Stat3 gene snps marker for detecting milk production traits of sheep and application thereof

Abstract

This invention discloses a method for detecting milk production traits in sheep. STAT3 Gene SNP markers and their applications belong to the field of biotechnology. This study uses dairy sheep as the research subject to investigate... STAT3 The expression levels of this gene in seven tissues, including the mammary gland, were investigated. The SNP sites of this gene were examined, and the impact of nucleotide sequence variations on sheep lactation performance was analyzed, aiming to provide effective molecular markers for improving sheep lactation performance. STAT3 STAT3 STAT3 STAT3 STAT3 Five SNP loci were identified in the genes: c.22+537C / T, c.22+658C / T, c.318+126C / G, c.417+360G / A, and c.417+395T / C. Compared with traditional selection methods, this invention allows for selection at birth in lambs, with higher accuracy. Therefore, this invention enables "early and accurate selection" of milk production performance in dairy sheep.

Description

Technical Field

[0001] This invention relates to a STAT3 gene SNP marker for detecting milk production traits in sheep and its application, belonging to the field of biotechnology. Background Technology

[0002] Signal transducers and activators of transcription (STAT3) is an important member of the STAT family, playing a dual role in cytoplasmic signal transduction and nuclear transcriptional activation. As intracellular effector molecules, the STAT protein family primarily participates in various biological processes such as cell proliferation, survival, differentiation, and angiogenesis through the JAK / STAT signaling pathway. Studies have demonstrated that most members of the STAT family are associated with mammary gland development and lactation. For example, growth hormone and prolactin activate JAK family tyrosine kinases upon binding to their receptors, which then bind to STAT1, affecting lactation performance in female animals. STAT4 is expressed in mammary gland tissue during pregnancy; when interleukin-12 (IL-12) binds to receptors on the surface of mammary epithelial cells, it initiates the JAK / STAT4 signaling pathway, regulating mammary cell differentiation. STAT5, known as the mammary factor, was first discovered in goat mammary glands. It mainly affects the vitality, proliferation, milk fat synthesis, casein synthesis, and mammary gland development of mammary epithelial cells through the JAK / STAT5 pathway. STAT6 is also known as a regulator of mammary gland differentiation. In early pregnancy, it can induce the expression of GATA-binding protein 3 (GATA3), thereby stimulating acinar differentiation and proliferation.

[0003] STAT3 protein, as a nuclear transcription factor and cytoplasmic signaling factor, is widely expressed in various tissues of livestock, including the mammary gland, liver, and kidney, and regulates physiological processes such as cell growth, migration, proliferation, and transformation. Studies have found that STAT3 is a key regulator of lysosome-mediated programmed cell death during mammary gland involution and a crucial mediator of this process. Knockout of STAT3 inhibits apoptosis in mouse mammary epithelial cells and delays mammary gland involution. Further research revealed that STAT3 induces mammary gland involution by affecting the expression of insulin-like growth factor binding protein-5 (IGFBP-5) in mammary epithelial cells. However, the effects of STAT3 gene polymorphisms on lactation traits in sheep have not yet been reported. Summary of the Invention

[0004] This study used 414 dairy sheep as research subjects and employed methods such as reverse transcriptase-quantitative-PCR (RT-qPCR), Sanger sequencing, and penta-primer amplification refractory mutation system (PARMS) to investigate the expression level of the STAT3 gene in seven tissues, including the mammary gland. The SNP sites of this gene were detected, and the effects of nucleotide sequence variations on sheep lactation performance were analyzed, aiming to provide effective molecular markers for improving sheep lactation performance.

[0005] This invention provides a single nucleotide polymorphism (SNP) genetic marker associated with milk production traits in sheep, wherein the SNP is located in the sheep STAT3 gene, and the SNP is any one or more combinations of the following (a) to (e);

[0006] (a) The single nucleotide polymorphism genetic marker is located at c.22+537bp of the STAT3 gene on the positive strand of chromosome 11 in the sheep reference genome ARS-UI_Ramb_v3.0 version sequence information, and there is a C / T base mutation;

[0007] (b) The single nucleotide polymorphism genetic marker is located at position c.22+658bp of the STAT3 gene on the positive strand of chromosome 11 in the sheep reference genome ARS-UI_Ramb_v3.0 version sequence information, and there is a C / T base mutation.

[0008] (c) The single nucleotide polymorphism genetic marker is located at position c.318+126bp of the STAT3 gene on the positive strand of chromosome 11 in the sheep reference genome ARS-UI_Ramb_v3.0 version sequence information, and there is a C / G base mutation.

[0009] (d) The single nucleotide polymorphism genetic marker is located at position c.417+360bp of the STAT3 gene on the positive strand of chromosome 11 in the sheep reference genome ARS-UI_Ramb_v3.0 version sequence information, and there is a G / A base mutation.

[0010] (e) The single nucleotide polymorphism genetic marker is located at position c.417+395bp of the STAT3 gene on the positive strand of chromosome 11 in the sheep reference genome ARS-UI_Ramb_v3.0 version sequence information, and has a T / C base mutation.

[0011] This invention also provides the application of at least one of the following five SNP sites in identifying or assisting in the identification of sheep milk production traits; the SNP site is the cytosine C at position c.22+537 of the STAT3 gene on the positive strand of chromosome 11, corresponding to the sheep reference genome ARS-UI_Ramb_v3.0 version sequence information, which is replaced by thymine T.

[0012] The SNP site is the cytosine C at position c.22+658 of the STAT3 gene on the positive strand of chromosome 11, corresponding to the sheep reference genome ARS-UI_Ramb_v3.0 version sequence information, which is replaced by thymine T.

[0013] The SNP site is the cytosine C at position c.318+126 of the STAT3 gene on the positive strand of chromosome 11, corresponding to the sheep reference genome ARS-UI_Ramb_v3.0 version sequence information, which is replaced with guanine G;

[0014] The SNP site is the guanine G at position c.417+360 of the STAT3 gene on the positive strand of chromosome 11, corresponding to the sheep reference genome ARS-UI_Ramb_v3.0 version sequence information, which is replaced with adenine A;

[0015] The SNP site refers to the thymine T at position c.417+395 of the STAT3 gene on the positive strand of chromosome 11, corresponding to the sequence information of sheep reference genome ARS-UI_Ramb_v3.0, where cytosine C is replaced by thymine T.

[0016] In one embodiment of the present invention, the milk production characteristics are milk fat percentage and / or ash content and / or dry matter content and / or average daily milk yield.

[0017] This invention also provides a reagent for detecting the genotype of at least one of the following five SNP sites in the identification or auxiliary identification of sheep milk production traits; wherein the SNP site is the cytosine C at position c.22+537 of the STAT3 gene on the positive strand of chromosome 11, corresponding to the sheep reference genome ARS-UI_Ramb_v3.0 version sequence information, which is replaced by thymine T;

[0018] The SNP site is the cytosine C at position c.22+658 of the STAT3 gene on the positive strand of chromosome 11, corresponding to the sheep reference genome ARS-UI_Ramb_v3.0 version sequence information, which is replaced by thymine T.

[0019] The SNP site is the cytosine C at position c.318+126 of the STAT3 gene on the positive strand of chromosome 11, corresponding to the sheep reference genome ARS-UI_Ramb_v3.0 version sequence information, which is replaced with guanine G;

[0020] The SNP site is the guanine G at position c.417+360 of the STAT3 gene on the positive strand of chromosome 11, corresponding to the sheep reference genome ARS-UI_Ramb_v3.0 version sequence information, which is replaced with adenine A;

[0021] The SNP site refers to the thymine T at position c.417+395 of the STAT3 gene on the positive strand of chromosome 11, corresponding to the sequence information of sheep reference genome ARS-UI_Ramb_v3.0, where cytosine C is replaced by thymine T.

[0022] In one embodiment of the present invention, the milk production characteristics are milk fat percentage and / or ash content and / or dry matter content and / or average daily milk yield.

[0023] This invention also provides the application of a haplotype combination sequence of a single nucleotide polymorphism molecular marker associated with sheep milk production traits in improving sheep milk fat percentage and / or dry matter content and / or ash content and / or average daily milk yield, wherein the haplotype combination is the haplotype combination of the single nucleotide polymorphism genetic marker associated with sheep milk production traits as described in claim 1, and the haplotype combination sequence tag is CCGGTTTT or CTGCTCTC or CTGCTTTT or CTGCTCTT or CTGGTCTC;

[0024] The single nucleotide polymorphism genetic marker is located at position c.22+537bp of the STAT3 gene on the positive strand of chromosome 11 in the sheep reference genome ARS-UI_Ramb_v3.0 version sequence information, and there is a C / T base mutation.

[0025] Or it may be located at position c.22+658bp of the STAT3 gene on the positive strand of chromosome 11 in the sheep reference genome ARS-UI_Ramb_v3.0 version sequence information, and there is a C / T base mutation;

[0026] Or it may be located at position c.318+126bp of the STAT3 gene on the positive strand of chromosome 11 in the sheep reference genome ARS-UI_Ramb_v3.0 version sequence information, and there is a C / G base mutation;

[0027] Or it may be located at position c.417+360bp of the STAT3 gene on the positive strand of chromosome 11 in the sheep reference genome ARS-UI_Ramb_v3.0 version sequence information, and there is a G / A base mutation;

[0028] It may be located at position c.417+395bp of the STAT3 gene on the positive strand of chromosome 11 in the sheep reference genome ARS-UI_Ramb_v3.0 version sequence information, and there is a T / C base mutation.

[0029] This invention also provides a method for identifying or assisting in the identification of milk production traits in sheep, wherein the method is any one of the following 1)-5):

[0030] 1) Includes the following steps: Detecting the genotype of the SNP site c.22+537C / T in the STAT3 gene of the tested sheep; the genotype of the SNP site c.22+537C / T is CC, CT, or TT;

[0031] The milk fat percentage and dry matter content of the tested sheep with the SNP site c.22+537C / T genotype CC in the STAT3 gene were superior to or slightly superior to those of the tested sheep with the SNP site c.22+537C / T genotypes CT and TT.

[0032] 2) Includes the following steps: Detecting the genotype of the SNP site c.22+658C / T in the STAT3 gene of the tested sheep; the genotype of the SNP site c.22+658C / T is CC, CT, or TT;

[0033] The milk fat percentage and dry matter content of the tested sheep with the SNP site c.22+658C / T genotype CC in the STAT3 gene were superior to or slightly superior to those of the tested sheep with the SNP site c.22+658C / T genotype TT.

[0034] 3) Includes the following steps: Detecting the genotype of the SNP site c.318+126C / G in the STAT3 gene of the tested sheep; the genotype of the SNP site c.318+126C / G is CC, CG or GG;

[0035] The milk fat percentage of the tested sheep with the genotype CC at the SNP site c.318+126C / G in the STAT3 gene was better than or slightly better than that of the tested sheep with the genotype GG at the SNP site c.318+126C / G.

[0036] 4) Includes the following steps: Detecting the genotype of the SNP site c.417+360G / A in the STAT3 gene of the tested sheep; the genotype of the SNP site c.417+360G / A is GG, GA or AA;

[0037] The milk fat percentage and dry matter content of the tested sheep with the genotype GG at the SNP site c.417+360G / A in the STAT3 gene were superior to or slightly superior to those of the tested sheep with the genotypes GA and AA at the SNP site c.417+360G / A.

[0038] 5) Includes the following steps: Detecting the genotype of the SNP site c.417+395T / C in the STAT3 gene of the tested sheep; the genotype of the SNP site c.417+395T / C is TT, TC or CC;

[0039] The milk fat percentage and dry matter content of the tested sheep with the TT genotype at the SNP site c.417+395T / C in the STAT3 gene were superior to or slightly superior to those of the tested sheep with the CC genotype at the SNP site c.417+395T / C.

[0040] In one embodiment of the present invention, the milk production characteristics are milk fat percentage and / or ash content and / or dry matter content and / or average daily milk yield.

[0041] This invention also provides the application of the above method in sheep screening or sheep breeding.

[0042] In one embodiment of the invention, the sheep selected for testing are of any of the following types for milk production or breeding:

[0043] The tested sheep with the CC genotype at the SNP site c.22+537C / T in the STAT3 gene;

[0044] Or the tested sheep with the genotype CC at the SNP site c.22+658C / T in the STAT3 gene;

[0045] Or the tested sheep with the genotype CC at the SNP site c.318+126C / G in the STAT3 gene;

[0046] Or the test sheep with the genotype GG at the SNP site c.417+360G / A in the STAT3 gene;

[0047] Or the test sheep with the genotype TT at the SNP site c.417+395T / C in the STAT3 gene.

[0048] The present invention also provides a primer pair for detecting mutations in the STAT3 gene, wherein the upstream and downstream nucleotide sequences of the primer pair are shown in SEQ ID NO. 1-2, respectively; or the upstream and downstream nucleotide sequences of the primer pair are shown in SEQ ID NO. 3-4, respectively; or the upstream and downstream nucleotide sequences of the primer pair are shown in SEQ ID NO. 5-6, respectively.

[0049] In one embodiment of the present invention, the first intron region is amplified using primers shown in SEQ ID NO.1~2, and c.22+537C / T (SNP1) and c.22+658C / T (SNP2) are detected in the first intron region.

[0050] The present invention amplifies the third intron region using primers shown in SEQ ID NO.3~4, and detects c.318+126C / G (SNP3) in the third intron region.

[0051] The present invention amplifies the fourth intron region using primers shown in SEQ ID NO.5~6, and c.417+360G / A (SNP4) and c.417+395T / C (SNP5) are detected in the fourth intron region.

[0052] The present invention also provides a method for detecting molecular markers associated with milk production traits in sheep, the method comprising the following steps:

[0053] a) Genomic DNA was extracted from sheep blood samples, and the sheep STAT3 gene was amplified by PCR using the primers shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.6;

[0054] b) Perform pooled sequencing and sequence analysis on the above PCR amplification products to obtain the mutation sites and determine the mutation types;

[0055] c) By performing STAT3 genotyping on individual sheep, the genotype and haplotype of the SNP loci in the STAT3 gene detection region of the sheep can be identified based on the genotyping results.

[0056] In one embodiment of the present invention, the milk production characteristics are milk fat percentage and / or ash content and / or dry matter content and / or average daily milk yield.

[0057] The present invention also provides a kit for detecting the above-mentioned molecular markers related to sheep milk production traits, the kit comprising the following primer pairs. The upstream and downstream nucleotide sequences of the primer pairs are shown in SEQ ID NO. 1-2, respectively; or the upstream and downstream nucleotide sequences of the primer pairs are shown in SEQ ID NO. 3-4, respectively; or the upstream and downstream nucleotide sequences of the primer pairs are shown in SEQ ID NO. 5-6, respectively.

[0058] In one embodiment of the present invention, the milk production characteristics are milk fat percentage and / or ash content and / or dry matter content and / or average daily milk yield.

[0059] The present invention also provides an application of primer pairs or primer combinations, said application being any one of the following (a)-(f):

[0060] (a) Identifying or assisting in the identification of milk production traits in sheep;

[0061] (b) Sheep selection;

[0062] (c) Sheep breeding;

[0063] (d) Prepare a kit for identifying or assisting in the identification of milk production traits in sheep;

[0064] (e) Preparation of a kit for sheep screening;

[0065] (f) Preparation of a kit for sheep breeding.

[0066] The upstream and downstream nucleotide sequences of the primer pair are shown in SEQ ID NO. 1-2, respectively; or the upstream and downstream nucleotide sequences of the primer pair are shown in SEQ ID NO. 3-4, respectively; or the upstream and downstream nucleotide sequences of the primer pair are shown in SEQ ID NO. 5-6, respectively.

[0067] In one embodiment of the present invention, the milk production characteristics are milk fat percentage and / or ash content and / or dry matter content and / or average daily milk yield.

[0068] Beneficial effects

[0069] This invention uses lactating sheep as the research subject, applies Sanger and other techniques to detect nucleotide sequence variation sites in the STAT3 gene, and constructs a general linear mixed-effects model to study the correlation between nucleotide sequence variation and sheep lactation traits, thereby identifying molecular genetic markers regulating sheep lactation traits. This invention has achieved some positive results and indeed possesses significant advantages compared to existing technologies, as detailed below:

[0070] (1) A total of 5 SNPs were found in the sheep STAT3 gene. Among them, c.22+537C / T (SNP1) and c.22+658C / T (SNP2) were detected in the first intron region, c.318+126C / G (SNP3) was detected in the third intron region, and c.417+360G / A (SNP4) and c.417+395T / C (SNP5) were detected in the fourth intron region.

[0071] (2) At SNP1, the milk fat percentage of CC individuals was 0.724% and 1.262% higher than that of CT and TT individuals, respectively, and the dry matter content was 0.924% and 1.584% higher than that of TT individuals (P<0.05); at SNP2, the milk fat percentage and dry matter content of CC individuals were 0.828% and 1.041% higher than those of TT individuals, respectively (P<0.05); at SNP3, the milk fat percentage of CC individuals was significantly higher than that of GG individuals. 0.263% (P<0.05); at SNP4, the milk fat percentage of individuals with the GG genotype was 0.734% and 1.062% higher than that of individuals with the GA and AA genotypes, respectively, and the dry matter content was 0.939% and 1.299% higher than that of individuals with the AA and AA genotypes, respectively (P<0.05); at SNP5, the milk fat percentage of individuals with the TT genotype was significantly higher than that of individuals with the CC genotype by 0.968%, and the dry matter content was 0.756% and 1.194% higher than that of individuals with the CC and TC genotypes, respectively (P<0.05).

[0072] (3) In traditional selection methods, individual selection is carried out after the sheep have started lactating, based on their milk production performance. At this time, the sheep are about 1.5 years old, and due to the low heritability of some traits, the accuracy of this method is not high. If the progeny selection method with higher accuracy is adopted, the generation interval is too long (about 3 years), and early selection cannot be achieved.

[0073] Therefore, compared with traditional selection methods, this invention allows for selection of lambs at birth, and the selection accuracy is higher than that of traditional breeding methods. Thus, this invention enables "early and accurate selection" of milk production performance in dairy sheep. Attached Figure Description

[0074] Figure 1 : Expression levels of the STAT3 gene in seven sheep tissues; Note: Different lowercase letters represent significant differences (P<0.05).

[0075] Figure 2 SNP sites of the sheep STAT3 gene; Note: The arrows indicate the SNP locations.

[0076] Figure 3 : PARMS genotyping of sheep STAT3; Note: X-axis represents FAM fluorescence signal intensity, Y-axis represents HEX fluorescence signal intensity. Detailed Implementation

[0077] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0078] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0079] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.

[0080] The detection methods involved in the following embodiments are as follows:

[0081] The following indicators were measured using a UL40BC milk composition analyzer:

[0082] Milk fat percentage: The percentage of fat contained in milk.

[0083] Milk protein percentage: The percentage of protein contained in milk.

[0084] Ash content: The mineral content in milk.

[0085] Non-dairy fat solids content: The content of nutrients in milk other than lipids and water.

[0086] Dry matter content: The content of other nutrients in milk after water is removed.

[0087] Lactose: The lactose content in sheep milk.

[0088] The daily milk production of each experimental sheep was determined using a DeLaval 9JP-2X24 parallel milking machine.

[0089] Example 1: Gene sequencing and analysis of SNPs associated with dry matter content and fat percentage in sheep milk

[0090] 1. Collection of experimental animals and samples

[0091] (1) Collection of blood and milk

[0092] At Gansu Yuansheng Agricultural and Animal Husbandry Technology Co., Ltd., 414 sheep with complete records of parity, number of lambs, and age, and currently in lactation, were selected. These included 35 Hu sheep (H), 17 East Friensian sheep (EF), 193 F1 crossbred East Friensian sheep (♂) × Hu sheep (♀), and 169 F2 progressive crossbred East Friensian sheep (♂) × Hu sheep (♀). During lactation (approximately 30 days after lambing), the daily milk production of the experimental sheep was measured using a DeLaval 9JP-2X24 parallel milking machine (DeLaval, Tianjin, China). 50 mL milk samples were collected from each sheep, and milk composition, including milk fat percentage, milk protein percentage, ash content, non-fat milk solids content, dry matter content, and lactose percentage, was determined using a UL40BC milk composition analyzer (U-Chuang, Hangzhou, China). Simultaneously, 1 mL of blood was collected from each test sample, dripped onto an FTA card, and dried for genomic DNA extraction. Additionally, three lactating F1 generation sheep were selected, and their hearts, livers, spleens, lungs, kidneys, ovaries, and mammary glands were collected after slaughter. These tissues were immediately preserved in liquid nitrogen and brought back to the laboratory as soon as possible for cryopreservation at -80°C for total RNA extraction.

[0093] 2. Extraction of genomic DNA from sheep blood and RNA from tissues

[0094] The specific steps are as follows:

[0095] 800 μL of blood was dropped onto an FTA card and dried at room temperature. Following the method described by Zhou et al. (2006), genomic DNA was extracted from the blood from the FTA card for screening STAT3 gene SNPs. Specifically, a 1.2 mm diameter disc was taken from the FTA card using a sampler and placed in a 1.5 mL centrifuge tube. 200 μL of 20 mmol / L NaOH was added to the centrifuge tube, and the mixture was incubated at room temperature for 30 minutes. If the blood sample had been stored for a long time, it was heated in a 50°C water bath for 25 minutes. During incubation, the centrifuge tube was rotated periodically. The NaOH solution in the tube was discarded. 200 μL of TE buffer solution was added, and the mixture was allowed to stand for 2 minutes. The TE buffer solution was then discarded, and the disc was air-dried at room temperature for later use.

[0096] Total RNA was extracted from heart, liver, spleen, lung, kidney, ovary, and breast tissues using the Rrizol method, and the concentration and purity of the RNA were detected using a NanoDrop 8000 spectrophotometer (Thermo Fisher Scientific, New York, USA). Subsequently, the quality-controlled RNA was reverse transcribed into cDNA using an Evo M-LV reverse transcription kit (Aikerui Biotechnology, Changsha, China) to detect the expression level of the STAT3 gene.

[0097] 3. STAT3 gene PCR primer design, amplification, and sequencing

[0098] The specific steps are as follows:

[0099] (1) Primer design for the STAT3 gene

[0100] By comparing the SNP regions of the STAT3 gene previously discovered in goats and cattle, and referring to the SNP information predicted on the AOD website and the sheep STAT3 gene sequence (XM_060395625) on NCBI, seven pairs of specific primers P1~P7 were designed using Primer 5.0 software to amplify exon 8, exon 9, intron 1, intron 3, intron 4, intron 11, and the 3'UTR region of the STAT3 gene. Simultaneously, one pair of RT-qPCR primers was designed in the CDS region to detect the expression level of the STAT3 gene (Table 1).

[0101] Table 1: Primer sequences, product lengths, and annealing temperatures

[0102] (2) PCR amplification and SNP site detection

[0103] Thirty samples were randomly selected from the experimental sheep. A 20 μL PCR reaction system was used to amplify seven regions of the STAT3 gene, including one 1.2 mm DNA card, 0.8 μL each of upstream and downstream primers (10 μmol / L), 10.4 μL of Taq DNA polymerase, and 8.0 μL of ddH2O. The amplification conditions were: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 56–62℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles; final extension at 72℃ for 7 min; and storage at 4℃. Two μL of the PCR amplification products from each of the 30 samples were mixed in equal volumes and sent to Yangling Tianrun Aoke Biotechnology Co., Ltd. for Sanger sequencing. Finally, Chromas software was used to screen for SNP sites.

[0104] (3) Analysis of STAT3 gene expression characteristics

[0105] The quality-tested cDNA was diluted to a concentration of 30 ng / μL. Using β-actin as an internal control gene, RT-qPCR was performed in a 20 μL system on an Applied Biosystems QuantStudio® 6 Flex qPCR instrument (Thermo Fisher Scientific, New York, USA). The system included 10 μL of SYBR Green qPCR Master Mix (Saiwell, Wuhan, China), 7.2 μL of deionized water, 0.8 μL of primers, and 2 μL of cDNA. Each sample was performed in 3 biological replicates and 4 technical replicates. Finally, 2... -ΔΔCtThe relative expression levels of the STAT3 gene in different sheep tissues were calculated.

[0106] (4) Experimental results

[0107] RT-qPCR results showed that the STAT3 gene was expressed in all seven sheep tissues, with the highest expression level in the lungs, followed by the liver and mammary glands, but both were significantly higher than those in the heart, spleen, kidneys, and ovaries (P<0.05), and the lowest expression level was found in the spleen. Figure 1 ).

[0108] The results showed that a total of 5 SNP sites were found in the sheep STAT3 gene. Figure 2 Specifically, c.22+537C / T (SNP1) and c.22+658C / T (SNP2) were detected in the first intron region, c.318+126C / G (SNP3) was detected in the third intron region, and c.417+360G / A (SNP4) and c.417+395T / C (SNP5) were detected in the fourth intron region.

[0109] SNP1: Represents single nucleotide polymorphism site 1, which is c.22+537C / T. This indicates that the STAT3 gene sequence located on sheep chromosome 11 has a C / T mutation at c.22+537bp.

[0110] SNP2: indicates single nucleotide polymorphism site 2, which is c.22+658C / T. This means that the STAT3 gene sequence located on sheep chromosome 11 has a C / T mutation at c.22+658bp.

[0111] SNP3: Represents single nucleotide polymorphism site 3, specifically c.318+126C / G, indicating a C / G mutation at c.318+126bp in the STAT3 gene sequence located on sheep chromosome 11.

[0112] SNP4: Represents single nucleotide polymorphism site 4, specifically: c.417+360G / A, indicating that the STAT3 gene sequence located on sheep chromosome 11 has a G / A mutation at c.417+360bp;

[0113] SNP5: Represents single nucleotide polymorphism site 5, which is c.417+395T / C. This indicates that the STAT3 gene sequence located on sheep chromosome 11 has a T / C mutation at c.417+395bp.

[0114] Based on the five identified SNPs, primers for amplifying these SNPs can be designed, including forward and reverse primers, located upstream and downstream of the five single nucleotide polymorphism sites, respectively. Kits for detecting these SNPs can also be designed using existing technologies based on these primers.

[0115] Example 2: Association between genotyping and milk production traits in sheep

[0116] 1. Experimental Methods

[0117] (1) Genotype determination and haplotype construction

[0118] Based on the sequencing results in Example 1, the SNP sites with mutations in the first, third, and fourth intron regions of the STAT3 gene were counted. Blood DNA extracted from the blood of all 414 lactating ewes selected in Example 1 was sent to Wuhan Jingtai Biotechnology Co., Ltd. for PARMS genotyping. The specific method is as follows:

[0119] Five primers were used for PCR reactions: two common fluorescent primers (CFPs) labeled with FAM and HEX respectively, two allele-specific primers (ASPs), and one locus-specific primer (LSP). ASPs bound to the target site and combined with LSP for amplification. CFPs recognized the adapter sequence and bound to LSP to amplify the corresponding DNA template. Genotypes were detected by competitive allele-specific polymerase chain reaction (AS-PCR). Finally, scatter plots were generated using Excel 2016 software based on the fluorescence signal values. Specific information on the PARMS genotyping primers is shown in Table 2. Haplotypes of the STAT3 gene were constructed using Haploview v4.2 software.

[0120] Table 2: PARMS Genotyping Primer Information

[0121] (2) Correlation analysis of lactation traits

[0122] Application of the Molecular Markers of the Invention in Association Analysis of Sheep Milk Production Traits

[0123] The experiment examined the polymorphism of 414 lactating ewes to determine their genotypes. The effects of STAT3 gene nucleotide sequence variations (genotype and haplotype combinations) on sheep lactation traits were analyzed using a general linear mixed-effects model in SPSS 27.0. The results are expressed as mean ± standard error.

[0124] To determine the fixed and random effects included in the model, we analyzed the effects of age, number of lambs, and parity on the lactation trait of sheep. The results showed that the number of lambs and parity had no significant effect on the lactation trait, but age had a highly significant effect on the lactation trait. Therefore, age was included in the model.

[0125] The analytical model is Y = μ + Genotype (Haplotype) + Population + Age + e, where Y represents the lactation trait, µ is the population mean, Genotype is the genotype, Haplotype is the haplotype, Population is the experimental population, Age is the age, and e is the random effect.

[0126] 2. Experimental Results

[0127] The embodiments of the present invention have achieved some positive results during the research and development or use process, and have indeed great advantages compared with the prior art. The following content describes them in conjunction with the data, charts and other information of the experimental process.

[0128] (1) Genotype identification

[0129] Three genotypes were detected at each SNP locus. Figure 3 These are the CC, CT, and TT genotypes at SNP1 and SNP2, the CC, CG, and GG genotypes at SNP3, the GG, GA, and AA genotypes at SNP4, and the TT, TC, and CC genotypes at SNP5.

[0130] No SNPs were detected in other areas.

[0131] (2) Association analysis between sheep STAT3 genotype and lactation trait

[0132] As shown in Tables 3-4, the genotypes of four loci (SNP1, SNP2, SNP4, and SNP5) have a significant impact on both milk fat percentage and dry matter content, while the genotype of the SNP3 locus only significantly affects milk fat percentage. At SNP1, the milk fat percentage of CC individuals was 0.724% and 1.262% higher than that of CT and TT individuals, respectively, and the dry matter content was 0.924% and 1.584% higher, respectively (P<0.05). At SNP2, the milk fat percentage and dry matter content of CC individuals were 0.828% and 1.041% higher than that of TT individuals, respectively (P<0.05). At SNP3, the milk fat percentage of CC individuals was significantly higher than that of GG individuals by 0.263% (P<0.05). At SNP4, the milk fat percentage of GG individuals was 0.734% and 1.062% higher than that of GA and AA individuals, respectively, and the dry matter content was 0.939% and 1.299% higher, respectively (P<0.05). At SNP5, the milk fat percentage of TT individuals was significantly higher than that of CC individuals by 0.968%, and the dry matter content was 0.756% and 1.194% higher than that of CC and TC individuals, respectively (P<0.05).

[0133] Table 3: Association analysis between STAT3 genotype and lactation traits in sheep

[0134] Table 4: Association analysis between STAT3 genotype and sheep lactation traits

[0135] (3) Effects of sheep STAT3 gene haplotype on sheep lactation traits

[0136] Analysis results from Haploview v4.2 software showed that there was no linkage relationship between SNP4 and the other four SNPs, so no haplotypes of SNP4 with the other SNPs were constructed. SNP1, SNP2, SNP3, and SNP5 were in a state of strong linkage disequilibrium (r0). 2 >0.66), a total of 7 haplotypes with frequencies greater than 1% were constructed, namely H1~H7. A total of 28 haplotype combinations were constructed from the 7 haplotypes, and the 7 haplotype combinations with frequencies greater than 5% are shown in Table 5;

[0137] Table 5: Haplotype Combination Frequencies of STAT3 Gene

[0138] For haplotype combinations with a frequency greater than 5%, their correlation with sheep lactation traits was further analyzed (Table 6). The milk fat percentage and dry matter content of haplotype combination H1H7 were significantly higher than those of H1H1 and H1H3 (P < 0.05), and the ash content of H1H7 was significantly higher than that of H1H1 (P < 0.05). The average daily milk yield of H1H2 was 0.266 kg higher than that of H1H7.

[0139] Table 6: Correlation analysis between STAT3 gene haplotype combinations and sheep lactation traits

[0140] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. Application of reagents for detecting the genotype of the following SNP loci in the identification of milk production traits in sheep; wherein the SNP loci are located on the positive strand of chromosome 11 of the sheep reference genome ARS-UI_Ramb_v3.0 version sequence information. STAT3 The gene has a C / T base mutation at position c.22+537bp. The PARMS genotyping primers for the SNP site are as follows: CCAGAATATCTTTTGGTTGGAAGC, TCCAGATATCTTTTGGTTGGAAGT, CTGAATCAGAGTTGCCAAGTGAAC; the milk production trait is milk fat percentage and / or dry matter content.

2. A method for identifying milk production traits in sheep, characterized in that, The method includes the following steps: The genotype of the SNP locus described in claim 1 was detected in the tested sheep; the genotype of the SNP locus was... CC, CT or TT The PARMS genotyping primers for the SNP sites are as follows: CCAGAATATCTTTTGGTTGGAAGC, TCCAGAATATCTTTTGGTTGGAAGT, CTGAATCAGAGTTGCCAAGTGAAC. The genotype of the SNP locus is CC The tested sheep had a higher milk fat percentage and dry matter content than the genotype at the stated SNP locus. CT and TT The tested sheep; the milk production characteristics are milk fat percentage and / or dry matter content.

3. The application of the method described in claim 2 in the screening of sheep milk production traits or in the breeding of sheep milk production traits, characterized in that, The milk production characteristics are milk fat percentage and / or dry matter content.

4. The application according to claim 3, characterized in that, In the application described, the genotype described in claim 2 is selected as... CC The sheep used in the experiment were intended for milk production or breeding.

Images