Lactobacillus casei, probiotic preparation for reducing vscs production and use thereof

Abstract

The application discloses a strain of Bifidobacterium breve KC88, which has a preservation number of CGMCC No.32107. The application also discloses a screening process and application of the strain. The Bifidobacterium breve KC88 provided by the application can down-regulate the expression of Cdl gene of Fusobacterium nucleatum and the expression of Mgl gene of Porphyromonas gingivalis. Meanwhile, the Bifidobacterium breve KC88 can inhibit the production of pathogenic bacteria biofilm and reduce the production of volatile sulfide. The surface protein of inactivated Bifidobacterium breve KC88 can inhibit the formation of pathogenic bacteria biofilm. Therefore, the live Bifidobacterium breve KC88 and the heat-inactivated Bifidobacterium breve KC88 have the effects of relieving breath and improving gastrointestinal function, and can be applied in the fields of medicine, health care products and the like.

Description

Technical Field

[0001] This invention belongs to the field of probiotics, specifically relating to Lactobacillus casei, probiotic preparations including Lactobacillus casei, and their applications. Background Technology

[0002] The human oral cavity is a complex micro-ecosystem, containing over 700 species of bacteria. Oral microorganisms maintain their balance through interactions such as symbiosis, competition, and antagonism. The Fourth National Oral Disease Epidemiological Survey Report shows that the prevalence of oral diseases in my country is as high as 96.7%, with approximately 30% of people suffering from varying degrees of halitosis. 65% of people can perceive their own halitosis, while 35% need to be informed by others. Halitosis largely originates from the decomposition of sulfur-containing amino acids (cystine, cysteine, methionine) or serum by oral bacteria, producing volatile sulfur compounds (VSCs) and other metabolic products. Furthermore, the formation of biofilms provides a suitable growth environment for other anaerobic odor-causing bacteria, enhancing their resistance and ultimately leading to halitosis. Microorganisms that cause halitosis exist in gingival crevicular fluid, saliva, dental plaque, and the dorsum of the tongue. Among them, Fusobacterium nucleatum, Porphyromonas gingivalis, and Prevotella intermedia are considered to be the three main odor-causing bacteria in the oral cavity. They can degrade sulfur-containing amino acids to produce unpleasant VSCs, especially hydrogen sulfide (H2S) and methanethiol (CH3SH).

[0003] Currently, clinical methods for preventing and treating halitosis mainly include mechanical, chemical, and probiotic methods. Mechanical methods primarily include brushing teeth, brushing the tongue, scraping the tongue, and using dental floss. Chemical methods mainly use antibacterial agents to inhibit bacteria and prevent oral diseases. Commonly used antibacterial agents include chlorhexidine and metal ions. However, these antibacterial agents not only inhibit pathogenic bacteria but also inhibit beneficial bacteria in the mouth, and long-term use may increase the drug resistance of pathogenic bacteria. Most antibacterial agents easily irritate the oral mucosa, seriously affecting the user experience. Furthermore, many consumers use specially flavored chewing gum, mints, and mouthwash to improve halitosis, but these only provide a temporary fresh breath and are unlikely to truly inhibit pathogenic bacteria. Probiotic methods have a good therapeutic effect on oral diseases, and are characterized by being mild, safe, and less prone to recurrence. Therefore, it is urgent to screen for probiotics that can improve halitosis, especially strains that reduce volatile sulfur compounds (VSCs) in the mouth.

[0004] Chinese Patent Application No. CN110713960A discloses a strain of *Lactobacillus plantarum* LN66 and its application in products reducing halitosis risk. The LN66 strain exhibits good tolerance to lysozyme, adapts to the oral environment, and is not intended to kill *Fusobacterium nucleatum*. The mechanism by which it reduces halitosis primarily involves the LN66 strain downregulating biofilm-related genes of *Fusobacterium nucleatum*, particularly genes encoding outer membrane adhesion proteins, including transport proteins radD, fap2, aim1, and cmpA, as well as the heat-modified protein gene fomA that mediates adhesion and stimulates host immune cells, and the bacterial surface adhesin protein gene fadA. Furthermore, LN66 can reduce the amount of extracellular polymeric substances (extracellular proteins and extracellular polysaccharides) secreted by *Fusobacterium nucleatum* and reduce *Fusobacterium nucleatum* biofilm. However, the *Lactobacillus plantarum* LN66 disclosed in the above application does not reduce the production of volatile substances (hydrogen sulfide and methanethiol) by pathogenic bacteria, nor does it disclose its ability to reduce the amount of VSCs produced by *Fusobacterium nucleatum*.

[0005] Chinese invention application CN118726190A discloses a *Streptococcus salivarius* MY-6 and its applications. The *Streptococcus salivarius* provided by this invention can effectively remove halitosis, eliminate odorous gases (ammonia and volatile sulfur compounds), inhibit the growth of halitosis-producing bacteria *Fusobacterium nucleatum* and *Porphyromonas gingivalis*, and inhibit the growth of biofilms from these odor-producing bacteria. Cell-free extracts of *Streptococcus salivarius* MY-6 can downregulate the expression of genes related to outer membrane adhesion in *Fusobacterium nucleatum*, with significant downregulation of cmpA, aim, and fomA genes, reducing their relative expression levels to approximately 0.2. Furthermore, it can downregulate the expression of genes related to outer membrane adhesion and virulence in *Porphyromonas gingivalis*, with significant downregulation of fimA and hagA genes. However, *Streptococcus salivarius* MY-6 does not reduce the amount of VSCs produced by *Fusobacterium nucleatum*. Summary of the Invention

[0006] The first objective of this invention is to provide a *Lactobacillus casei* KC88 that can reduce the production of VSCs by *Fusobacterium nucleatum*.

[0007] A second objective of this invention is to provide a probiotic preparation comprising the aforementioned Lactobacillus casei KC88.

[0008] A third objective of this invention is to provide a method for preparing the probiotic preparation.

[0009] A fourth object of the present invention is to provide an application of the probiotic preparation.

[0010] This invention is achieved through the following technical solution: A strain of *Lactobacillus casei*, KC88, was deposited on September 29, 2024, at the China General Microbiological Culture Collection Center (CGMCC). The address of the collection center is: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, 100101, China; the accession number is CGMCC No. 32107. The strain was viable at the time of deposit.

[0011] A fermentation product obtained by fermentation of the aforementioned Lactobacillus casei KC88.

[0012] A probiotic preparation comprising the aforementioned Lactobacillus casei KC88 and a fermentation product obtained by fermenting the aforementioned Lactobacillus casei KC88.

[0013] A method for preparing the probiotic preparation includes the following steps: After inoculating the culture medium with the aforementioned Lactobacillus casei KC88, fermentation was carried out to obtain probiotic sludge. The probiotic slurry is mixed with a freeze-drying protectant and then freeze-dried to obtain the final product.

[0014] The culture medium comprises the following components by weight percentage: 1.0-1.5% soybean peptone, 0.5-1.5% yeast extract, 2.0-4.0% glucose, 0.05-0.10% Tween, 0.1-0.2% dipotassium hydrogen phosphate heptahydrate, 0.4-0.6% sodium acetate trihydrate, 0.02-0.04% magnesium sulfate heptahydrate, 0.02-0.04% manganese sulfate monohydrate, 0.05-0.15% L-cysteine, and water as the balance.

[0015] The freeze-drying protectant, by weight percentage, comprises 10-25% trehalose, 1-3% sodium thiosulfate, 1.0-1.5% maltodextrin, 1-2% sorbitol, 5-10% whey protein powder, and the balance being water.

[0016] The fermentation process had a pH of 5.9 and a fermentation time of 12–18 hours. The pH of the freeze-drying protectant is 6.0 to 6.5.

[0017] One application of the probiotic preparation is in the preparation of a drug that downregulates the expression of the Cdl gene in Fusobacterium nucleatum.

[0018] One application of the probiotic preparation is in the preparation of a drug that downregulates the expression of the Mgl gene in Porphyromonas gingivalis.

[0019] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention provides a strain of *Lactobacillus casei* KC88, which significantly downregulates the expression of a gene related to hydrogen sulfide production (Cdl gene) in *Fusobacterium nucleatum*, reducing the relative expression level to approximately 0.42, thereby inhibiting biofilm formation in *Fusobacterium nucleatum*. Furthermore, the *Lactobacillus casei* KC88 (both live and heat-inactivated strains) significantly downregulates the expression of a gene related to methanethiol production in *Porphyromonas gingivalis*, primarily downregulating the expression of the Mgl gene, reducing the relative expression level to approximately 0.35, thus inhibiting pathogenic bacterial biofilm production and reducing the production of volatile sulfides. The heat-inactivated strain primarily inhibits the production of volatile substances by *Porphyromonas gingivalis* due to the significant inhibitory effect of its surface proteins on pathogenic bacterial biofilms. Therefore, it can improve breath quality. Both live bacteria and heat-sterilized bacteria significantly reduced the plaque index in halitosis mice, restoring the plaque index to the normal control level, with an index of 1. Thin plaques were present near the gingival margin, invisible to the naked eye, but could be scraped out with the side of a probe tip. The halitosis index also returned to normal levels, decreasing by 46.10%. Attached Figure Description

[0020] Figure 1 A schematic diagram showing the adhesion ability of dominant bacteria and competing bacteria to hydroxyapatite is shown. Figure 2 A schematic diagram illustrating the self-aggregation ability of different strains is shown; Figure 3 A schematic diagram of the growth curves of different strains is shown. Detailed Implementation

[0021] The *Lactobacillus casei* KC88 provided by this invention was obtained by screening the saliva of healthy women without halitosis. Since most adults are prone to halitosis, and the saliva of healthy women without halitosis contains probiotics that inhibit vitamin C stores (VSCs), screening was conducted from the saliva of healthy women without halitosis. Specifically, the screening method for *Lactobacillus casei* KC88 is as follows: Initial screening: Six strains of bacteria were screened by initial screening of saliva samples, infant feces, breast milk and other samples (ability to inhibit Fusobacterium nucleatum, acid production, and biofilm inhibition rate of Fusobacterium nucleatum). These strains showed stronger antibacterial and acid-producing properties than the positive control strains. Secondary screening: The strains obtained from the initial screening were screened again (adhesion ability and self-aggregation ability to hydroxyapatite) to select secondary screening strains. Among them, Lactobacillus casei KC88 (TY1-18) had an adhesion ability to hydroxyapatite as high as 91.01%. Final screening: Lysozyme tolerance, gastrointestinal fluid tolerance, growth curve, inhibition zone of *Porphyromonas gingivalis*, and biofilm inhibition rate of pathogenic bacteria were evaluated. Combined with oral-gastric-intestinal triple tolerance screening, it was found that *Lactobacillus casei* KC88 could tolerate 1 mg / mL of lysozyme, with a gastric fluid tolerance survival rate as high as 98.13% and an intestinal fluid tolerance survival rate as high as 85.86%. Regarding the growth curve, *Lactobacillus casei* KC88 (TY1-18) entered the logarithmic growth phase earliest, and its stationary OD600 value was close to 2.5.

[0022] Specifically, the present invention will be further described in conjunction with the following embodiments.

[0023] Example 1 1. Evaluation of the probiotic functional characteristics of the initial screening strains Inhibition zone: Take 200µL of Fusobacterium nucleatum ATCC 25586 bacterial suspension (from Shanghai Microbiological Preservation Center) and spread it evenly on blood agar plates. After standing for 30 min to allow the bacterial suspension on the surface to fix, use an Oxford cup to make a hole on the surface of the plate and inject 200µL of lactic acid bacteria suspension (OD600 around 1.0) into the hole. Use physiological saline as a control. After incubation at 37℃ for 24 h, observe the results and measure the diameter of the inhibition zone.

[0024] Acid production capacity evaluation: The two dominant strains were inoculated into MRS liquid medium and cultured at 37°C for 24 h. After three generations of activation, the fermentation supernatant of each strain was collected and the pH of each fermentation supernatant was measured.

[0025] Biofilm inhibition rate of pathogenic bacteria: Adjust the 24-hour culture of pathogenic bacteria to 10 8 CFU / mL, add 100 µL of pathogenic bacterial suspension to each well of a 96-well plate. Simultaneously, add 100 µL of supernatant from all lactic acid bacteria to each well of the 96-well plate, using MRS as a blank control. Incubate the 96-well plate at 37°C for 24 h. After biofilm formation, carefully remove planktonic cells by washing three times with PBS, and fix with 100 µL of methanol per well for 30 min. After discarding the methanol, stain the biofilm with 0.1% crystal violet for 5 min. Discard the crystal violet, wash three times with PBS, add 200 µL of 36% glacial acetic acid to each well, and measure the absorbance of each well at 590 nm using a microplate reader.

[0026] Copolymerization rate: The cultured lactic acid bacteria and Fusobacterium nucleatum were adjusted to OD600 = 0.5 ± 0.05. Equal volumes of lactic acid bacteria and Streptococcus mutans suspensions were mixed thoroughly and incubated at 37℃ for 24 h. The absorbance of the supernatant was measured at 600 nm. The copolymerization rate was calculated using the following formula:

[0027] In the formula: Ax, initial OD value of lactic acid bacteria; Ay, initial OD value of Streptococcus mutans; Am, OD value of supernatant after 24 h of incubation.

[0028] Dental plaque biofilm is a prerequisite for halitosis. Only when pathogenic bacteria aggregate and adhere to form a biofilm and produce large amounts of acid does dental plaque begin to form and generate volatile substances, ultimately causing halitosis. Therefore, inhibiting biofilm formation is crucial for the prevention and treatment of dental caries. This invention evaluates the biofilm inhibitory effect of primary screening bacteria on *Fusobacterium nucleatum*. Specifically, this invention uses crystal violet staining to determine the inhibitory effect of 19 lactic acid bacteria strains on *Streptococcus mutans* biofilm. The specific results are shown in Table 1.

[0029] Table 1 Evaluation of the probiotic function of the pre-screened dominant bacteria

[0030] After entering the oral cavity, probiotics can copolymerize with planktonic pathogenic bacteria. The resulting copolymers are easily expelled from the oral cavity with saliva, thus inhibiting pathogenic bacteria in the mouth. Therefore, the copolymerization ability of probiotics and pathogenic bacteria also needs to be evaluated. Based on a comprehensive evaluation of indicators such as the diameter of the inhibition zone of *Fusobacterium nucleatum*, the biofilm inhibition ability of *Fusobacterium nucleatum*, acid production ability, and copolymerization ability, the following six strains were selected for subsequent screening: TY1-18 (*Lactobacillus casei* / *Lactobacillus paracasei*), TY4-8 (plant), TY21-1 (plant), 24-32m4 (plant), 33m1 (plant), and 31mc4 (plant), with *Streptococcus salivarius* K12 serving as a positive control strain.

[0031] Example 2 Assessment of the adhesion and growth capabilities of the secondary screening strains Adhesion of saliva-coated hydroxyapatite A saliva-coated hydroxyapatite (SHA) model was established. 100 µL of lactic acid bacteria suspension (centrifuged and then mixed with physiological saline) (OD600 = 0.5 ± 0.05) was mixed thoroughly with 10 µL of acridine orange fluorescent dye (0.01% dye) and incubated at 37°C in the dark for 30 min. 200 µL of the labeled bacterial suspension was added to a 96-well plate pre-filled with 1 mg of SHA, and anaerobically cultured at 37°C for 30 min. The supernatant was removed, and the plate was washed once with PBS and resuspended. The fluorescence value was measured using a fluorescence microplate reader; this value represents the fluorescence of the adherent bacteria. Wells containing only hydroxyapatite and PBS buffer served as the negative control group, while wells containing only labeled bacterial suspension were used to determine the total fluorescence value.

[0032] The adhesion ability of lactic acid bacteria to SHA is calculated using the following formula.

[0033]

[0034] Hydroxyapatite is a major component of tooth hard tissue, and the acquired membrane formed by salivary glycoproteins on the tooth surface is the main adhesion site for pathogenic microorganisms. Therefore, saliva-coated hydroxyapatite (SHA) is often used as an in vitro model to simulate the oral environment. Thus, the adhesion ability of the initially screened strains to hydroxyapatite was compared. The adhesion ability, from highest to lowest, was TY21-1 > 33m1 > TY1-18 > 31mc4, and all three strains showed superior adhesion ability compared to their competitors.

[0035] Self-cohesive ability: The OD600 of the lactic acid bacteria was adjusted to 0.5 ± 0.05 using sterile PBS (pH 7.0). 4 mL of the bacterial suspension was vortexed for 10 seconds and then allowed to stand at room temperature. The absorbance of the supernatant was measured at different time intervals (2 h, 4 h, 8 h, 18 h, 24 h). The self-polymerization rate (%) was calculated using the following formula.

[0036] 100% In the formula: A t A0, absorbance at t = 0; A0, absorbance at t = 0 The self-aggregation ability of lactic acid bacteria is positively correlated with their adhesion to epithelial cells. To ensure the colonization of lactic acid bacteria in the oral environment and further alleviate halitosis, it is necessary to screen for lactic acid bacteria strains with strong self-aggregation ability. Furthermore, since the later product design is for lozenges, strains with strong early-stage self-aggregation ability need to be identified. Strains with superior early-stage self-aggregation rates (0-8h) include: TY21-1, TY1-18, TY4-8, and 24-32M4.

[0037] Growth curve: Using the growth kinetics function module of the microplate reader, the dominant strain was inoculated into 24-well plates at a rate of 2 mL per well, with an inoculation volume of approximately 2%. The temperature was set at 37°C and the inoculation time was 24 h.

[0038] Depend on Figure 3 It can be seen that the strains that entered the logarithmic phase earliest and had high OD values ​​in the stationary phase were TY1-18, TY4-8, TY21-1, and 33m1.

[0039] Gastrointestinal fluid tolerance: Artificial gastric fluid tolerance test: The treated bacterial culture was inoculated into artificial gastric fluid at pH 3.0, and then incubated in a 37°C water bath for 3 hours. The number of viable bacteria was then measured and the survival rate was calculated.

[0040] Artificial intestinal fluid tolerance test: After treating high-survival-rate bacteria in artificial gastric fluid for 3 hours, they were inoculated into artificial intestinal fluid (containing 0.3% bile salts), placed in a 37°C water bath for 3 hours, and then the number of viable bacteria was measured and the survival rate was calculated.

[0041] Lysozyme tolerance: The concentration of lysozyme in the human oral cavity (1–57 µg / mL) was measured by adding 200 µL of 0, 1, 3, 5, or 10 mg / mL lysozyme solution to the wells of an Oxford cup, spreading 100 µL of probiotic fermentation broth on a plate, and determining the diameter of the inhibition zone using the Oxford cup inhibition zone method.

[0042] Table 2. Effects of different bacterial strains on lysozyme tolerance

[0043] Lysozyme in saliva has a strong dissolving effect on the acetaminophen component of the cell walls of Gram-positive cocci, leading to bacterial death. Table 2 shows that all six lactic acid bacteria strains could tolerate a concentration of 1 mg / mL of lysozyme, which is far higher than the concentration of lysozyme in the human oral cavity (1–57 µg / mL). For 10 mg / mL of lysozyme, the smaller the inhibition zone, the stronger the strain's tolerance. The lysozyme tolerance is: TY21-1 > 31mc4 > 33m1 > TY1-18.

[0044] Table 3. Gastrointestinal fluid tolerance of dominant bacteria

[0045] The gastrointestinal fluid tolerance of the above four strains was determined. The two strains with stronger gastrointestinal fluid tolerance were TY1-18 and TY21-1.

[0046] inhibition zone and biofilm inhibition rate of Porphyromonas gingivalis: Subsequent evaluation of the antibacterial ability of another pathogenic bacterium causing halitosis revealed that TY1-18 had a strong antibacterial ability against Porphyromonas gingivalis, with an inhibition zone of 14.32 mm and a biofilm inhibition rate as high as 92.39%.

[0047] Table 4. Antibacterial activity of dominant bacteria against Porphyromonas gingivalis

[0048] Example 3 16S rDNA identification The bacterial genomic DNA was extracted from the bacterial strain using a bacterial genomic DNA extraction kit. The extracted genomic DNA was then used as a template for PCR amplification. Universal primers were used for lactic acid bacteria. 27F (SEQ ID No. 1): AGAGTTTGATCCTGGCTCAG; 1492R (SEQ ID No. 2): GGTTACCTTGTTACGACTT; After electrophoresis detection of the amplified products, they were sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. An 800bp region was extracted from the sequencing peak diagram; the results were then compared with the GenBank database using the BLAST program. The strain origin and identification results are shown in Table 4.

[0049] Table 5. Strains' origin and identification results

[0050] The 16S DNA sequence of Lactobacillus casei KC88 is shown below: Example 4 Probiotic preparation method A method for preparing the probiotic preparation includes the following steps: The culture medium comprises the following components by weight percentage: 1.2% soybean peptone, 1.05% yeast extract, 2.0% glucose, 0.05% Tween, 0.1% dipotassium hydrogen phosphate heptahydrate, 0.4% sodium acetate trihydrate, 0.02% magnesium sulfate heptahydrate, 0.024% manganese sulfate monohydrate, 0.0515% L-cysteine, and the balance being distilled water. The pH is kept constant at 5.9 during fermentation, and the fermentation time is 16 hours. After centrifugation, probiotic sludge is obtained. The freeze-drying protectant contains 15% trehalose, 1.2% sodium thiosulfate, 1.2% maltodextrin, 1.0% sorbitol, and 5% whey protein powder. The pH is adjusted to 6.0 before freeze-drying.

[0051] The probiotic slurry is mixed evenly with the freeze-drying protectant and then freeze-dried to obtain probiotic freeze-dried powder.

[0052] Example 5 Research on the mechanism by which *Lactobacillus casei* KC88 inhibits the production of volatile substances by *Porphyromonas gingivalis*. 1. Preparation of live Lactobacillus casei KC88, heat-inactivated bacteria, and cell-free supernatant: Lactobacillus casei KC88 was cultured overnight, centrifuged at 10000×g for 5 minutes, washed three times with PBS, and resuspended until the OD600 was approximately 0.8, indicating live bacteria. Following the above procedure, the bacterial suspension with an OD600 of approximately 0.8 was inactivated in a 70℃ water bath for 1 hour to obtain heat-inactivated bacteria. The resuspended liquid was centrifuged and stirred at 100 rpm for at least 2 hours, then centrifuged at 10000×g for 5 minutes, and filtered through a 0.22µm sterile filter membrane to obtain cell-free supernatant. The live bacteria, heat-inactivated cells, and cell-free supernatant were stored at 4℃.

[0053] 2. Pathogenic bacteria biofilm inhibition rate: The above samples were used to evaluate the biofilm inhibition rate of Porphyromonas gingivalis.

[0054] 3. Lactobacillus casei KC88 can inhibit the expression of gas-producing genes in Porphyromonas gingivalis. Methods: The above control group (PBS), live bacteria, heat-inactivated bacteria, cell-free supernatant, and *Porphyromonas gingivalis* were co-cultured. The expression of key gas-producing genes was investigated using quantitative real-time PCR. RNA was extracted from the odor-producing bacteria and reverse transcribed into cDNA. The synthesized cDNA template was stored at -80°C. Quantitative real-time PCR was performed using the primers obtained in Table 5, with the 16S rRNA gene used as an internal reference gene. Amplification was performed using SYBR green PCR Master Mix (Applied Biosystems, Foster City, CA, USA). 2 - CT The target gene was relatively quantified, and the cycle threshold (Ct) was determined.

[0055] Table 6 Primer information for quantitative real-time PCR

[0056] Odor-causing bacteria in the oral cavity can degrade sulfur-containing amino acids to produce unpleasant VSCs, particularly hydrogen sulfide (H2S) and methanethiol (CH3SH). L-cysteine ​​desulfurization hydrolase acts on L-cysteine ​​to produce pyruvate, ammonia, and hydrogen sulfide, while L-methionine α-deamin-γ-mercaptomethane lyase (METase) produces α-ketobutyrate, ammonia, and methanethiol from L-methionine. *Porphyromonas gingivalis* produces large amounts of methanethiol via METase, a process encoded by the Mgl gene. Studies have found that a *Porphyromonas gingivalis* mutant with a defective Mgl gene produces significantly less methanethiol than the wild type; mgl is not only responsible for methanethiol production but is also associated with the pathogenicity of the bacteria. Additionally, *Fusobacterium nucleatum* produces large amounts of hydrogen sulfide via L-cysteine ​​desulfurization hydrolase, a process encoded by the Cdl gene.

[0057] Therefore, it is necessary to evaluate the effect of *Lactobacillus casei* KC88 on the expression of Mgl and Cdl genes. Table 6 shows that the live *Lactobacillus casei* KC88 bacteria exhibited a higher inhibition rate against pathogenic bacterial biofilms than the heat-inactivated group, but the difference was not statistically significant. The heat-inactivated cell group significantly downregulated the expression of the Mgl gene, with a relative expression level of approximately 0.35. This indicates that heat-inactivated *Lactobacillus casei* KC88 has a stronger inhibitory effect, significantly downregulating the expression of Mgl and Cdl genes and inhibiting the formation of pathogenic bacterial biofilms, thereby inhibiting the production of volatile substances by *Porphyromonas gingivalis*.

[0058] Table 7. Effects of different groups on biofilm inhibition rate and MGL gene expression of pathogenic bacteria

[0059] Example 6 Inactivated bacteria contain a variety of components, including teichoic acid, surface proteins, peptidoglycan, and capsular polysaccharides. In order to find out which component inhibits the adhesion of pathogenic bacteria and their gas production, the following experiments were conducted for verification.

[0060] 1. Effect of sodium periodate treatment on the inhibition of pathogenic bacterial biofilm The lactic acid bacteria cultured overnight were washed three times with PBS, and the bacterial cells were resuspended in 50 mM sodium periodate solution and incubated at 37°C for 30 min. The cells were then collected by centrifugation at 5000 x g for 10 min, washed five times with PBS, and the bacterial concentration was adjusted to 1.0 × 10⁻⁶. 9 The concentration of CFU / mL was heat-inactivated, and a biofilm inhibition experiment was performed with cultured pathogenic bacteria (Porphyromonas gingivalis). Untreated strains served as controls.

[0061] 2. Study on the inhibitory effect of lipoteichoic acid on pathogenic bacterial biofilm after bovine serum albumin treatment. The lactic acid bacteria cultured overnight were washed three times with PBS, and the bacterial cell mass was resuspended in 2% bovine serum albumin and incubated at 37°C for 30 min. The cells were then collected by centrifugation at 5000 x g for 10 min, washed five times with PBS, and the bacterial concentration was adjusted to 1.0 × 10⁻⁶. 9 The concentration of CFU / mL was heat-inactivated, and a biofilm inhibition experiment was performed with cultured pathogenic bacteria (Porphyromonas gingivalis). Untreated strains served as controls.

[0062] 3. Lithium chloride treatment study on the inhibitory effect of surface proteins on pathogenic bacterial biofilms. The lactic acid bacteria cultured overnight were washed three times with PBS, and the bacterial cells were resuspended in 5M LiCl and incubated at 37°C for 30 min. The cells were then collected by centrifugation at 5000 x g for 10 min, washed five times with PBS, and the bacterial concentration was adjusted to 1.0 × 10⁻⁶. 9 The concentration of CFU / mL was heat-inactivated, and a biofilm inhibition experiment was performed with cultured pathogenic bacteria (Porphyromonas gingivalis). Untreated strains served as controls.

[0063] Table 8. Inhibitory effects of heat-inactivated bacteria under different treatment methods on pathogenic bacteria.

[0064] Sodium periodate can cleave the C-C bonds between hydroxyl groups of sugars, thus the polysaccharides on the bacterial surface can be effectively removed by sodium periodate. After removing the extracellular polysaccharides on the surface of KC88 with sodium periodate, the biofilm inhibition ability of pathogenic bacteria decreased, but it did not reach a highly significant level (P>0.01), indicating that extracellular polysaccharides are not the main factor.

[0065] Because bovine serum albumin and lipoteichoic acid have similar cell membrane receptors, bovine serum albumin can significantly inhibit the role of lipoteichoic acid in biomembrane inhibition. The results showed that there was no significant difference between the KC88 group and the blank group (P>0.01), indicating that lipoteichoic acid is not an important factor. The surface proteins of bacterial cell KC88 were removed by lithium chloride to verify whether the inhibitory effect of the strain on pathogenic bacteria biofilm was due to the influence of its surface proteins. Lithium chloride treatment significantly reduced the biofilm inhibition rate of pathogenic bacteria, indicating that the surface proteins of the strain are involved in the inhibition process.

[0066] In summary, KC88 heat-inactivated bacteria inhibit the production of volatile substances by Porphyromonas gingivalis mainly because its surface proteins significantly inhibit the biofilm of pathogenic bacteria.

[0067] Example 7 Animal experiments verified Preparation of pathogenic bacteria culture Fusobacterium nucleatum was inoculated into nutrient broth medium and cultured anaerobically at 37°C for 2-5 days. Single colonies from the plates were picked and a bacterial suspension was prepared in 5 mL of sterile PBS (50 mmol / L, pH 7.4), adjusted to a McFarland turbidity concentration of 0.5 (i.e., 1 x 10⁻⁶). 7 The solution was prepared by adding carboxymethyl cellulose (CFU / mL) and filtering it through a 0.22µm pore size membrane to obtain a fresh pathogenic bacteria solution containing 2% carboxymethyl cellulose.

[0068] Preparation of lactic acid bacteria culture: According to the bacterial agent prepared in Example 4, the OD600 of the bacterial solution was adjusted to about 0.8 using sterile PBS to obtain a lactic acid bacteria solution. According to the bacterial agent prepared in Example 4, it was inactivated at 110°C for 15 minutes, and then the OD600 of the bacterial solution was adjusted to about 0.8 to obtain an inactivated lactic acid bacteria solution.

[0069] Establishment of a rat model of periodontitis and halitosis SPF-grade male Wistar rats, weighing 180–220g, were selected. They were healthy, active, with glossy fur, good appetite, and free from dental caries and periodontal disease. After anesthetizing the rats with an intraperitoneal injection of 3% sodium pentobarbital (1 mg / kg), the mandibular first molar was ligated at the neck with medical sutures, ensuring the suture was placed as far into the gingival sulcus as possible. If the suture came loose, it needed to be re-ligated. After ligation, the rats were fed 10% glucose solution instead of drinking water. A bacterial suspension of pathogenic bacteria (1×10⁻⁶) was selected. 7The prepared pathogenic bacterial solution (CFU / mL) was applied to the periodontal tissue of the mandibular first molar every other day (0.1 ml). After 28 days, the plaque index (PI) and halitosis concentration in rats were measured. Periodontal tissue was taken from two rats, fixed, and prepared for pathological examination to observe the pathological changes. The results showed that the animals had a PI value greater than 3, with abundant inflammatory cell infiltration in the periodontal fibers, disordered collagen fiber bundle arrangement, and alveolar bone resorption, indicating successful model establishment.

[0070] Animal grouping and administration.

[0071] Male rats were randomly divided into a normal control group (normal rats), a model group (model rats), and experimental groups A (live bacteria with an OD of approximately 0.8) and B (inactivated bacteria with an OD of approximately 0.8), with 10 rats in each group. After successful modeling, the normal control group and the model group were administered 0.5% sodium carboxymethyl cellulose by gavage. Experimental group A was treated with a periodontal tissue lactic acid bacteria solution, while experimental group B was treated with a periodontal tissue inactivated lactic acid bacteria solution. The administration was carried out once daily at a dose of 1 ml / 100g body weight for 14 consecutive days. The rats' mental state, activity, coat, diet, and periodontal changes were observed daily.

[0072] Evaluation indicators: A. Plaque Index (PI): Each tooth is examined at four points: mesobob, buccal, distobuccal, and lingual. Each point is scored separately. The sum of the four scores divided by 4 gives the tooth's overall score. 0 indicates no plaque near the gingival margin; 1 indicates a thin layer of plaque near the gingival margin, invisible to the naked eye but scrapable with the side of a probe tip; 2 indicates a moderate amount of plaque at the gingival margin or proximal surfaces; 3 indicates a large amount of soft plaque in the gingival sulcus or at the gingival margin and proximal surfaces.

[0073] B. Halitosis Index (HI): The halitosis index (ppm) was measured using a Halimeter PLUS breath analyzer.

[0074] Table 9 Comparison of plaque index and halitosis index among different groups of rats after the end of the event.

[0075] Both live and heat-inactivated Lactobacillus casei KC88 significantly reduced the plaque index in halitosis mice, restoring it to the level of the normal control (index 1). Thin plaques were present near the gingival margin, invisible to the naked eye, but could be scraped out with the side of a probe tip. The halitosis index also returned to the normal level, decreasing by 46.10%.

Claims

1. A type of Lactaseibacillus casei KC88, characterized in that: Its accession number is CGMCC No.32107.

2. A fermentation product, characterized in that: It is obtained by fermentation of Lactobacillus casei KC88 as described in claim 1.

3. A probiotic preparation, characterized in that: It includes Lactobacillus casei KC88 as described in claim 1 and the fermentation product as described in claim 2.

4. A method for preparing the probiotic preparation as described in claim 3, characterized in that: Includes the following steps: After inoculating the culture medium with the aforementioned Lactobacillus casei KC88, fermentation was carried out to obtain probiotic sludge. The probiotic slurry is mixed with a freeze-drying protectant and then freeze-dried to obtain the final product.

5. The method for preparing the probiotic preparation as described in claim 4, characterized in that: The culture medium comprises the following components by weight percentage: 1.0-1.5% soybean peptone, 0.5-1.5% yeast extract, 2.0-4.0% glucose, 0.05-0.10% Tween, 0.1-0.2% dipotassium hydrogen phosphate heptahydrate, 0.4-0.6% sodium acetate trihydrate, 0.02-0.04% magnesium sulfate heptahydrate, 0.02-0.04% manganese sulfate monohydrate, 0.05-0.15% L-cysteine, and water as the balance.

6. The method for preparing the probiotic preparation as described in claim 4, characterized in that: The freeze-drying protectant, by weight percentage, comprises 10-25% trehalose, 1-3% sodium thiosulfate, 1.0-1.5% maltodextrin, 1-2% sorbitol, 5-10% whey protein powder, and the balance being water.

7. The method for preparing the probiotic preparation as described in claim 4, characterized in that: The fermentation process had a pH of 5.9 and a fermentation time of 12–18 hours. The pH of the freeze-drying protectant is 6.0 to 6.

5.

8. The application of the probiotic preparation as described in claim 3, characterized in that: It is used in the preparation of drugs that inhibit biofilm formation in Fusobacterium nucleatum.

9. The application of the probiotic preparation as described in claim 3, characterized in that: It is used in the preparation of drugs that inhibit biofilm formation by Porphyromonas gingivalis.

Images