Plantarum and application thereof in preparing astragalus membranaceus fermentation liquor with antihypertensive effect

By fermenting Astragalus membranaceus with Lactobacillus plantarum, the content of active ingredients in the fermentation liquid of Astragalus membranaceus was increased and its activity in improving hypertension was improved. This solved the problem of low bioavailability of Astragalus membranaceus and enabled the application of Astragalus membranaceus fermentation liquid in functional foods and drugs.

CN119842519BActive Publication Date: 2026-06-19SOUTH CHINA UNIV OF TECH

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SOUTH CHINA UNIV OF TECH
Filing Date
2024-12-18
Publication Date
2026-06-19

AI Technical Summary

Technical Problem

Existing Astragalus membranaceus drugs have low bioavailability in lowering blood pressure and poor taste, which affects their application. Fermentation of traditional Chinese medicine can enhance the content of active ingredients and improve flavor, but there is a lack of effective probiotic fermentation methods.

Method used

Astragalus membranaceus was fermented using Lactiplantibacillus plantarum WH-P2. Through the biotransformation of macromolecules during fermentation, the content of active ingredients in the fermentation broth was increased, and nutrients were provided for probiotics, thus preparing an Astragalus membranaceus fermentation broth with the activity of improving hypertension.

🎯Benefits of technology

Astragalus fermentation broth is rich in active ingredients and exhibits excellent in vitro antioxidant capacity. It can reduce cellular oxidative stress response, inflammatory factor expression and vasoconstrictor factors, and significantly improve hypertension activity. It is suitable for the development of functional foods and drugs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119842519B_ABST
    Figure CN119842519B_ABST
Patent Text Reader

Abstract

This invention discloses a strain of *Lactiplantibacillus plantarum* and its application in the preparation of *Astragalus membranaceus* fermentation broth with antihypertensive effects. The strain, named *Lactiplantibacillus plantarum* WH-P2, was deposited on November 7, 2024, at the Guangdong Provincial Microbial Culture Collection Center (GDMCC), located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, with accession number GDMCC No: 65436. Experiments revealed that *Lactiplantibacillus plantarum* WH-P2 can be used to ferment *Astragalus membranaceus* extract. The fermented *Astragalus membranaceus* broth exhibits activity in improving hypertension; therefore, it can be used to develop functional products with antihypertensive effects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of microbial fermentation technology, and specifically relates to a strain of *Lactobacillus plantarum* and its application in the preparation of *Astragalus membranaceus* fermentation broth with hypotensive effect. Background Technology

[0002] Hypertension is a major risk factor for cardiovascular and cerebrovascular diseases and a leading cause of premature death worldwide. Statistics show that 7 million people die from hypertension every year, and the number of people with hypertension worldwide is expected to reach 1.56 billion by 2025. Therefore, finding drugs that can prevent, control, and treat cardiovascular diseases is a common desire of international biomedical scientists and patients.

[0003] As people increasingly embrace the theory of food and medicine sharing the same origin, traditional Chinese medicine uses the principles of "prevention of disease" and health preservation to prevent and treat hypertension in terms of diet, health maintenance, and rehabilitation. Modern domestic and international research shows that hypertension can be effectively controlled through dietary rehabilitation methods, which can also effectively reduce the occurrence of complications such as heart, brain, and kidney problems.

[0004] Astragalus is a traditional Chinese medicine that is both food and medicine. It contains polysaccharides, triterpenoid saponins, flavonoids, alkaloids, amino acids, and other major active ingredients, possessing pharmacological effects such as anti-inflammatory, antioxidant, anti-tumor, hypoglycemic, immune-enhancing, and blood pressure-lowering properties. In modern medicine, numerous studies have shown that astragalus has antihypertensive functions, with definite efficacy in clinical and animal experiments, effectively improving hypertension. Clinical trials have shown that astragalus administration can regulate immune responses and lower systolic and diastolic blood pressure. Its antihypertensive mechanism mainly involves inhibiting the renal arterial system (RAAS) and promoting urination, with a stable and relatively safe antihypertensive effect. However, astragalus, like other traditional Chinese medicines, still faces some challenges, such as low oral bioavailability and poor taste, hindering its application. Existing research indicates that probiotic fermentation of traditional Chinese medicine can increase the content of active ingredients, enhance drug efficacy, promote the production of new active ingredients, improve flavor, and reduce the toxic side effects of herbs. Therefore, finding a probiotic that can effectively ferment astragalus to enhance the in vivo bioavailability of astragalus's active substances and improve its activity in improving hypertension is of great significance. Summary of the Invention

[0005] The primary objective of this invention is to overcome the shortcomings and deficiencies of the prior art and to provide a strain of plant lactobacillus.

[0006] Another object of the present invention is to provide the application of the aforementioned *Lactobacillus plantarum*.

[0007] The objective of this invention is achieved through the following technical solution:

[0008] A strain of Lactiplantibacillus plantarum, named Lactiplantibacillus plantarum WH-P2, with accession number GDMCC No:65436, was deposited on November 7, 2024, at the Guangdong Provincial Microbial Culture Collection Center (GDMCC), 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0009] The application of *Lactobacillus plantarum* in the fermentation of *Astragalus membranaceus*.

[0010] A method for preparing Astragalus fermentation broth with antihypertensive activity includes the following steps:

[0011] S1. Dry, pulverize and sieve the raw material of Astragalus membranaceus to obtain Astragalus membranaceus powder; then mix the Astragalus membranaceus powder with water and extract under ultrasonic conditions. After extraction, centrifuge, take the supernatant, sterilize and obtain Astragalus membranaceus extract.

[0012] S2. The above-mentioned *Lactobacillus plantarum* was inoculated into the *Astragalus membranaceus* extract for fermentation culture. After fermentation was completed, the extract was centrifuged and the supernatant was collected to obtain the *Astragalus membranaceus* fermentation broth with the activity of improving hypertension.

[0013] The sieving mentioned in step S1 is sieving through a 60-80 mesh sieve; preferably through an 80 mesh sieve.

[0014] The solid-liquid ratio of Astragalus powder to water in step S1 is 1g:5-20mL; preferably 1g:10mL.

[0015] The ultrasonic conditions described in step S1 are: ultrasonic treatment at 35-45℃ and 40kHz for 1-3 hours; preferably: ultrasonic treatment at 40℃ and 40kHz for 2 hours.

[0016] The centrifugation conditions described in steps S1 and S2 are: 4℃, 10000~15000rpm for 10~20min; preferably: 4℃, 12000rpm for 15min.

[0017] The sterilization conditions described in step S1 are: sterilization at 121°C for 10-20 minutes; preferably: sterilization at 121°C for 15 minutes.

[0018] In step S2, the inoculated *Lactobacillus plantarum* is preferably *Lactobacillus plantarum* seed culture, which can be obtained by culturing *Lactobacillus plantarum* seed culture according to conventional methods in the art; preferably, it is prepared by the following method: inoculating a single colony of *Lactobacillus plantarum* into a culture medium, incubating it statically at 37±1℃ for 16-18h, and then transferring it to a fresh liquid culture medium and culturing it at 37±1℃ for 16-18h to obtain *Lactobacillus plantarum* seed culture.

[0019] The culture medium is preferably MRS culture medium.

[0020] The inoculum size of *Lactobacillus plantarum* in step S2 is 2.0 ± 0.4 × 10⁻⁶. 7 CFU / mL.

[0021] The fermentation conditions described in step S2 are: fermentation at 37±1℃ for 12 to 36 hours; preferably: fermentation at 37℃ for 24 hours.

[0022] An Astragalus fermentation broth with activity in improving hypertension is prepared by any of the methods described above.

[0023] The application of the aforementioned *Lactobacillus plantarum* and / or *Astragalus membranaceus* fermentation broth in the preparation of products for the prevention or treatment of hypertension (antihypertensive products).

[0024] The products mentioned for the prevention or treatment of hypertension include functional foods, health products, or drugs that prevent and treat hypertension, improve hypertension, and inhibit angiotensin-converting enzyme.

[0025] This invention utilizes *Lactobacillus plantarum* to ferment *Astragalus membranaceus*, a traditional Chinese medicine that is both food and medicine. Through the biotransformation of *Astragalus membranaceus* components by *Lactobacillus plantarum*, the macromolecules in the Chinese medicine are decomposed and transformed, precursor substances are gradually generated, heavy metals undergo biointegration, and toxic and harmful substances are modified and detoxified. Ultimately, the content of active ingredients in the fermented Chinese medicine liquid is significantly increased, enhancing its activity in improving hypertension. At the same time, the active ingredients in the *Astragalus membranaceus* extract can provide nutrients for the growth and metabolism of *Lactobacillus plantarum*, promoting its growth, thereby maximizing the effects of the Chinese medicine and probiotics.

[0026] The present invention has the following advantages and effects compared with the prior art:

[0027] 1. The Astragalus fermentation broth of this invention is prepared by fermenting Astragalus extract with Lactobacillus plantarum. Experiments have shown that the fermented broth contains a rich variety of 141 substances, with flavonoids being the most abundant. The Astragalus fermentation broth exhibits superior in vitro antioxidant capacity compared to unfermented Astragalus extract. In the HUVEC endothelial dysfunction model, the Astragalus fermentation broth can increase NO content, reduce cellular oxidative stress response, reduce the expression of inflammatory factors, and reduce the expression of ACE and vasoconstrictor ET-1, thus improving hypertension. It also enriches the nutritional structure of pharmaceutical products and has great application value. It can be used to develop functional foods, health products, or pharmaceuticals with hypertension-improving effects.

[0028] 2. This invention utilizes probiotics to prepare Astragalus fermentation liquid through biological fermentation, evaluates its effect on improving hypertension, broadens the biological efficacy of Astragalus-related products, and further enhances the application value of Astragalus.

[0029] 3. This invention selects Astragalus extract as the fermentation substrate under certain temperature conditions and selects dominant probiotics as the fermentation strain for fermentation. It can be operated by mechanization and automation, which is a significant advantage for realizing industrial-scale production.

[0030] 4. This invention increases the bioavailability of Astragalus membranaceus active substances in vivo and enhances its activity in improving hypertension through probiotic fermentation. At the same time, it provides some ideas and methods for the development and utilization of Astragalus membranaceus and other medicinal and edible herbs, promotes the inheritance, innovation and development of traditional Chinese medicine in the new biotechnology era, and also provides an effective and safe new method for improving hypertension. Attached Figure Description

[0031] Figure 1 This is a colony morphology diagram of the Lactobacillus plantarum WH-P2 strain.

[0032] Figure 2 This is a graph showing the effect of different concentrations of hydrogen peroxide on the viability of HUVEC cells.

[0033] Figure 3 This is a graph showing the effects of different samples on NO content in an endothelial dysfunction model.

[0034] Figure 4 The figures show the effects of different samples on oxidative stress-related indicators in an endothelial dysfunction model; where A represents the effect on ROS content; B represents the effect on SOD content; and C represents the effect on MDA content.

[0035] Figure 5 The graphs show the effects of different samples on inflammatory factor-related indicators in an endothelial dysfunction model. Among them, A shows the effect on IL-6 levels; B shows the effect on TNF-α levels; and C shows the effect on IL-10 levels.

[0036] Figure 6 The figures show the effects of different samples on the expression of ACE, eNOS, and ET-1 mRNA in HUVEC cells; where A represents the effect on ACE mRNA expression, B represents the effect on eNOS mRNA expression, and C represents the effect on ET-1 mRNA expression.

[0037] Figure 7The graphs show the effects of different samples on the expression of IL-6, IL-1β, TNF-α, and IL-10 mRNA in HUVEC cells. Among them, A shows the effect on IL-6 mRNA expression; B shows the effect on IL-1β mRNA expression; C shows the effect on TNF-α mRNA expression; and D shows the effect on IL-10 mRNA expression.

[0038] Figure 8 These are the base peak chromatograms of the system before and after fermentation in positive and negative ion modes; where A is the base peak chromatogram of the Unfermented (unfermented Astragalus extract) group sample in positive ion mode; B is the base peak chromatogram of the Unfermented group sample in negative ion mode; C is the base peak chromatogram of the P2 (fermented by Lactobacillus plantarum) group sample in positive ion mode; and D is the base peak chromatogram of the P2 group sample in negative ion mode.

[0039] Figure 9 These are in vitro antioxidant results for samples of different concentrations; where A represents the DPPH free radical scavenging results; B represents the hydroxyl free radical scavenging results; and C represents the iron ion reducing power measurement results. Detailed Implementation

[0040] The present invention will be further described in detail below with reference to embodiments, but the embodiments of the present invention are not limited thereto. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field. Test methods in the following embodiments that do not specify specific experimental conditions are generally performed under conventional experimental conditions. Unless otherwise specified, the reagents and raw materials used in the present invention are all commercially available.

[0041] Example 1: Isolation, Identification and Preservation of *Lactobacillus plantarum*

[0042] 1g of pickled vegetable samples (purchased from a market in Guangzhou, Guangdong Province), sour soup (from Qiannan Buyi and Miao Autonomous Prefecture, Guizhou Province), fermented vegetable juice (from Tianshui City, Gansu Province), infant feces, and breast milk (collected from healthy infants aged 0-3 months who were exclusively breastfed, had no history of antibiotic or probiotic use, and were obtained from volunteers) were suspended in 9mL of sterile PBS buffer (pH 7.4, containing 0.5g / L L-cysteine ​​hydrochloride), homogenized, and serially diluted. The samples were then spread onto the surface of MRS solid medium containing 2% (w / v) CaCO3 and anaerobically incubated at 37℃ for 36–48h. Single colonies with a clear transparent zone, smooth surface, and round shape were picked, numbered, recorded, and streaked for purification at least three times. During purification, the strains were preliminarily identified and contaminants were removed based on colony morphology, catalase test, and Gram staining microscopy. Finally, the purified single colonies were inoculated into MRS liquid medium and incubated statically at 37°C for 18 hours. The fresh bacterial culture was then mixed with an equal volume of 25% (w / v) glycerol and stored at -80°C for later use. The purified strains were subjected to Gram staining and catalase tests. Gram staining showed Gram-positive bacteria, and catalase was negative. A total of 54 strains were purified. Preliminary screening using an in vitro angiotensin-converting enzyme inhibition assay yielded five strains, numbered F10, F12A, J3, J15, and P2, all identified as *Lactobacillus plantarum*. The colony morphology of strain P2 is as follows: Figure 1 As shown. Its 16S rRNA sequence SEQ ID NO.1 is shown below:

[0043]

[0044] Based on the colony morphology and molecular identification results, the strain was named Lactiplantibacillus plantarum WH-P2 and deposited on November 7, 2024, at the Guangdong Provincial Microbial Culture Collection Center (GDMCC), 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, with accession number GDMCC No:65436.

[0045] Example 2: Preparation of Astragalus Fermentation Broth

[0046] 1. Preparation of Astragalus Extract: Astragalus (purchased from Kangmei Traditional Chinese Medicine City, Haozhou City, Gansu Province) was dried, pulverized, and sieved through an 80-mesh sieve. A certain amount of Astragalus powder was weighed and mixed with water at a solid-liquid ratio of 1:10 (g / ml). The mixture was then ultrasonically treated at 40℃ and 40kHz for 2 hours. After centrifugation at 12000rpm for 15 minutes, the supernatant was collected and sterilized at 121℃ for 15 minutes to obtain the Astragalus extract.

[0047] 2. Preparation of Fermentation Strain Seed Culture: The bacteria isolated and purified in Example 1 (numbered F10, F12A, J3, J15, and P2) were inoculated into fresh MRS liquid medium at a ratio of 1:10 (v / v) and incubated at 37°C for 16–18 hours. After mixing, an appropriate amount of bacterial culture was streaked onto MRS solid medium, sealed, and incubated at 37°C for 48 hours. Single colonies were picked and inoculated into fresh MRS liquid medium. After incubation at 37°C for 16–18 hours, the cultures were mixed and inoculated into fresh MRS liquid medium at a ratio of 1:10 (v / v). After incubation at 37°C for 16–18 hours, the activated fermentation strain seed culture was obtained.

[0048] 3. Preparation of Astragalus fermentation broth: The seed cultures of the fermentation strains (F10, F12A, J3, J15, P2) were inoculated into the Astragalus extract, with an initial colony count of 2 × 10⁻⁶. 7 After static incubation at 37℃ for 24 h at CFU / mL, centrifugation was performed at 12000 rpm for 15 min at 4℃. The supernatant was collected as the Astragalus fermentation broth (F10, F12A, J3, J15, P2). The seed culture of the fermentation strains was replaced with an equal volume of sterile water, while keeping all other conditions unchanged. The resulting supernatant was the unfermented Astragalus extract.

[0049] Example 3: Determination of angiotensin-converting enzyme inhibition rate in vitro

[0050] 1. Experimental Method:

[0051] In this embodiment, the pyridine benzenesulfonyl chloride method was used to determine the in vitro angiotensin-converting enzyme inhibition rate. The Astragalus fermentation broth (F10, F12A, J3, J15, P2) and unfermented Astragalus extract samples prepared in Example 2 were diluted to a final concentration of 2.44 mg / mL in the enzyme reaction system. Three replicates were performed for each group of samples, and the average value was taken. Specific experimental steps are shown in Table 1.

[0052] Table 1. Experimental procedures for in vitro angiotensin-converting enzyme inhibition rate

[0053]

[0054] The inhibition rate of angiotensin-converting enzyme was calculated as follows:

[0055]

[0056] Among them: A a A represents the absorbance when the sample is added. b A represents the absorbance without the addition of sample. c The absorbance of the blank group is shown.

[0057] 2. Experimental Results:

[0058] The inhibitory effects of Astragalus fermentation broth (F10, F12A, J3, J15, P2) and unfermented Astragalus extract on angiotensin-converting enzyme activity are shown in Table 2. The inhibitory effect of Astragalus extract fermented by the strains was superior to that of unfermented Astragalus extract, indicating that fermented Astragalus can more effectively inhibit angiotensin-converting enzyme activity, with strain P2 showing the best effect.

[0059] Table 2. Experimental results of angiotensin-converting enzyme inhibition rate.

[0060] strain Inhibition rate (%) Inhibition rate increased (%) Unfermented 51.48±6.22 / P2 79.63±5.33 28.15 F10 78.31±1.69 26.83 J3 75.98±2.97 24.50 F12A 75.58±1.78 24.10 J15 72.66±4.92 21.18

[0061] Example 4: Changes in colony count before and after fermentation

[0062] 1. Experimental Method:

[0063] This embodiment utilizes the glass bead coating method for colony counting. First, the seed culture of the fermentation strains prepared in Example 2 (F10, F12A, J3, J15, P2) and Astragalus extract were mixed thoroughly (after fermentation, bacteria will settle at the bottom; shake to mix before counting to ensure uniform bacterial distribution). Then, sterile physiological saline was added at a 1:10 ratio. 6 Dilute the solution proportionally, take 100 μL of the diluted solution and spread it onto MRS solid culture medium with glass beads. Incubate at 37℃ for 48 h and then count the colonies to investigate the changes in colony count.

[0064] 2. Experimental Results:

[0065] The results are shown in Table 3. The number of colonies after fermentation was significantly higher than that after initial inoculation, indicating that the dietary fiber, polysaccharides, phenolic compounds and amino acids in Astragalus extract can provide nutrients for the strain and maintain its normal growth and metabolism.

[0066] Table 3 Changes in colony count after fermentation

[0067]

[0068] Example 5: Construction of the HUVEC Endothelial Dysfunction Model

[0069] 1. Experimental Methods:

[0070] HUVEC cells were purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences. The growth medium used contained: basal DMEM medium, 10% (v / v) fetal bovine serum (FBS), and 1% penicillin and streptomycin solution. HUVEC cells were seeded at 7000 cells / well in 96-well plates and cultured in a cell culture incubator (37℃, 5% CO2). After the cells reached 70% confluence, each well was washed with PBS buffer and the medium was replaced with serum-free DMEM medium. The cells were cultured for another 12 hours, followed by washing with PBS and adding 100 μL of inducing agent (hydrogen peroxide solution diluted in serum-free DMEM medium at concentrations of 100, 300, 500, 700, 900, and 1000 μM) for 1 hour to complete the model. The control group was culturing for the same amount of time with the same volume of serum-free DMEM medium instead of the inducing agent. After modeling, the culture medium was discarded, and the cells were washed three times with PBS. Then, 100 μL of CCK-8 reagent, pre-diluted 10-fold with fresh serum-free DMEM medium, was added. After shaking thoroughly for 10 seconds, the cells were incubated at 37°C for 45 minutes. Finally, the absorbance of each well was read at 450 nm using a microplate reader to calculate cell viability. The hydrogen peroxide concentration at which 50% viability was achieved was selected as the optimal treatment concentration. The experiment was performed in triplicate.

[0071] 2. Experimental Results

[0072] The results are as follows Figure 2 As shown, the survival rate of HUVEC cells decreased with increasing hydrogen peroxide concentration. When treated with 900 μM hydrogen peroxide, the cell survival rate decreased to 49.80% ± 2.59%, which was significantly different from the normal group. Therefore, 900 μM was selected as the optimal treatment concentration for constructing the HUVEC endothelial dysfunction model.

[0073] Example 6: Determination of NO content in an endothelial dysfunction model

[0074] 1. Experimental Methods:

[0075] 1.1 NO detection was performed using a DAF-FM DA probe.

[0076] 1.1.1 Experimental groups were first divided into: Blank control group (Conrtrol): without any intervention factors; Experimental group: treated with 1 mg / mL of Astragalus sample (Astragalus fermentation broth F10, F12A, J3, J15, P2, and unfermented Astragalus extract prepared in Example 2) for 12 h, followed by treatment with 700 μM hydrogen peroxide for 1 h; Model group: incubated with serum-free DMEM medium for 12 h, followed by treatment with 700 μM hydrogen peroxide for 1 h; Positive control group (Captopril): treated with 2 mg / L captopril for 12 h, followed by treatment with 900 μM hydrogen peroxide for 1 h.

[0077] 1.1.2 HUVEC cells were loaded at a rate of 2 × 10⁻⁶. 5 1 mL of cells were seeded per well in 6-well plates and incubated at 37°C in a CO2 incubator. When the cells reached approximately 70% confluence with the bottom of the wells, they were treated according to the grouping procedure described in 1.1.1 above. After treatment with hydrogen peroxide for 1 hour, the culture medium was discarded, and the cells were washed twice with PBS. Cells were then collected by trypsin digestion with phenol red-free medium. The DAF-FM DA probe was diluted 1:1000 (v / v) with serum- and phenol red-free medium to a final concentration of 5 μM. The cells were resuspended in the prepared probe to a cell density of 1 × 10⁶ cells / well. 6 ~2×10 7 The cells were incubated at 37°C in the dark for 20 min at a density of [number] cells / mL. The cells were washed three times with PBS to thoroughly remove any probes that had not entered the cells. The cells were resuspended in PBS and analyzed using a fluorescence microplate reader. Simultaneously, a portion of the cells was lysed to determine protein concentration. The experiment was performed in triplicate.

[0078] 2. Experimental Results:

[0079] NO is an important endothelial signaling molecule produced by endothelial cells, which regulates vasomotor activity and is closely related to the development of hypertension. According to... Figure 3 The results showed that, compared with the normal control group, the NO secretion of cells in the model group was significantly reduced (p<0.001). The P2 group and the Unfermented group significantly increased NO release, and there was a significant difference between P2 and Unfermented, indicating that Astragalus fermented via P2 can more significantly stimulate endothelial cells to release NO.

[0080] Example 7: Determination of oxidative stress-related indicators in an endothelial dysfunction model

[0081] 1. Determination of ROS content:

[0082] 1.1 Experimental Methods:

[0083] NO was detected using the H2DCFDA probe. Experimental groups and HUVEC cell treatment were performed according to the procedures in Example 6, and digested cells were collected. H2DCFDA was then diluted with serum-free culture medium at a ratio of 1:1000 (v / v) to a final concentration of 10 μM. The diluted H2DCFDA probe was then added to the HUVEC cells to achieve a cell density of 1 × 10⁻⁶ cells / cells. 6 ~2×10 7 Incubate at 37°C for 30 min in the dark using a microplate reader at a concentration of [value missing]. Wash cells 1-2 times with serum-free cell culture medium to thoroughly remove any uninfiltrated H2DCFDA. Detect using a fluorescent microplate reader. Simultaneously, lyse a portion of cells and determine protein concentration. Perform the experiment in triplicate.

[0084] 1.2 Experimental Results:

[0085] according to Figure 4 As shown in Figure A, the ROS content in the model group was 150.77% ± 15.45% of that in the normal control group (p < 0.001). Except for F12A, which did not significantly reduce ROS production in the endothelial dysfunction model (p > 0.05), all other drug-treated groups significantly reduced ROS content (p < 0.05). Compared to the Unfermented group (131.70% ± 10.00%), the ROS contents of J15 and P2 were 118.96% ± 5.64 and 116.96% ± 10.16 (p < 0.05), respectively, and the ROS content of J3 was 115.15% ± 2.94 (p < 0.01). This indicates that most Astragalus fermentation broths could reduce hydrogen peroxide-induced intracellular ROS levels, thereby alleviating damage caused by oxidative stress, and the effects of J15, P2, and J3 were superior to those of the Unfermented group.

[0086] 2. Determination of SOD activity and MDA content

[0087] 2.1 Experimental Methods:

[0088] HUVEC cells were loaded at a rate of 2 × 10 5Cells were seeded at 1 mL per well in 6-well plates and incubated at 37°C in a CO2 incubator. When the cells reached approximately 70% confluence with the bottom of the wells, experimental grouping and HUVEC cell treatment were performed as described in Example 6, and the digested cells were collected. Cells were then lysed using lysis buffer. After complete lysis, the cells were centrifuged (10,000 rpm, 10 min, 4°C), and the supernatant was collected for subsequent assays. The protein content of the supernatant was determined using a BCA protein concentration assay kit, and the levels of MDA (malondialdehyde) and SOD (superoxide dismutase) in the cell culture medium and lysis buffer were also determined according to the kit. The experiment was performed in triplicate.

[0089] 2.2 Experimental Results:

[0090] The results are as follows Figure 4 B and Figure 4 As shown in Figure C, compared with the normal control group, the model group showed a significant decrease in SOD activity (p<0.0001) and a significant increase in MDA content (p<0.01), indicating that hydrogen peroxide treatment significantly reduced intracellular SOD activity and significantly increased MDA content in HUVEC cells. Compared with the model group, except for groups F12A and J3 which did not significantly increase SOD activity, all other groups significantly increased SOD activity, while all treatment groups significantly reduced MDA content (p>0.05). Compared with the Unfermented group, J15 significantly increased intracellular SOD activity, while J3, J15, and P2 significantly reduced MDA content, indicating that fermented Astragalus membranaceus was more effective in alleviating oxidative damage to HUVEC cells caused by hydrogen peroxide treatment.

[0091] By combining the effects of different Astragalus extracts on NO content in an endothelial dysfunction model and on oxidative stress indicators including ROS content, SOD activity, and MDA content, it was found that P2 had a better effect than other fermentation groups. Therefore, P2 was retained for subsequent experiments.

[0092] Example 8: Determination of inflammatory factor-related indices in an endothelial dysfunction model

[0093] 1. Experimental Methods:

[0094] The Astragalus fermentation broth P2 prepared in Example 2 was used for experimental grouping and HUVEC cell treatment according to the experimental procedures in Example 6. The cell culture medium was collected and centrifuged at 1000×g for 10 min at 4℃. The supernatant was collected and used to determine the contents of IL-6, TNF-α and IL-10 in the cell culture supernatant according to the kit (purchased from Xinbosheng Biotechnology Co., Ltd.).

[0095] 2. Experimental Results:

[0096] The results are as follows Figure 5 As shown, the levels of IL-6 and TNF-α in the model group were significantly increased compared to the normal control group, while the level of IL-10 was significantly decreased (p<0.05). This indicates that hydrogen peroxide treatment significantly increases the production of pro-inflammatory factors such as IL-6 and TNF-α and significantly reduces the level of anti-inflammatory factors such as IL-10 in HUVEC cells. Compared to the model group, all treatment groups significantly reduced the levels of IL-6 and TNF-α and significantly increased the level of IL-10. Compared with Unfermented, P2 was significantly better than Unfermented in reducing the levels of IL-6 and TNF-α (p<0.01, p<0.05), while there was no significant difference in the effect on increasing the level of IL-10 (p<0.05). This indicates that the fermented Astragalus extract is more effective than the unfermented extract in reducing the production of pro-inflammatory factors in the endothelial dysfunction model.

[0097] Example 9: Determination of mRNA expression levels of HUVEC cells-related genes

[0098] 1. Experimental Methods

[0099] The assay was performed using quantitative real-time PCR. HUVEC cells were sputtered at a rate of 2 × 10⁻⁶. 5 Cells were seeded per well in 6-well plates, 1 mL per well, and incubated in a 37°C CO2 incubator. When the cells reached approximately 70% confluence with the bottom of the wells, experimental grouping and HUVEC cell treatment were performed as described in Example 6, and the digested cells were collected. The culture medium was thoroughly aspirated from the cells, and total RNA was extracted according to the RNA extraction kit instructions. cDNA was then reverse transcribed, and quantitative reactions were performed according to the instructions. The mRNA expression level was calculated based on the Ct value of qPCR, using the expression level of the internal control gene GADPH as a reference. -△△Ct The relative expression level of the target gene mRNA was calculated using a method with three replicates per group, and the average value was taken. The primer sequences used are shown in Table 5.

[0100] Table 4 PCR Primer Sequences

[0101] Forward Primer (5′-3′) Reverse Primer (5'-3') GAPDH GGAAGCTTGTCATCAATGGAAATC TGATGACCCTTTTGGCTCCC ACE CAGGATCATCGGAGCTGTGC TAGCAGGGCGTTGTACTGC eNOS GACGCTACGAGGAGTGGAAG CCTGTATGCCAGCACAGCTA ET-1 TTGAGATCTGAGGAACCCGC GCTCAGCGCCTAAGACTGTT IL-6 CATCCTCGACGGCATCTCAG TCACCAGGCAAGTCTCCTCA IL-1β TTCGAGGCACAAGGCACAA TGGCTGCTTCAGACACTTGAG TNF-α CACTTTGGAGTGATCGGCCC CAGCTTGAGGGTTTGCTACAAC IL-10 GGCACCCAGTCTGAGAACAG GGCAACCCAGGTAACCCTTA

[0102] 2. Experimental Results

[0103] 2.1 Expression of ACE, eNOS, and ET-1 mRNA

[0104] Angiotensin-converting enzyme (ACE) plays a crucial role in the development of hypertension, converting angiotensin I to angiotensin II, which causes strong vasoconstriction. Endothelial nitric oxide synthase (eNOS) catalyzes the synthesis of NO from L-arginine in endothelial cells. ET-1 is a vasoconstrictor that can induce endothelial dysfunction and atherosclerosis, leading to hypertension. By measuring the mRNA transcription levels of ACE, eNOS, and ET-1 in HUVEC cells, the effects of Astragalus membranaceus fermentation broth on the synthesis of ACE, NO, and ET-1 can be investigated.

[0105] according to Figure 6 It was found that the transcriptional levels of ACE and ET-1 mRNA were significantly increased, while the transcriptional level of eNOS mRNA was significantly decreased in the model group. This suggests that hydrogen peroxide treatment may reduce NO production by downregulating eNOS expression and increase ACE and ET-1 secretion by upregulating ACE and ET-1 expression, thereby leading to elevated blood pressure. Figure 6 Compared to the model group P2, the expression level of ACE mRNA in cells A was significantly decreased, while there was no significant difference in the Unfermented group. According to... Figure 6 B indicates that the eNOS mRNA expression level was significantly increased in Unfermented and P2 group cells. According to... Figure 6 In the C group, the expression levels of ET-1 mRNA in the Unfermented group and the P2 group were significantly decreased. The results showed that compared with the Unfermented group, the expression levels of ACE mRNA and ET-1 mRNA in the P2 group were significantly decreased, while the expression level of eNOS mRNA was significantly increased. These results suggest that P2 may improve hypertension by upregulating eNOS mRNA expression, promoting NO synthesis, and downregulating the expression of ACE mRNA and ET-1 mRNA, thereby reducing the synthesis and secretion of ACE and ET-1. Furthermore, the effect after fermentation is superior to that after non-fermentation.

[0106] 2.2 Expression of IL-6, IL-1β, TNF-α, and IL-10 mRNA

[0107] Inflammation is closely related to elevated blood pressure. By measuring the expression levels of IL-6 mRNA, IL-1β mRNA, TNF-α mRNA, and IL-10 in HUVEC cells, the effects of Astragalus fermentation broth on the synthesis of IL-6, IL-1β, TNF-α, and IL-10 can be understood.

[0108] according to Figure 7It was found that, compared with the blank control group, the transcriptional levels of IL-6 mRNA, IL-1β mRNA, and TNF-α mRNA in the model group were significantly increased, while the transcriptional level of IL-10 mRNA was significantly decreased. This indicates that after hydrogen peroxide treatment, the secretion of IL-6, IL-1β, and TNF-α can be increased by upregulating the expression of IL-6 mRNA, IL-1β mRNA, and TNF-α mRNA, while the expression of IL-10 mRNA is downregulated, thereby reducing the production of IL-10 and leading to vascular inflammation. Figure 7 A, Figure 7 B and Figure 7 As shown in C, compared with the model group, there was no significant difference in IL-1β mRNA expression in the Unfermented group, while IL-6 mRNA and TNF-α mRNA expression levels were significantly decreased. In contrast, the expression levels of IL-6 mRNA, IL-1β mRNA, and TNF-α mRNA were all significantly decreased in the P2 group. Based on... Figure 7 As shown in Figure D, compared with the model group, the expression level of IL-10 mRNA in cells of the Unfermented group and P2 group was significantly increased. Compared with the Unfermented group, the expression levels of IL-6 mRNA, IL-1β mRNA, and TNF-α mRNA in cells of the P2 group were significantly decreased, while the expression level of IL-10 mRNA was significantly increased. These results suggest that the Unfermented and P2 groups may reduce the synthesis and secretion of IL-6, IL-1β, and TNF-α by downregulating the expression of IL-6 mRNA, IL-1β mRNA, and TNF-α mRNA, and upregulate the expression of IL-10 mRNA to promote the synthesis and secretion of IL-10, thereby alleviating vascular inflammation and exerting its activity in improving hypertension. Furthermore, the fermented Astragalus membranaceus showed better effects than the unfermented Astragalus membranaceus.

[0109] Example 10: Component Analysis of Fermented and Unfermented Astragalus Extracts

[0110] 1. Experimental Method:

[0111] Liquid chromatography-mass spectrometry (LC-MS) was used to analyze the Astragalus fermentation broth (P2) and unfermented Astragalus extract samples prepared in Example 2. 500 μL of each sample was centrifuged at 13000 rpm for 10 minutes, and the supernatant was collected for analysis.

[0112] The analysis was performed using an UltiMate 3000U HPLC system with a Thremo Hypersil gold C18 column (1.9 μm, 2.1 mm × 100 mm). The flow rate was 0.3 mL / min and the injection volume was 10 μL. The mobile phase consisted of 0.1% (v / v) formic acid / acetonitrile (B) and 0.1% (v / v) formic acid / water (A), with a gradient elution program shown in Table 4. The mass spectrometer was a Q-Exactive (Thermo Fisher Scientific, CA, USA) HESI source with an ion source temperature of 310 °C, a capillary temperature of 320 °C, a sheath gas flow rate of 30 units, an auxiliary gas flow rate of 10 units, a spray voltage of 3 kV in positive ion mode, and a spray voltage of 2.8 kV in negative ion mode.

[0113] Data-dependent scan analysis (DDA) was used, with a loopcount set to 10. HCD energies were step-wise normalized collision energies set to 10, 28, and 35 eV. The primary mass spectrometry scan range was 100–1500 m / z, with a resolution of 70,000, an AGC target of 3E6, and an injection time of 200 ms. The secondary mass spectrometry resolution was set to 17,500, the AGC target to 1E5, and the injection time to 50 ms.

[0114] Table 5. Mobile Phase Gradient Elution Program

[0115] Time (min) A(%) B(%) 0 90 10 1 90 10 15 0 100 17 0 100 17.1 90 10 20 90 10

[0116] 2. Experimental Results:

[0117] Base peak chromatograms of different samples in positive and negative ion modes are as follows Figure 8 As shown in the figure, analysis revealed 138 chemical components in the Unfermented sample and 141 chemical components in the P2 sample, totaling 125 components. Relative quantification of each compound was performed based on peak area percentage. The P2 sample showed an increase in the relative content of 72 components compared to the Unfermented sample, as shown in Table 6. Among these, isoflavones and pterostilbene have been reported to have antihypertensive activity. In other words, this Astragalus fermentation broth (P2) possesses certain antihypertensive activity.

[0118] Table 6. Components with relatively increased content

[0119]

[0120]

[0121] Example 11: Determination of in vitro antioxidant activity of fermented and unfermented Astragalus extracts

[0122] I. Determination of DPPH free radical scavenging ability:

[0123] 1.1 Experimental Methods:

[0124] Sample solutions were prepared in advance by diluting the Astragalus fermentation broth (P2) and unfermented Astragalus extract (Unfermented) prepared in Example 2 with water to a series of concentrations. Simultaneously, a series of vitamin C aqueous solutions (positive standards, used as references) were prepared for later use. A 0.2 mmol / L dibenzopicrylamide radical (DPPH) solution was prepared with anhydrous ethanol and stored in the dark. 100 μL of sample solutions of different concentrations were mixed with 100 μL of DPPH solution, and the mixture was allowed to stand at room temperature in the dark for 30 min. The absorbance (A) was measured at 517 nm. i ); Mix 100 μL of sample solutions of different concentrations with 100 μL of anhydrous ethanol solution, let stand at room temperature in the dark for 30 min, and measure the absorbance (A) at 517 nm. j Mix 100 μL of anhydrous ethanol solution with 100 μL of DPPH solution, let stand at room temperature in the dark for 30 min, and measure the absorbance (A0) at 517 nm. The scavenging rate of the sample for DPPH free radicals is calculated according to the following formula. Each group of samples has 3 replicates, and the average value is taken.

[0125]

[0126] 1.2 Experimental Results:

[0127] The results are as follows Figure 9 As shown in Figure A, the scavenging effect of both Unfermented and P2 on DPPH free radicals increased with increasing concentration. It can be found that the scavenging effect of fermented Astragalus on DPPH free radicals is better than that of unfermented Astragalus.

[0128] II. Determination of Hydroxyl Radical Scavenging Capacity

[0129] 2.1 Experimental Methods:

[0130] Sample solutions were prepared in advance by diluting the Astragalus fermentation broth (P2) and unfermented Astragalus extract (Unfermented) prepared in Example 2 with water to a series of concentrations, and simultaneously preparing a series of vitamin C aqueous solutions. 1.0 mL of the sample solution or vitamin C aqueous solution was mixed with 1.0 mL of 8.8 mmol hydrogen peroxide aqueous solution, 1.0 mL of 9 mmol ferrous sulfate aqueous solution, and 1.0 mL of 9 mmol / L salicylic acid-ethanol solution. The reaction solution was incubated at 37°C for 30 min. Distilled water was used as a control, and the absorbance of the reaction solution was measured at 510 nm, with vitamin C as a positive control. The absorbance of the sample reaction solution at different concentrations was measured at 510 nm and recorded as A1; the absorbance of the control reaction solution using distilled water instead of the sample solution was measured at 510 nm and recorded as A0. Each group of samples was tested in triplicate, and the average value was taken. The formula for calculating the scavenging ability of the sample against hydroxyl radicals is as follows:

[0131]

[0132] 2.2 Experimental Results:

[0133] The results are as follows Figure 9 As shown in B, the scavenging effect of both Unfermented and P2 on hydroxyl radicals increases with increasing concentration, and P2 has a better scavenging effect on hydroxyl radicals than Unfermented, indicating that fermented Astragalus membranaceus has a better scavenging effect on hydroxyl radicals than unfermented Astragalus membranaceus.

[0134] III. Determination of Iron Ion Reducing Power

[0135] 3.1 Experimental Methods:

[0136] The FRAP working solution was prepared by mixing 10 mM TPTZ solution dissolved in 40 mM HCl solution, 20 mM FeCl3 solution, and 0.3 M acetate buffer (pH 3.6) in a volume ratio of 1:1:10, and then stored at 37°C for later use. 50 μL of fermentation samples of different concentrations (prepared as described in 1.1 above) were added to 150 μL of FRAP solution and incubated at 37°C for 15 min. The absorbance was measured at 593 nm. Each group of samples was tested in triplicate, and the average value was taken. The reducing power of the samples was compared by absorbance; a higher absorbance value indicated a stronger reducing power.

[0137] 3.2 Experimental Results:

[0138] The results are as follows Figure 9As shown in C, the iron ion reducing capacity of both Unfermented and P2 increases with increasing concentration, and the iron ion reducing capacity of P2 is better than that of Unfermented, indicating that the iron ion reducing capacity of fermented Astragalus membranaceus is better than that of unfermented Astragalus membranaceus.

[0139] Based on the above experimental results, fermented Astragalus membranaceus showed better performance than unfermented Astragalus membranaceus in terms of DPPH free radical scavenging capacity, hydroxyl free radical scavenging capacity, and iron ion reducing capacity, indicating that fermentation can enhance the in vitro antioxidant activity of Astragalus membranaceus.

[0140] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A strain of *Lactobacillus plantarum*, characterized by: Lactobacillus plantarum (Lactobacillus plantarum) Lactiplantibacillus plantarum ) WH-P2, with the preservation number of GDMCC No: 65436, which has been preserved in the Guangdong Microbial Culture Collection Center, 5th Floor, No. 59 Building, Guangzhou Xianlie Middle Road 100 Courtyard, on November 7, 2024.

2. The application of *Lactobacillus plantarum* as described in claim 1 in the fermentation of *Astragalus membranaceus*.

3. A method for preparing a fermented liquor of Astragalus membranaceus with improved hypertension activity, characterized in that, Includes the following steps: S1. Dry, pulverize and sieve the raw material of Astragalus membranaceus to obtain Astragalus membranaceus powder; then mix the Astragalus membranaceus powder with water and extract under ultrasonic conditions. After extraction, centrifuge, take the supernatant, sterilize and obtain Astragalus membranaceus extract. S2. The *Lactobacillus plantarum* as described in claim 1 is inoculated into the *Astragalus membranaceus* extract for fermentation culture. After fermentation is completed, the extract is centrifuged, and the supernatant is collected to obtain the *Astragalus membranaceus* fermentation broth with the activity of improving hypertension.

4. The method according to claim 3, characterized in that: The solid-liquid ratio of Astragalus powder to water in step S1 is 1 g: 5-20 mL; The inoculation amount of the Lactobacillus plantarum described in step S2 is 2.0 ± 0.4 x 10 7 CFU / mL.

5. The method according to claim 3, characterized in that: The ultrasonic conditions described in step S1 are: ultrasonic treatment at 35-45℃ and 40 kHz for 1-3 hours. The fermentation conditions described in step S2 are: fermentation at 37±1℃ for 12 to 36 hours.

6. The method according to claim 3, characterized in that: In step S2, the inoculated *Lactobacillus plantarum* is a seed culture of *Lactobacillus plantarum*, which is prepared by the following method: a single colony of *Lactobacillus plantarum* is inoculated into a culture medium and incubated statically at 37±1℃ for 16-18 h, and then transferred to a fresh liquid culture medium and incubated at 37±1℃ for 16-18 h to obtain the seed culture of *Lactobacillus plantarum*. The culture medium is MRS medium.

7. The method according to claim 3, characterized in that: The sieving mentioned in step S1 refers to passing through a 60-80 mesh sieve; The centrifugation conditions described in steps S1 and S2 are: 4℃, 10000~15000 rpm for 10~20 min; The sterilization conditions described in step S1 are: sterilization at 121℃ for 10–20 min.

8. A fermented Astragalus membranaceus broth with activity in improving hypertension, characterized in that: It is prepared by the method described in any one of claims 3 to 7.