Grape drought sensitive gene VvPUB24 as well as amino acid sequence and application thereof

Abstract

The invention discloses a seedless white grape drought-sensitive gene VvPUB24 as well as an amino acid sequence and application thereof, and belongs to the technical field of molecular biology and biology. According to the grape drought sensitive gene VvPUB24 as well as the amino acid sequence and application thereof, the drought resistance of plants can be reduced by overexpressing the VvPUB24 gene, so that drought-resistant grape varieties can be cultivated by silencing or editing the VvPUB24 gene in the future, and the grape drought sensitive gene VvPUB24 has important significance in improving the drought resistance of grapes.

Description

Technical Field

[0001] The present invention relates to the technical field of biotechnology, and in particular to a grape drought-sensitive gene VvPUB24 and its amino acid sequence and application. Background Art

[0002] Grape (Vitis vinifera L.) is one of the most important fruit crops in the world. It has a unique flavor and is rich in nutrients. It also contains a special functional ingredient, resveratrol, which has special effects in preventing cardiovascular diseases and anti-oxidation and anti-tumor. It is increasingly favored by consumers.

[0003] Drought is one of the main adverse stress factors affecting the growth and development of grapes. Although grapes are drought-resistant fruit trees, mild and moderate water stress is beneficial to the synthesis and accumulation of anthocyanins and flavor substances in grape fruits. However, long-term water shortage and drought will cause the plant growth to slow down and photosynthesis will be inhibited, seriously affecting the yield and quality of the fruit.

[0004] In addition to taking drought-resistant technical measures such as water-saving irrigation, spraying anti-transpiration agents, and covering the soil surface (planting grass, covering straw, and mulching), cultivating drought-resistant grape varieties is the fundamental way to solve production problems. However, the drought resistance mechanism of grapes is complex, and it is difficult to cultivate drought-resistant grape varieties using traditional breeding methods. Using modern molecular biological technology to discover and use drought-related genes to improve the drought resistance of grapes is an effective way. Summary of the invention

[0005] The purpose of the present invention is to provide a grape drought-sensitive gene VvPUB24 and its amino acid sequence and application, which solves the problem of drought resistance of grape planting in the prior art.

[0006] To achieve the above object, the present invention provides the following technical solutions: A grape drought-sensitive gene VvPUB24, the gene coding region sequence of which is shown in SEQ ID NO:1.

[0007] On the basis of the above technical solution, the present invention also provides the following optional technical solution: In an alternative embodiment: its amino acid sequence is shown in SEQ ID NO:2.

[0008] The above grape drought-sensitive gene is used to improve the resistance of grapes to drought stress.

[0009] Compared with the prior art, the present invention has the following beneficial effects: 1. The present invention proves that the VvPUB24 gene negatively regulates plant drought resistance. In the future, drought-resistant grape varieties can be cultivated by silencing or editing the VvPUB24 gene, thereby increasing grape yield. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] Figure 1 This is the CDS clone of the 'seedless white' grape VvPUB24 gene of the present invention {lanes 1 and 2: VvPUB24 gene; lane 3: DL5000 standard molecular weight}.

[0011] Figure 2 This is the construction of the VvPUB24 gene expression vector of the present invention {DNA standard molecular weight; lanes 2-13: bacterial liquid PCR detection of the expression vector construction results, wherein lanes 2-4, 6, 7, 10, 11, and 13 are successfully constructed}.

[0012] Figure 3 The invention provides resistance screening for the transgenic Arabidopsis plants.

[0013] Figure 4 This is the PCR detection of the transgenic Arabidopsis plants of the present invention {lane 1: DNA standard molecular weight; lanes 2-13: 12 T1 generation transgenic Arabidopsis resistant seedlings; lane 14: WT, lane 15: blank control (water); lane 16: positive control}.

[0014] Figure 5 The phenotypes of the transgenic Arabidopsis plants before and after drought treatment of the present invention are shown. DETAILED DESCRIPTION

[0015] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention. Example 1

[0016] Cloning of the Grape Drought-Sensitive Gene VvPUB24 Total RNA was extracted from the leaves of 'seedless white' grapes using a plant RNA extraction kit (OMEGA). The quality of RNA was tested by UV spectrophotometer. RNA with good test results was selected and reverse transcribed into cDNA according to the instructions of the reverse transcription kit (Tiangen). After diluting to a mass concentration of 100 ng / μL, it was used as a template for gene cloning. Primers (VvPUB24-F and VvPUB24-R) were designed based on the sequence of the PUB24 gene of 'Pinot Noir' grapes. Using the cDNA of the leaves of 'seedless white' grapes as a template, the open reading frame of the VvPUB24 gene was amplified by homologous cloning and sent to Shanghai Sangon Biotech Co., Ltd. for sequencing.

[0017] VvPUB24-F:ATGGCTGTGTGGAGTTCAATGGATGA VvPUB24-R:TTACCTAGCGTACCTTGTTAAAAGATAAACAG; VvPUB24 gene coding region sequence: shown in SEQ ID NO: 1; VvPUB24 amino acid sequence: SEQ ID NO: 2 2. Construction of VvPUB24 gene overexpression vector and genetic transformation Construction of overexpression vector The cloned grape drought-sensitive gene VvPUB24 was connected to the pCAMBIA2300 linearized vector by homologous recombination to construct a plant expression vector named pCAMBIA2300-VvPUB24 ( Figure 2 ), the specific operations are as follows: First, the linearized vector was obtained by double enzyme digestion (KpnI and BamHI) (Three Lions) method, and then the linearized vector was obtained by agarose gel electrophoresis detection and gel recovery kit (OMEGA). After checking the concentration and purity of the recovered product with a nucleic acid protein analyzer, the next step of the experiment was carried out.

[0018] The target fragment DNA and the linearized vector were added to a 0.2 mL centrifuge tube at a molar ratio of 3:1, mixed well, and then the recombination reaction was carried out in a PCR instrument at 37°C for 30 min.

[0019] Add 10 μL of the reaction solution to 30 μL of Top10 competent cells, mix gently with a pipette, incubate on ice for 30 minutes, heat shock in a 42°C water bath for 90 seconds, and quickly cool on ice for 5 minutes. Add 200 μL of LB liquid culture medium to the clean bench, incubate at 37°C for 60 minutes, and gently spread on the LB solid culture medium containing Kan resistance with a sterile coating rod, and invert and culture in a 37°C incubator for 14-16 hours.

[0020] Single clones on the transformation plate were picked and placed in 10 μL sterile water. After mixing, 1 μL was taken for PCR identification. The detection primers used were 35S and SeqYFPR. The positive bacterial solution was added to liquid LB medium containing Kan antibiotics and cultured in an incubator at 37°C and 200 rpm overnight. The plasmid was extracted and sent to the company (Shanghai Sangon Biotechnology Co., Ltd.) for sequencing.

[0021] 35S: ATCCTTCGCAAGACCCTTCCTCTAT SeqYFPR: CAGGGTCAGCTTGCCGTAG.

[0022] Transformation of Agrobacterium with overexpression vector The pCAMBIA2300-VvPUB24 vector prepared above was transformed into Agrobacterium tumefaciens GV3101, and the specific operation was as follows: Add 1 μg of plasmid DNA to 50 μL GV3101 Agrobacterium competent cells, gently pipette the bottom of the tube to mix, let stand on ice for 30 min, quick freeze in liquid nitrogen for 1 min, and bath in 37°C water for 5 min.

[0023] Add 400 μL of antibiotic-free LB liquid culture medium to the clean bench, shake and culture at 28°C for 1.5 h, evenly spread on LB solid culture medium containing Kan, Rif and Gent, invert and culture in a 28°C incubator for 2 days, pick positive clones and verify by colony PCR.

[0024] Planting and cultivation of Arabidopsis thaliana (1) Take a certain amount of nutrient soil, add water and mix it, sterilize it with high temperature and high pressure, and then put it into the culture pot.

[0025] (2) Take out the wild-type Arabidopsis seeds that have been vernalized in a 4°C refrigerator and sow them evenly on the surface of the nutrient soil. Cover with plastic wrap to maintain humidity. After most seeds germinate, remove the plastic wrap.

[0026] (3) After one week, water the plants every three days or so.

[0027] (4) After the Arabidopsis thaliana has grown two true leaves, select the Arabidopsis thaliana with better growth for individual transplanting and cover with film to keep moisture for one day.

[0028] (5) After Arabidopsis thaliana shoots and flowers, cut off the main inflorescence to promote the growth of axillary inflorescences.

[0029] Arabidopsis thaliana transformation by inflorescence dip method (1) Take out the Agrobacterium culture medium containing the recombinant plasmid and inoculate it into 5 mL of LB liquid culture medium containing antibiotics at a ratio of 1:100. Activate it at 28°C and 200 rpm for 1 to 2 days.

[0030] (2) Inoculate the activated Agrobacterium culture medium into 250 mL of LB liquid culture medium containing antibiotics at a ratio of 1:50 and culture overnight at 28°C and 200 rpm.

[0031] (3) Centrifuge at 5000 rpm for 10 min, discard the culture medium, resuspend the bacteria in 500 mL of 5% sucrose solution, add 100 μL of surfactant, mix well and set aside for transformation solution.

[0032] (4) Immerse the inflorescence in the transformation solution and shake it gently. Remove the inflorescence after 1 min of immersion. Shake off the excess transformation solution on the plant. Wrap the plant with plastic wrap and place it on its side in a tray. Culture it in the dark for 24 h. Remove the plastic wrap and place it upright for culture. Transform it a second time after about 7 days.

[0033] (5) Continue to cultivate Arabidopsis thaliana in the culture room, collect all mature seeds, dry them and store them in a refrigerator at 4°C; Screening and identification of transgenic plants Resistance screening ① Take a small amount of harvested transgenic Arabidopsis seeds into a 1.5 mL centrifuge tube, add 1 mL of distilled water, and soak for 5 minutes to collect the seeds.

[0034] ② Add 1 mL of 75% ethanol, shake and wash for 30 s, and collect the seeds.

[0035] ③ Add 1 mL of sterile water, shake and wash for 2 min, repeat twice, and collect the seeds.

[0036] ④ Add 1 mL of 2% 84 disinfectant, disinfect the seeds for 10 min, and collect the seeds.

[0037] ⑤ Add 1 mL of sterile water, shake and wash for 2 min, collect the seeds, and repeat 5 times.

[0038] ⑥ Seeds were sown in 1 / 2MS medium containing Kan; Genomic PCR testing Arabidopsis leaf DNA was extracted using a kit (LabHelper). Wild-type Arabidopsis leaf DNA was used as a negative control, and VvPUB24-pCAMBIA2300 plasmid DNA was used as a positive control. PCR detection was performed using specific primers VvPUB24-430-F and VvPUB24-430-R.

[0039] VvPUB24-430-F:GCTTTAGGCTGCGAGACCGAC VvPUB24-430-R:GTGCTCGATCGTCAGTCGTG; Detection of drought resistance of transgenic plants Four-week-old wild-type and transgenic Arabidopsis overexpressing the VvPUB24 gene were used for drought stress experiments. The experimental plants were watered thoroughly on day 0 and then no longer watered. After 28 days of treatment, the phenotypic changes of wild-type and transgenic Arabidopsis plants were observed. Before drought treatment, the growth conditions of wild-type and transgenic Arabidopsis were similar. After 28 days of drought stress, the leaves of transgenic Arabidopsis were severely yellowed and wilted, while the leaves of wild-type plants only showed slight yellowing ( Figure 5). This indicates that overexpression of the VvPUB24 gene reduces the drought resistance of Arabidopsis plants. The present invention proves that the VvPUB24 gene negatively regulates plant drought resistance, and in the future, drought-resistant grape varieties can be cultivated by silencing or editing the VvPUB24 gene.

[0040] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A grape drought-sensitive gene VvPUB24, characterized in that: The gene coding region sequence is shown in SEQ ID NO:

1.

2. The grape drought-sensitive gene VvPUB24 according to claim 1, characterized in that Its amino acid sequence is shown in SEQ ID NO:

2.

3. Use of the grape drought-sensitive gene according to claim 1 in improving the resistance of grapes under drought stress.

Images