Application of TGF-beta in promoting cell production and / or exosome release

Abstract

The invention provides an application of TGF-beta in promoting cell production and / or exosome release. The tumor cell strain stably expressing TGF-beta is finally obtained by constructing a lentiviral vector overexpressing the TGF-beta gene and transfecting tumor cells with the lentiviral vector. According to the cell strain provided by the embodiment of the invention, the yield of the exosome per unit cell and per unit culture medium volume is obviously improved, the yield of the exosome is obviously improved, the overexpressed exosome can be efficiently taken by tumor cells, and the proliferation of the early tumor cells is fully inhibited.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular, relates to the use of TGF-β in promoting cells to produce and / or release exosomes. Background Art

[0002] Exosomes are a type of extracellular vesicles released by cells, with a diameter ranging from about 40 to 160 nm. They are released outside the cell after forming multivesicular bodies through the invagination of the cell membrane. Exosomes contain a variety of cellular components, including DNA, RNA, metabolites, and cytoplasmic and cell surface proteins. Exosomes play an important role in intercellular signaling. They can deliver biological molecules such as proteins, metabolites, and nucleic acids to target cells, thereby affecting the biological responses of these cells. This mechanism may play a role in regulating cell survival, apoptosis, and immune responses. Exosomes may help remove excess or unnecessary components in cells, thereby maintaining the stability of the cell's internal environment. Exosomes are associated with a variety of physiological and pathological processes, especially cancer progression.

[0003] Exosomes have the advantages of low immunogenicity, good stability and targeting ability, making them an ideal drug delivery system. In particular, the use of engineered exosomes can achieve more efficient and safer drug delivery through modification, loading chemotherapy drugs, non-coding RNA (ncRNA), protein drugs, small molecule drugs, etc., to achieve more precise tumor targeting and stronger therapeutic effects. The use of engineered exosomes to overexpress related tumor-associated antigens can regulate the development, maturation and anti-tumor ability of immune cells.

[0004] TGF-β, or transforming growth factor-β, is a cytokine that regulates cell growth and differentiation and belongs to the TGF-β superfamily. TGF-β is a dimer consisting of two subunits with the same or similar structure and a molecular weight of 12.5 kDa connected by a disulfide bond. In mammals, there are at least four subtypes: TGF-β1, TGF-β2, TGF-β3, and TGF-β1β2.

[0005] TGF-β in the tumor microenvironment can affect tumor development through both tumor cells and immune cells. In the early stages of tumor cell development, TGF-β can inhibit tumor cell division and proliferation by inducing the expression of p15, p21, and p27, preventing tumor cells from transitioning from the G1 phase to the S phase in the division cycle, and downregulating the expression of c-Myc. In addition, TGF-β can not only inhibit tumor cell proliferation, but also promote tumor cell apoptosis by acting on apoptosis-related effector molecules. Using TGF-β in the early stages of tumor treatment may be used as a tumor treatment strategy. Because exosomes have low immunogenicity, good stability, and good engineering. Overexpression of TGF-β on exosomes can produce a better therapeutic effect on tumor immunotherapy, and show broad potential in tumor treatment applications, which is of great significance for actual production. Summary of the invention

[0006] The present invention aims to solve at least one of the technical problems existing in the prior art to at least a certain extent. To this end, the present invention provides the use of TGF-β in promoting cells to produce and / or release exosomes.

[0007] The present invention is accomplished based on the following findings of the inventors:

[0008] Currently, the number of exosomes produced and / or released in tumor cells is relatively small. The present application has found that by constructing a lentiviral vector that overexpresses the TGF-β gene and transfecting it into tumor cells, a tumor cell line that stably expresses TGF-β can be obtained. After experimental verification, it was surprisingly found that the expression level and growth rate of exosomes in tumor cells can be increased, and the effectiveness of tumor treatment and immune regulation can be further effectively improved.

[0009] In the first aspect of the present invention, the present invention proposes the use of TGF-β in promoting cells to produce and / or release exosomes. According to an embodiment of the present invention, stable expression of TGF-β in cells can increase the growth rate of exosomes, increase the exosome yield per unit cell and per unit culture medium volume, thereby increasing the production of exosomes and enhancing their ability to inhibit tumor proliferation.

[0010] In the second aspect of the present invention, the present invention proposes the use of a reagent in the preparation of a kit. According to the use of an embodiment of the present invention, the reagent is used to regulate the expression or activity of TGF-β, and the kit is used to regulate the production and / or release of exosomes in cells. As mentioned above, stable expression of TGF-β in cells can increase the growth rate of exosomes, increase the exosome yield per unit cell and per unit culture medium volume, thereby increasing the yield of exosomes. Therefore, the reagent that regulates the expression or activity of TGF-β can further regulate the production and / or release of exosomes in cells.

[0011] In the third aspect of the present invention, the present invention proposes the use of an agent in the preparation of a drug. According to the use of an embodiment of the present invention, the agent is used to promote the expression or activity of TGF-β in tumor cells, and the drug is used to treat or prevent cancer or to increase the immunotherapy effect on tumor cells.

[0012] In a fourth aspect of the present invention, the present invention provides a method for regulating the production and / or release of exosomes by cells. According to an embodiment of the present invention, the method comprises: contacting an agent with the cells to be treated, wherein the agent is used to regulate the expression or activity of TGF-β. According to the method of the embodiment of the present invention, the yield of exosomes produced and / or released by tumor cells can be increased.

[0013] Additional aspects and advantages of the present invention will be given in part in the following description and in part will be obvious from the following description, or will be learned through practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] The above and / or additional aspects and advantages of the present invention will become apparent and easily understood from the description of the embodiments in conjunction with the following drawings, in which:

[0015] Figure 1 It shows a schematic diagram of the structure of the basic carrier LV3 in Example 1 of the present invention;

[0016] Figure 2 The schematic diagram of the structure of the recombinant lentiviral vector in Example 1 of the present invention is shown;

[0017] Figure 3 The light microscopic image (10X) of mouse CT26 colon cancer cells in Example 2 of the present invention is shown;

[0018] Figure 4 The flow fluorescence image of CT26 cells transfected with LV3 lentivirus in Example 2 of the present invention is shown;

[0019] Figure 5 A schematic diagram of the process of extracting exosomes according to Example 3 of the present invention is shown;

[0020] Figure 6 The electron microscope image of TGF-βEVs in Example 3 of the present invention is shown;

[0021] Figure 7 The graph shows the results of particle size analysis of TGF-βEVs in Example 3 of the present invention;

[0022] Figure 8 The result of the test of the number of exosome particles extracted in Example 3 of the present invention is shown, wherein:

[0023] Figure A shows the particle count results of the Control group after 10-fold dilution.

[0024] Figure B shows the particle number results of the TGF-βEVs group at 20-fold dilution;

[0025] Fig. 9 The Western blot result of the expression of TGF-β protein in exosomes in Example 3 of the present invention is shown;

[0026] Fig.10 The fluorescence detection result of mouse colon cancer cells taking up two kinds of exosomes in Example 3 of the present invention is shown;

[0027] Fig.11 The figure shows the result that the two exosomes in Example 3 of the present invention inhibit the proliferation of mouse colon cancer cells. DETAILED DESCRIPTION

[0028] The embodiments of the present invention are described in detail below. The embodiments described below are exemplary and are only used to explain the present invention, and should not be understood as limiting the present invention.

[0029] It should be noted that the terms "first" and "second" are used for descriptive purposes only and should not be understood as indicating or implying relative importance or implicitly indicating the number of the indicated technical features. Therefore, the features defined as "first" and "second" may explicitly or implicitly include one or more of the features. Further, in the description of the present invention, unless otherwise specified, the meaning of "plurality" is two or more.

[0030] In this document, the terms “contain”, “include” or “comprise” are open expressions, that is, they include the contents specified in the present invention but do not exclude other contents.

[0031] As used herein, the terms "optionally", "optional" or "optionally" generally mean that the subsequently described event or circumstance may but need not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.

[0032] The present invention proposes the use of TGF-β in promoting cells to produce and / or release exosomes, the use of the reagent in preparing a kit, the use of the reagent in preparing a drug, and a method for regulating cells to produce and / or release exosomes, which will be described in detail below.

[0033] Use of TGF-β in promoting cell production and / or release of exosomes

[0034] In the first aspect of the present invention, the present invention proposes the use of TGF-β in promoting cells to produce and / or release exosomes. According to an embodiment of the present invention, stably expressing TGF-β in cells can increase the exosome yield per unit cell and per unit culture medium volume, and increase the production of exosomes.

[0035] According to an embodiment of the present invention, the nucleotide sequence of TGF-β is as shown in SEQ ID NO: 1 or a nucleotide sequence obtained by deleting, replacing, inserting, inverting and misplacing one or more bases in the sequence shown in SEQ ID NO: 1.

[0036]

[0037] It should be noted that the "nucleic acid" described in the present application can be any polymer containing deoxyribonucleotides or ribonucleotides, including but not limited to modified or unmodified DNA and RNA, and its length is not subject to any special restrictions. For constructs used to construct recombinant cells, it is preferred that the nucleic acid is DNA, because DNA is more stable and easy to operate compared to RNA. The "nucleic acid" described in the present application actually includes any one or two of the complementary double strands. For convenience, in this specification and claims, although only one strand is given in most cases, the other strand complementary to it is actually disclosed. For example, when mentioning SEQ ID NO: 1, its complementary sequence is actually included. Those skilled in the art can also understand that one strand can be used to detect another strand, and vice versa.

[0038] "Construct" as described in the present application refers to a genetic vector that includes a specific nucleic acid sequence and can transfer the target nucleic acid sequence into a host cell to obtain a recombinant cell. The form of the construct is not particularly limited. According to an embodiment of the present invention, it can be at least one of a plasmid, a phage, an artificial chromosome, a cosmid, a virus, and a viral vector, preferably a virus or a viral vector, and those skilled in the art can select as needed.

[0039] According to an embodiment of the present invention, the cell is a tumor cell.

[0040] According to an embodiment of the present invention, the tumor cells include at least one of colon cancer cells, breast cancer cells, melanoma cells, liver cancer cells, prostate cancer cells, and bladder cancer cells.

[0041] According to an embodiment of the present invention, the breast cancer cells include luminal B breast cancer cells.

[0042] According to some specific embodiments of the present invention, the tumor cells are colon cancer cells.

[0043] Use of reagents in preparing kits

[0044] In the second aspect of the present invention, the present invention proposes the use of an agent in the preparation of a kit. According to an embodiment of the present invention, the agent is used to regulate the expression or activity of TGF-β, and the kit is used to regulate the production and / or release of exosomes in cells. As mentioned above, stable expression of TGF-β in cells can increase the growth rate of exosomes, increase the exosome yield per unit cell and per unit culture medium volume, and increase the yield of exosomes. Therefore, agents that regulate the expression or activity of TGF-β can further regulate the production and / or release of exosomes in cells.

[0045] According to an embodiment of the present invention, the agent is used to promote the expression or activity of TGF-β, and the kit is used to promote the production and / or release of exosomes in cells.

[0046] According to an embodiment of the present invention, the agent includes at least one of a viral vector and a virus for overexpressing TGF-β.

[0047] According to an embodiment of the present invention, the virus includes at least one of a lentivirus and an adenovirus.

[0048] According to an embodiment of the present invention, the viral vector includes retrovirus, lentivirus, adenovirus and other enveloped virus vectors.

[0049] According to an embodiment of the present invention, the viral vector is a lentiviral vector.

[0050] According to an embodiment of the present invention, the agent is used to inhibit the expression or activity of TGF-β, and the kit is used to inhibit the production and / or release of exosomes in cells.

[0051] According to an embodiment of the present invention, the agent includes siRNA for inhibiting TGF-β expression.

[0052] According to an embodiment of the present invention, the nucleotide sequence of the target site directed by the siRNA is shown in SEQ ID NO:2.

[0053] ctgcaagactatcgacatggagc (SEQ ID NO: 2).

[0054] Use of reagents in the preparation of drugs

[0055] In the third aspect of the present invention, the present invention proposes the use of an agent in the preparation of a drug. According to an embodiment of the present invention, the agent is used to promote the expression or activity of TGF-β in tumor cells, and the drug is used to treat or prevent cancer or to increase the immune killing effect on tumor cells.

[0056] According to an embodiment of the present invention, the agent includes at least one of a viral vector and a virus for overexpressing TGF-β.

[0057] Methods for regulating cell production and / or release of exosomes

[0058] In a fourth aspect of the present invention, the present invention provides a method for regulating the production and / or release of exosomes by cells. According to an embodiment of the present invention, the method comprises: contacting an agent with the cells to be treated, wherein the agent is used to regulate the expression or activity of TGF-β. According to the method of the embodiment of the present invention, the yield of exosomes produced and / or released by cells can be increased.

[0059] According to an embodiment of the present invention, the cell is a tumor cell.

[0060] According to an embodiment of the present invention, the tumor cells include at least one of colon cancer cells, breast cancer cells, melanoma cells, liver cancer cells, prostate cancer cells and bladder cancer cells.

[0061] According to an embodiment of the present invention, the breast cancer cells include luminal B breast cancer cells.

[0062] According to some specific embodiments of the present invention, the tumor cells are colon cancer cells.

[0063] According to an embodiment of the present invention, the agent is used to promote the expression or activity of TGF-β, and the agent includes at least one of a viral vector and a virus for overexpressing TGF-β.

[0064] According to an embodiment of the present invention, the agent is used to inhibit the expression or activity of TGF-β, and the agent includes siRNA for inhibiting the expression of TGF-β.

[0065] According to an embodiment of the present invention, the nucleotide sequence of the target site directed by the siRNA is shown in SEQ ID NO:2.

[0066] According to an embodiment of the present invention, the culture medium used for culturing the cells is serum-free DMEM culture medium.

[0067] According to an embodiment of the present invention, the method for producing and / or releasing exosomes is as follows: selecting mouse colon cancer cells transfected with a recombinant lentiviral vector in the P3 generation logarithmic growth phase, and continuing to culture with serum-free DMEM medium until the cell confluence is 70% to 80%, ultracentrifuging to obtain tumor cell exosomes.

[0068] Herein, the "cell confluence" refers to the percentage of the surface area covered by the cell layer in the culture container during the cell culture process.

[0069] The present invention exemplarily uses the LV3 vector as the basic vector to construct a lentiviral vector that overexpresses the TGF-β gene, which is transfected into tumor cells to obtain a stably expressed TGF-β cell line. After exosome extraction and detection, the cell line significantly increased the growth rate of exosomes, as well as the exosome yield per unit cell and per unit culture medium volume, and the exosome yield was improved. In addition, the present invention purifies and separates exosomes through the GFP tag carried by the lentivirus, which solves the defects of traditional methods to a certain extent and promotes the scientific research and clinical level of tumor cell exosomes.

[0070] Tumor cells

[0071] In a fifth aspect of the present invention, the present invention provides a tumor cell. According to an embodiment of the present invention, TGF-β is overexpressed in the tumor cell. According to the tumor cell of the embodiment of the present invention, the production of exosomes can be increased.

[0072] Overexpression of TGF-β may activate the intracellular SWAD pathway, and the activation of the signal pathway further promotes the secretion of exosomes; in addition, it may also change the metabolic state of the cells, which may involve the synthesis and transport of related biological molecules, thereby increasing the secretion of exosomes.

[0073] According to an embodiment of the present invention, the tumor cell is selected from at least one of colon cancer cells, breast cancer cells, melanoma cells, liver cancer cells, prostate cancer cells and bladder cancer cells.

[0074] According to an embodiment of the present invention, the tumor cell is at least one of a colon cancer cell, a breast cancer cell, and a melanoma cell.

[0075] According to an embodiment of the present invention, the breast cancer cells include luminal B breast cancer cells.

[0076] According to an embodiment of the present invention, the tumor cells are colon cancer cells.

[0077] According to an embodiment of the present invention, the colon cancer cells overexpressing TGF-β are prepared by the following method: constructing a recombinant lentivirus overexpressing TGF-β and mouse colon cancer cells.

[0078] Specifically, the tumor cells overexpressing the TGF-β gene of the present invention are prepared by the following method:

[0079] Using the pLV3 vector as the basic vector, a recombinant plasmid pLV3-TGF-β that overexpressed the TGF-β gene was constructed. The recombinant lentivirus was packaged into the 293T cell line and named LV3-TGF-β. The recombinant lentivirus LV3-TGF-β was transfected into tumor cells to obtain a tumor cell line that stably expressed TGF-β.

[0080] The present invention also provides a method for preparing the above-mentioned tumor cells overexpressing the TGF-β gene, which is prepared by the following method:

[0081] Using the pLV3 vector as the basic vector, a recombinant plasmid pLV3-TGF-β that overexpressed the TGF-β gene was constructed. The recombinant lentivirus was packaged by transfecting the 293T cell line and named LV3-TGF-β. The recombinant lentivirus LV3-TGF-β was transfected into tumor cells to obtain a cell line that stably expressed TGF-β.

[0082] According to an embodiment of the present invention, the TGF-β gene is the nucleotide sequence shown in SEQ ID NO: 1, or a nucleotide sequence obtained by deleting, replacing, inserting, inverting and ectopic one or more bases of the sequence shown in SEQ ID NO: 1.

[0083] According to an embodiment of the present invention, the lentivirus is LV3.

[0084] In the present invention, the recombinant lentivirus overexpressing the TGF-β gene is constructed, named pLV3-TGF-β, and is transfected into tumor cells to screen and obtain tumor cell lines that highly express TGF-β.

[0085] The present invention uses pLV3 vector as the basic vector, constructs a recombinant plasmid of overexpressed TGF-β gene, pLV3-TGF-β, transfects 293T cell line to package to obtain recombinant lentivirus, named LV3-TGF-β, and transfects the recombinant lentivirus LV3-TGF-β into tumor cells to obtain a stable expression TGF-β cell line. The cell line is tested to significantly increase the exosome yield per unit cell and per unit culture medium volume, and the exosome yield is significantly increased.

[0086] According to an embodiment of the present invention, the TGF-β overexpression is achieved by at least one of the following methods: viral / non-viral vector-mediated gene / mRNA transfection technology, transposase or recombinase-mediated gene integration, and gene editing or transcriptional activation based on the CRISPR / CAS system.

[0087] According to an embodiment of the present invention, the gene / mRNA transfection technology is not particularly limited and is achieved by utilizing at least one of the following methods: liposome or LNP-mediated transfection, calcium phosphate-mediated transfection, cationic transfection agent-mediated transfection, virus-like particle VLP-mediated transfection, electroporation transfection, lentiviral vector for gene delivery, adeno-associated virus vector for gene delivery, adenoviral vector for gene delivery, and Sendai virus vector for gene delivery.

[0088] The scheme of the present invention will be explained below in conjunction with the embodiments. It will be appreciated by those skilled in the art that the following embodiments are only used to illustrate the present invention and should not be considered as limiting the scope of the present invention. Where specific techniques or conditions are not indicated in the embodiments, the techniques or conditions described in the literature in this area or the product specifications are used. The reagents or instruments used are not indicated by the manufacturer and are all conventional products that can be obtained commercially.

[0089] Example 1: Construction of TGF-β lentivirus

[0090] The TGF-β gene shown in SEQ ID NO: 1 was cloned and expressed as Figure 1The pLV3 shown in the figure was used as the basic vector to construct the recombinant vector pLV3-TGF-β containing the TGF-β gene, and the recombinant vector pLV3-TGF-β was packaged by transfecting the 293T cell line to generate the Figure 2 LV3-TGF-β lentivirus as indicated.

[0091] Example 2: Preparation of tumor cells stably expressing TGF-β

[0092] The lentivirus LV3-TGF-β constructed in Example 1 was transfected into mouse CT26 colon cancer cells (Biyuntian Biotechnology Co., Ltd., catalog number: C7399) (the virus infection multiplicity MOI value was 20-100) to obtain tumor cells overexpressing the TGF-β gene, which were cultured in 1640 medium, the growth of tumor cells was observed, and the expression of TGF-β was detected by flow cytometry. The detection method is a routine operation in the art and will not be described here. The results are as follows Figure 3 and Figure 4 As shown, it is shown that the cell viability cultured in the present invention is higher than 90%, and the normal expression of TGF-β fluorescence is detected by flow cytometry.

[0093] Example 3: Extraction and identification of exosomes from tumor cells

[0094] 3.1 Extraction of exosomes from tumor cells:

[0095] Tumor cells in the logarithmic growth phase of the P3 generation (Control group) and tumor cells overexpressing TGF-β constructed in Example 2 (TGF-βEVs group) were selected for culture and exosome extraction.

[0096] The specific method is as follows: Use DMEM complete medium to culture cells. When the cell confluence reaches 70% to 80%, wash the cells with PBS to remove exosomes in the serum. Use serum-free DMEM complete medium for 48 hours, and then separate and extract exosomes by ultracentrifugation. Take 100mL of cell culture supernatant and centrifuge at 300g for 10 minutes to remove cells, centrifuge at 2000g for 10 minutes to remove cell debris, and then centrifuge at 10000g for 30 minutes to remove apoptotic bodies. Finally, centrifuge at 100000g for 70 minutes to discard the supernatant, collect the crude exosome precipitate and resuspend it with 1mL PBS, then centrifuge at 100000g for 70 minutes to discard the supernatant, and finally resuspend it with 200μL sterile PBS to obtain exosomes, divide it into portions and store it at -80℃. The flow chart is as follows Figure 5 shown.

[0097] 3.2 Electron microscopy detection of tumor cell-derived exosomes

[0098] The P3 generation logarithmic growth phase tumor cells (Control group / control group) and the TGF-β-overexpressing tumor cells constructed in Example 2 (TGF-βEVs group) were cultured and exosomes were extracted. The extracted exosomes were resuspended in 20-30 μL PBS, 10 μm was aspirated and dropped on the transmission electron microscope copper grid to precipitate for 5 minutes, the supernatant was aspirated with filter paper, 10 μm of phosphotungstic acid counterstaining solution was aspirated and dropped on the transmission electron microscope copper grid to precipitate for 5 minutes, the supernatant was aspirated with filter paper, and the supernatant was dried at room temperature and observed on the machine.

[0099] Figure 6 In the figure, Figure A is the electron microscopic image of exosomes extracted from tumor cells in the control group, and Figure B is the electron microscopic image of exosomes extracted from tumor cells in the TGF-βEVs group, showing that the size of the exosomes in the electron microscopic image is about 50-150nm, and the exosomes appear saucer-like, indicating that there is no significant difference between the overexpressed TGF-β exosomes and the exosomes extracted from tumor cells in the control group, which is consistent with the structure of exosomes.

[0100] 3.3 Analysis of the particle size of tumor cell-derived exosomes

[0101] The tumor cells overexpressing TGF-β constructed in Example 2 (TGF-βEVs group) were cultured and exosomes were extracted. The extracted exosomes were resuspended in 2 mL of PBS and placed in Nano ZS90 Plus (Malvern, UK) for exosome size analysis. The results are shown in Figure 2. Figure 7 As shown, the particle size of exosomes detected is between 100 and 200 nm, which corresponds to the size of exosomes detected by TEM and is consistent with the particle size range of exosomes.

[0102] 3.4 Detection of exosome particle number from tumor cells

[0103] Tumor cells in the logarithmic growth phase of P3 (Control group) and tumor cells overexpressing TGF-β constructed in Example 2 (TGF-βEVs group) were cultured and exosomes were extracted. The extracted exosomes were resuspended in 2 mL of PBS, and the exosomes of the Control and TGF-βEVs groups were diluted 10 times and 20 times, respectively, for nanoflow cytometry testing. This detection is a routine operation in the field and will not be described here. The results are shown in Figure 8 As shown, the number of particles of exosomes extracted from tumor cells in the Control group was 5.55+11Particles / mL when diluted 10 times; the number of particles of exosomes extracted from tumor cells in the TGF-βEVs group could reach 4.73+11Particles / mL when diluted 20 times. The results showed that the number of exosome particles extracted from tumor cells in the TGF-βEVs group was significantly higher than that in the Control group.

[0104] 3.5 Western blot detection of tumor cell-derived exosomes

[0105] Tumor cells in the logarithmic growth phase of the P3 generation (Control group) and tumor cells overexpressing TGF-β constructed in Example 2 (TGF-βEVs group) were cultured and exosomes were extracted. Protein lysis solution (purchased from Bio-Technology Co., Ltd.) was added to the extracted exosome precipitate, and placed on ice for 10 to 20 minutes, during which time it was shaken 4 to 6 times, each time for 20 to 30 seconds. Subsequently, it was centrifuged at 4°C and 11000 rpm for 3 to 5 minutes, and the supernatant was transferred to a new centrifuge tube for Western blot detection of TGF-β protein expression. The results are shown in Figure 2. Fig. 9 As shown, the expression of TGF-β protein can be detected in exosomes of the TGF-βEVs group extracted by ultracentrifugation.

[0106] 3.6 Cellular exosome uptake experiment

[0107] Tumor cells in the logarithmic growth phase of P3 generation (Control group) and tumor cells overexpressing TGF-β constructed in Example 2 (TGF-βEVs group) were cultured and exosomes were extracted. The exosome fluorescent material Cy5 (Xi'an Qiyue Biological, Q-0345731) was prepared and mixed with the exosomes extracted above, so that the exosomes were connected with the dye, and then the excess dye was washed away. A small amount of exosomes containing Cy5 fluorescent dye was added to the cultured tumor cells, and the culture was continued for 1 to 4 hours. The supernatant was aspirated and washed 2 to 3 times with PBS, and then placed under an inverted fluorescence microscope for detection. The results are as follows: Fig.10 As shown, obvious red fluorescence signals of Cy5 fluorescent dye can be observed in exosomes overexpressing TGF-β compared with the control group.

[0108] 3.7 Effects of exosomes on tumor cell proliferation

[0109] Tumor cells in the logarithmic growth phase of P3 (Control group) and tumor cells overexpressing TGF-β constructed in Example 2 (TGF-βEVs group) were cultured and exosomes were extracted. The exosomes obtained from the Control and TGF-βEVs groups were mixed with mouse colon cancer cell CT26 cells in 1640 culture medium at 37°C and 5% CO. 2 Co-culture was performed under incubator conditions. The proliferation of mouse colon cancer cells at 24, 48, 72, and 96 h of culture was detected by CCK8 (Biyuntian Biotechnology Co., Ltd., C0037). The detection steps were performed according to the instructions of the kit. Fig.11As shown, TGF-βEVs had an inhibitory effect on CT26 cells. After 96 h of co-culture, the survival rate of CT26 cells in the TGF-βEVs group was only about 60%.

[0110] In the description of this specification, the description with reference to the terms "one embodiment", "some embodiments", "example", "specific example", or "some examples" etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described may be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art may combine and combine the different embodiments or examples described in this specification and the features of the different embodiments or examples, without contradiction.

[0111] Although the embodiments of the present invention have been shown and described above, it is to be understood that the above embodiments are exemplary and are not to be construed as limitations of the present invention. A person skilled in the art may change, modify, replace and vary the above embodiments within the scope of the present invention.

Claims

1. Use of TGF-β in promoting cells to produce and / or release exosomes.

2. The use according to claim 1, characterized in that The nucleotide sequence of TGF-β is as shown in SEQ ID NO: 1 or a nucleotide sequence obtained by deleting, replacing, inserting, inverting or ectopically positioning one or more bases in the sequence shown in SEQ ID NO: 1; Preferably, the cells are tumor cells.

3. Use of a reagent in preparing a kit, wherein the reagent is used to regulate the expression or activity of TGF-β, and the kit is used to regulate the production and / or release of exosomes in cells.

4. The use according to claim 3, wherein the reagent is used to promote the expression or activity of TGF-β, and the kit is used to promote the production and / or release of exosomes in cells; Optionally, the agent comprises at least one of a viral vector and a virus for overexpressing TGF-β.

5. The use according to claim 3, wherein the agent is used to inhibit the expression or activity of TGF-β, and the kit is used to inhibit the production and / or release of exosomes in cells; Optionally, the reagent includes siRNA for inhibiting TGF-β expression; Optionally, the nucleotide sequence of the target site directed by the siRNA is as shown in SEQ ID NO:

2.

6. Use of an agent in the preparation of a drug, wherein the agent is used to promote the expression or activity of TGF-β in tumor cells, and the drug is used to treat and / or prevent cancer, or to increase the immune killing effect on tumor cells; Optionally, the agent comprises at least one of a viral vector and a virus for overexpressing TGF-β.

7. A method for regulating cell production and / or release of exosomes, characterized in that: include: contacting the cells to be treated with an agent for regulating the expression or activity of TGF-β; Optionally, the cell is a tumor cell.

8. The method according to claim 7, wherein the agent is used to promote the expression or activity of TGF-β, and the agent comprises at least one of a viral vector and a virus for overexpressing TGF-β.

9. The method according to claim 7, wherein the agent is used to inhibit the expression or activity of TGF-β, and the agent comprises siRNA for inhibiting the expression of TGF-β.

10. The method according to claim 9, characterized in that The nucleotide sequence of the target site targeted by the siRNA is shown in SEQ ID NO:2.

Images