ for later use.

[0027] The PCR amplification system is shown in Table 2 below.

[0028] Table 2 PCR amplification system reagents Usage Primer F 1 μL Primer R 1 μL Template DNA 1 μL High-fidelity enzymes 25 μL <![CDATA[dd H2O]]> Add to 50 μL The PCR product digestion system is shown in Table 3 below.

[0029] Table 3 Digestive System reagents Usage PCR stock solution 50μL DpnⅠ 1μL The reaction system for the recombination reaction is shown in Table 4 below.

[0030] Table 4 Reaction system for recombination reaction reagents Usage Recombinase 1μL Buffer 2μL pPIC9K-Lfcin purified product 1.71μL Purified product of LfcinB gene fragment 1.2μL sterile water 14.09μL 3. The recombinant product pPIC9K-Lfcin-LfcinB was transformed into E. coli DH5α competent cells. Positive transformants were picked and verified. The agarose gel verification image is shown below. Figure 2 Store the correctly transformed strains at -80°C.

[0031] Example 2: Construction of pPIC9K-Lfcin-LfcinB-ElT cloning vector This embodiment constructs the recombinant elastin peptide fusion expression gene cloning vector pPIC9K-Lfcin-LfcinB-ElT. The plasmid map of pPIC9K-Lfcin-LfcinB-ElT can be found in [link to plasmid map]. Figure 1 Follow these steps: 1. Cloned using primers LF-F and LF-R.

[0032] The ElT gene fragment was cloned using ElT-F and ElT-R.

[0033] PCR amplification of pPIC9K-Lfcin-LfcinB was performed using primers LF-F and LF-R. The PCR product was purified to obtain the pPIC9K-Lfcin-LfcinB gene fragment. PCR amplification of pPIC9K-ElT was performed using primers ElT-F and ElT-R. The PCR product was purified to obtain the ElT gene fragment. The pPIC9K-Lfcin-LfcinB and ElT gene fragments were ligated into a circular compound using a one-step cloning kit to obtain the recombinant product pPIC9K-Lfcin-LfcinB-ElT, which was stored at -20℃ for later use. The plasmid map of pPIC9K-Lfcin-LfcinB-ElT is shown below. Figure 1 .

[0034] The reaction system for the recombination reaction is shown in Table 5 below.

[0035] Table 5 Reaction system for recombination reaction reagents Usage Recombinase 1μL Buffer 2μL pPIC9K-Lfcin-LfcinB gene fragment 1.53μL ElT gene fragment 1.1μL sterile water 14.37μL 2. The recombinant product pPIC9K-Lfcin-LfcinB-ElT was transformed into E. coli DH5α competent cells. Positive transformants were picked and verified. The agarose gel verification image is shown below. Figure 3 Store the correctly transformed strains at -80°C.

[0036] Example 3: Construction of recombinant Pichia pastoris engineered strain GS115-Lfcin-LfcinB-ElT In this embodiment, the recombinant Pichia pastoris engineered strain GS115-Lfcin-LfcinB-ElT was constructed according to the following steps: 1. The expression vector pPIC9K-Lfcin-LfcinB-ElT was linearized by digesting it with the restriction endonuclease SacⅠ at 37℃ for 30 min. The reaction system is shown in Table 6 below. Then, 1% agarose gel electrophoresis was used to check whether the digestion was complete. After complete digestion, the next step of the experiment was performed.

[0037] Table 6 Reaction System reagents Usage plasmid pPIC9K-Lfcin-LfcinB-ElT 1μg 10×buffer 2μL SacⅠ 1μL Sterilized water Add to 20 μL 2. The linearized plasmid pPIC9K-Lfcin-LfcinB-ElT was electroporated into Pichia pastoris GS115 competent cells. Positive transformants were picked and verified, and the results were confirmed by gel electrophoresis. Figure 4 As shown, the band around 792 bp represents the target gene, and the corresponding bacterial strain is a positive transformant. The correctly transformed strain was stored at -80℃ and designated as the engineered Pichia pastoris strain GS115-Lfcin-LfcinB-ElT.

[0038] The method for selecting positive transformants for verification is as follows: PCR verification is performed using α-F, 3AOX primers as amplification primers. The PCR conditions are: 98℃ pre-denaturation for 5 min, one thermal cycle; 98℃ thermal denaturation for 10 s, 55℃ annealing for 15 s, 30 thermal cycles; 72℃ final extension for 5 min.

[0039] Example 4 Fermentation Culture This embodiment describes the fermentation culture of engineered Pichia pastoris strain GS115-Lfcin-LfcinB-ElT, following the steps below: The correctly transformed strain obtained in Example 3, stored at -80℃, was inoculated into BMG medium at a 5% inoculum (volume ratio) and cultured at 30℃ and 200 rpm for 14 hours until OD. 600 It is 3.6.

[0040] Centrifuge at 4500 rpm for 5 min at room temperature, collect the bacterial cells, resuspend the cells in BMM medium, and adjust to OD. 600 The concentration was 1.0, transferred to BMM medium, sealed with gauze, and incubated at 30°C and 220 rpm for three days. During the incubation period, 100% methanol was added to the BMM medium every 24 hours until the final concentration reached 1%.

[0041] After three days of shaking culture, 1 mL of bacterial culture sample was taken and centrifuged at 12,000 rpm for 2 min at room temperature. The supernatant was collected for SDS-PAGE electrophoresis detection (three parallel experiments). The SDS-PAGE results of the fermentation broth supernatant are shown below. Figure 5 As shown, the band around 25.15 kDa represents the recombinant elastin peptide fusion protein. (The text abruptly ends here.) Figure 5 It can be seen that the fermentation was in line with the expected size, and the recombinant elastin peptide fusion protein was successfully fermented.

[0042] After three days of shaking culture, the fermentation broth was used to quantitatively determine the expression level of the fusion protein using a BCA kit (purchased from Shanghai Sangon Biotech Co., Ltd.). The specific operation steps were followed according to the BCA kit instructions. The expression level of the recombinant Pichia pastoris GS115-Lfcin-LfcinB-ElT fusion protein was found to be 0.9 g / L.

[0043] Therefore, the recombinant Pichia pastoris GS115-Lfcin-LfcinB-ElT elastin peptide fusion protein of this invention exhibits a high expression level. Furthermore, the preparation process of this elastin peptide fusion protein is completed solely through bacterial fermentation, resulting in no harmful waste liquid production. Moreover, this invention achieves a high expression level using Pichia pastoris GS115, significantly reducing the cost of obtaining elastin. Additionally, this elastin peptide fusion protein incorporates bovine lactoferrin peptide with natural antibacterial functions, ensuring a high expression level while endowing the fusion protein with additional functions. This allows the fusion protein to be applied in cosmetics, medical devices such as artificial blood vessels, and other fields without the need for additional preservatives, ensuring both product functionality and high safety, and demonstrating broad application prospects.

[0044] Unless otherwise specified, the raw materials and equipment used in this invention are all commonly used in the field; unless otherwise specified, the methods used in this invention are all conventional methods in the field.

[0045] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Any simple modifications, alterations, and equivalent transformations made to the above embodiments based on the technical essence of the present invention shall still fall within the protection scope of the present invention.

Claims

1. An elastin peptide fusion protein, characterized in that: The fusion protein includes bovine lactoferrin N-leaf peptide, bovine lactoferrin peptide, and elastin peptide, and the amino acid sequence of the fusion protein is shown in SEQ ID NO.

1.

2. The gene encoding the fusion protein as described in claim 1.

3. The encoding gene as described in claim 2, characterized in that: The nucleotide sequence is shown in SEQ ID NO.

2.

4. A recombinant vector, characterized in that: It includes the coding gene as described in claim 2 or 3.

5. The recombinant vector as described in claim 4, characterized in that: The vector is the pPIC9K plasmid.

6. A genetically engineered bacterium, characterized in that: It contains the coding gene as described in claim 2 or the recombinant vector as described in claim 4.

7. The genetically engineered bacteria as described in claim 6, characterized in that: The genetically engineered bacteria is Pichia pastoris GS115.

8. The method for preparing the fusion protein as described in claim 1, characterized in that: Includes the following steps: The bovine lactoferrin N-leaf peptide gene, bovine lactoferrin peptide gene, and elastin peptide gene were ligated into the pPIC9K plasmid to obtain the recombinant plasmid pPIC9K-Lfcin-LfcinB-ElT. Then, the recombinant plasmid pPIC9K-Lfcin-LfcinB-ElT was electroporated into Pichia pastoris GS115 for fermentation expression.

9. The application of the fusion protein as described in claim 1 in skin care products.

10. The application of the fusion protein as described in claim 1 in the preparation of artificial blood vessels.

Images