A method of genetic transformation suitable for poa pratia

By using the genetic transformation method of Kentucky bluegrass stem segments, and utilizing specific culture media and Agrobacterium infection, the problem of instability in the Kentucky bluegrass genetic transformation system was solved, and efficient Kentucky bluegrass variety improvement was achieved.

CN119842795BActive Publication Date: 2026-07-31QIQIHAR UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
QIQIHAR UNIVERSITY
Filing Date
2025-02-06
Publication Date
2026-07-31

AI Technical Summary

Technical Problem

Existing technologies lack efficient and stable genetic transformation systems for Kentucky bluegrass, and research mainly focuses on the regeneration induction of explants, making it difficult to achieve efficient genetic improvement of Kentucky bluegrass.

Method used

Using Kentucky bluegrass stem segments as the infection target, and employing differentiation and antibacterial media of specific concentrations, combined with Agrobacterium infection and resistance selection media, the genetic transformation cycle was shortened, and the differentiation rate and positive transformation rate of regenerated seedlings were improved.

Benefits of technology

It significantly shortened the genetic transformation cycle, improved the regeneration seedling differentiation rate and genetic transformation success rate of Kentucky bluegrass, and provided an efficient and stable genetic transformation method to support the high-quality improvement of Kentucky bluegrass varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119842795B_ABST
    Figure CN119842795B_ABST
Patent Text Reader

Abstract

This invention relates to a genetic transformation method for Kentucky bluegrass, belonging to the field of biotechnology. To address the lack of efficient and stable genetic transformation systems for Kentucky bluegrass in existing technologies, this invention provides a genetic transformation method suitable for Kentucky bluegrass. This method directly infects stem segments, which can directly differentiate into regenerated seedlings, shortening the experimental cycle of genetic transformation and increasing the differentiation rate of regenerated seedlings. This invention utilizes differentiation, antibacterial, and resistance screening media with specific mass concentrations, and limits the infection time of Agrobacterium and the age of sterile seedlings, thereby obtaining a genetic transformation method with high antibacterial rate, differentiation rate, and positive transformation rate. The Kentucky bluegrass genetic transformation method provided by this invention is characterized by high efficiency and stable transformation, and can be applied to the genetic transformation of Kentucky bluegrass to obtain high-quality new varieties and trait improvements.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a genetic transformation method suitable for Kentucky bluegrass. Background Technology

[0002] Kentucky bluegrass ( Poa pratensis Kentucky bluegrass (L.) is a cool-season turfgrass, prized for its graceful form and strong cold and trampling resistance, making it commonly used for lawn establishment in northern urban landscaping. However, Kentucky bluegrass is susceptible to adverse conditions such as drought and salinity, affecting its growth and ornamental value. These traits can be improved to some extent through gene transformation. Genetic transformation technology can edit key genes to precisely improve varietal traits, cultivating high-quality, high-yielding, and multi-resistant new varieties. However, current research on Kentucky bluegrass genetic transformation systems is relatively limited, and studies mainly focus on explant regeneration induction.

[0003] Therefore, those skilled in the art can develop an efficient and stable genetic transformation system suitable for Kentucky bluegrass. Summary of the Invention

[0004] This invention addresses the lack of an efficient and stable genetic transformation system for Kentucky bluegrass in the prior art by providing a genetic transformation method suitable for Kentucky bluegrass.

[0005] One objective of this invention is to provide a genetic transformation method suitable for Kentucky bluegrass, the genetic transformation method comprising the following steps: S1: The seeds of Kentucky bluegrass were sterilized to obtain sterile material. The sterile material was placed in a differentiation medium for differentiation induction culture to obtain sterile seedlings after differentiation induction. S2: Take the stem segments of sterile seedlings aged 4-10 weeks after differentiation induction in S1 as materials, inoculate them in differentiation medium for pre-culture for 1 day, immerse the pre-cultured sterile seedling stem segments in an infection solution containing Agrobacterium for infection, transfer the infected sterile seedling stem segments to differentiation medium for dark culture, and obtain stem segment recipients. S3: The stem segment recipients obtained in S2 were transferred to the antibacterial culture medium and cultured in the dark to obtain regenerated seedlings; S4: The regenerated seedlings obtained in S3 were transferred to a resistance selection medium for culture to obtain successfully genetically transformed Kentucky bluegrass seedlings.

[0006] In a preferred embodiment of the present invention, the aseptic treatment step in S1 is as follows: remove the seed coat of Kentucky bluegrass seeds, soak them in 75% ethanol solution for 3 min, rinse them with sterile water 3-5 times, then soak them in 1% sodium hypochlorite solution for 5 min, and rinse them with sterile water 5-6 times after soaking.

[0007] In a preferred embodiment of the present invention, the differentiation medium in S1 comprises the following components in mass concentration: MS medium 4.4~4.6 g / L, 2,4-D 0.1~0.3 mg / L, 6-BA 1.0~1.4 mg / L, IBA 0.1~0.3 mg / L, sucrose 30~32 g / L and agar 7.0~7.2 g / L, pH=6.0.

[0008] In a preferred embodiment of the present invention, the Agrobacterium in S2 is Agrobacterium tumefaciens or Agrobacterium rhizogenes.

[0009] In a preferred embodiment of the present invention, the Agrobacterium contains an overexpression vector capable of expressing the target gene.

[0010] In a preferred embodiment of the present invention, the infection solution in S2 comprises the following components by mass concentration: 2.2-2.4 g / L of 1 / 2 MS medium and 30-32 g / L of sucrose; the infection time is 8-10 min.

[0011] In a preferred embodiment of the present invention, the dark culture time in S2 is 2-3 days.

[0012] In a preferred embodiment of the present invention, the antibacterial culture medium in S3 comprises the following components in mass concentration: MS medium 4.4~4.6 g / L, 2,4-D 0.1~0.3 mg / L, 6-BA 1.0~1.4 mg / L, IBA 0.1~0.3 mg / L, Timentin 200~400 mg / L, sucrose 30~32 g / L and agar 7.0~7.2 g / L, pH=6.0.

[0013] In a preferred embodiment of the present invention, the resistance screening medium in S4 comprises the following components in mass concentration: MS medium 4.4~4.6 g / L, 2,4-D 0.1~0.3 mg / L, 6-BA 1.0~1.4 mg / L, IBA 0.1~0.3 mg / L, Timentin 200~400 mg / L, hygromycin 25~35 mg / L, sucrose 30~32 g / L and agar 7.0~7.2 g / L, pH=6.0.

[0014] In a preferred embodiment of the present invention, the cultivation conditions are as follows: daytime temperature 25°C, nighttime temperature 15°C, relative humidity 60%, and light intensity 600 μmol·m⁻¹. -2 ·s -1 The culture time for one day includes 16 hours of light culture and 8 hours of dark culture.

[0015] The beneficial effects of this invention are as follows: This invention provides a genetic transformation method suitable for Kentucky bluegrass. This method directly infects stem segments, which can then directly differentiate into regenerated seedlings. In contrast, existing genetic transformation methods for Kentucky bluegrass use callus tissue differentiated from seeds as the infection target, and then the callus tissue differentiates into regenerated seedlings. Compared to existing methods that directly transform from sterile seedlings to plants, the genetic transformation method provided by this invention reduces the process of first transforming from sterile seedlings to callus tissue and then to plants. The experimental cycle of the genetic transformation method provided by this invention is 2-3 months, significantly shortening the experimental cycle and improving the differentiation rate of regenerated seedlings.

[0016] This invention utilizes differentiation and antibacterial media with specific concentrations, and limits the infection time of Agrobacterium and the age of sterile seedlings, to achieve a genetic transformation method suitable for Kentucky bluegrass with high inhibition and differentiation rates. Simultaneously, the use of resistance selection media with specific concentrations improves the positive transformation rate of this method, providing support for the precise improvement of Kentucky bluegrass varietal traits and the breeding of high-quality, high-yielding, and multi-resistant new varieties. Therefore, the Kentucky bluegrass genetic transformation method provided by this invention is characterized by high efficiency and stable transformation, and can be applied to the genetic transformation of Kentucky bluegrass to obtain high-quality new varieties and trait improvements. Attached Figure Description

[0017] Figure 1 A schematic diagram showing the differentiation of stem segments of five Kentucky bluegrass varieties, namely “Miracle”, “Kentucky”, “Elegant”, “Jenny”, and “Happy”, in an antibacterial culture medium at 0d, 7d, 14d, and 21d after infection. Figure 2 A is a schematic diagram of the Kentucky bluegrass regenerated seedling culture in Example 1; A is a schematic diagram of the differentiation of Kentucky bluegrass regenerated seedlings after 0d, 10d and 20d of antibacterial culture; B is a schematic diagram of the regenerated seedlings after antibacterial culture being transferred to the resistance selection medium for 0d and 20d of culture. Figure 3 The image shows the DNA detection results of transgenic positive Kentucky bluegrass seedlings after genetic transformation in Example 1; where M represents DL 2000 DNA Marker (bp), lanes 1-2 are the CK control group, and lanes 3-10 are the amplification results of the target gene. Detailed Implementation

[0018] Those skilled in the art can refer to the content of this document and appropriately improve the process parameters to achieve the desired results. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments, and those skilled in the art can obviously make modifications or appropriate alterations and combinations to the methods and applications described herein without departing from the content and scope of this invention to implement and apply the technology of this invention.

[0019] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, and the materials, reagents, methods, and instruments used are all conventional materials, reagents, methods, and instruments in the art, which can be obtained commercially by those skilled in the art.

[0020] Example 1: A genetic transformation method suitable for Kentucky bluegrass S1: Remove the seed coat from Kentucky bluegrass "Miracle" seeds, soak them in 75% ethanol solution for 3 min, rinse 3-5 times with sterile water, then soak them in 1% sodium hypochlorite solution for 5 min. After soaking, rinse 5-6 times with sterile water to obtain sterile material. Place the above sterile material in differentiation medium for differentiation induction culture. The culture conditions are: daytime / nighttime temperature 25℃ / 15℃, relative humidity 60%, light / dark culture time 14 h / 10 h, and light intensity 600 μmol·m⁻¹. -2 ·s -1 To obtain sterile seedlings after differentiation induction; The differentiation medium contains the following components at the following mass concentrations: MS medium 4.4 g / L, 2,4-D 0.2 mg / L, 6-BA 1.0 mg / L, IBA 0.2 mg / L, sucrose 30 g / L and agar 7.2 g / L, pH=6.0, autoclaved at 121℃ for 20 min; S2: Take the 1.5 cm stem segment from the base of the 10-week-old sterile seedlings after differentiation induction in S1 as material, inoculate it in the differentiation medium for pre-culture for 1 day, and immerse the sterile seedling stem segments with good growth after pre-culture in the infection solution containing positive Agrobacterium tumefaciens colonies for 8 min for infection. Take out the infected sterile seedling stem segments, wipe the surface bacterial solution with sterile filter paper, transfer them to the differentiation medium for dark culture for 2 days to obtain stem segment recipients; The preparation method of Agrobacterium is as follows: thaw Agrobacterium GV3101 competent cells on ice, then add 3 μg of plasmid DNA, mix by hand by tapping the bottom of the tube, and incubate sequentially on ice for 5 min, in liquid nitrogen for 5 min, in a 37℃ water bath for 5 min, and in an ice bath for 5 min; then add 700 μL of antibiotic-free LB medium, and culture with shaking at 28℃ and 200 rpm for 2-3 hours; centrifuge at 6000 rpm for 1 min; take 100 μL of the above supernatant and gently resuspend the bacterial block by pipetting, spread the reconstituted bacterial cells on LB plates containing 20 mg / L kanamycin and rifampin, and incubate upside down at 28℃. After the growth of single-clone strains, use PCR to identify the resistance gene and preserve positive Agrobacterium tumefaciens colonies; The method for preparing the infection solution containing positive Agrobacterium tumefaciens colonies is as follows: Agrobacterium tumefaciens colonies are cultured in 20 ml of liquid LB medium for 16 h, centrifuged at 4000 rpm for 10 min, and after removing the supernatant, 20 ml of sterilized infection solution is added. The infection solution comprises the following components at the following mass concentrations: 2.4 g / L 1 / 2 MS medium and 30 g / L sucrose. The 1 / 2 MS medium was purchased from Hangzhou Mobaite Biotechnology Co., Ltd. The mixture is thoroughly mixed and activated on a shaker at 200 rpm for 1 h to obtain the infection solution containing positive Agrobacterium tumefaciens colonies. S3: The stem segment recipients obtained in S2 were transferred to an antibacterial culture medium and cultured in the dark to obtain regenerated seedlings, such as... Figure 1 As shown; the antibacterial culture medium contains the following components at the following mass concentrations: MS medium 4.4 g / L, 2,4-D 0.2 mg / L, 6-BA 1.0 mg / L, IBA 0.2 mg / L, Timentin 400 mg / L, sucrose 30 g / L and agar 7.2 g / L, pH=6.0, autoclaved at 121℃ for 20 min; S4: The regenerated seedlings from S3, after 21 days of antibacterial culture, were transferred to a resistance selection medium for further culture to obtain genetically transformed Kentucky bluegrass seedlings. These seedlings were then cultured in the resistance selection medium to obtain genetically transformed Kentucky bluegrass seedlings. Figure 2 As shown; The resistance screening medium contains the following components at the following mass concentrations: MS medium 4.4 g / L, 2,4-D 0.2 mg / L, 6-BA 1.0 mg / L, IBA 0.2 mg / L, Timentin 400 mg / L, hygromycin 30 mg / L, sucrose 30 g / L and agar 7.2 g / L, pH=6.0, autoclaved at 121℃ for 20 min.

[0021] In this embodiment, total DNA from the genetically transformed Kentucky bluegrass seedlings was used as a template. PCR detection was performed using hpt557-F (nucleotide sequence shown in SEQ ID NO.1: ACACTACATGGCGTGATTTCAT) and hpt557-R (nucleotide sequence shown in SEQ ID NO.2: TCCACTATCGGCGAGTACTTCT) as primers. The results are as follows: Figure 3 As shown, the Kentucky bluegrass seedlings obtained by the above genetic transformation method successfully obtained a 557 bp target fragment, indicating that the genetic transformation method provided by the present invention can successfully transform the overexpression vector expressing the target gene into Kentucky bluegrass seedlings.

[0022] Example 2: The difference between this embodiment and embodiment 1 is that in S2, a 1.5 cm stem segment from the base of a 4-week-old sterile seedling after differentiation induction is used as the material; the remaining steps are the same as in embodiment 1.

[0023] Comparative Example 1: The difference between this comparative example and Example 1 is that the Kentucky bluegrass seeds mentioned in S1 are Kentucky bluegrass seeds; the remaining steps are the same as in Example 1.

[0024] Comparative Example 2: The difference between this comparative example and Example 1 is that the Kentucky bluegrass seeds described in S1 are of the same variety as in Example 2; the remaining steps are the same as in Example 2.

[0025] Comparative Example 3: The difference between this comparative example and Example 1 is that the Kentucky bluegrass seeds mentioned in S1 are Jenny; the remaining steps are the same as in Example 1.

[0026] Comparative Example 4: The difference between this comparative example and Example 1 is that the Kentucky bluegrass seeds mentioned in S1 are Lesotho; the remaining steps are the same as in Example 1.

[0027] Comparative Example 5: The difference between this comparative example and Example 1 is that the differentiation medium described in S1 contains the following components at the following mass concentrations: MS medium 4.4 g / L, 2,4-D 0.4 mg / L, 6-BA 2.0 mg / L, IBA 0.4 mg / L, sucrose 30 g / L and agar 7.2 g / L, pH=6.0, autoclaved at 121°C for 20 min; the remaining steps are the same as in Example 1.

[0028] Comparative Example 6: The difference between this comparative example and Example 1 is that the differentiation medium described in S1 contains the following components at the following mass concentrations: MS medium 4.4 g / L, 2,4-D 0.2 mg / L, 6-BA 2.0 mg / L, IBA 0.2 mg / L, sucrose 30 g / L and agar 7.2 g / L, pH=6.0, autoclaved at 121°C for 20 min; the remaining steps are the same as in Example 1.

[0029] Comparative Example 7: The difference between this comparative example and Example 1 is that the differentiation medium described in S1 contains the following components at the following mass concentrations: MS medium 4.4 g / L, 2,4-D 0.2 mg / L, 6-BA 2.0 mg / L, sucrose 30 g / L and agar 7.2 g / L, pH=6.0, autoclaved at 121°C for 20 min; the remaining steps are the same as in Example 1.

[0030] Comparative Example 8: The difference between this comparative example and Example 1 is that the antibacterial culture medium described in S3 contains the following components at the following mass concentrations: MS medium 4.4 g / L, 2,4-D 0.4 mg / L, 6-BA 2.0 mg / L, IBA 0.4 mg / L, Timentin 400 mg / L, sucrose 30 g / L and agar 7.2 g / L, pH=6.0, autoclaved at 121℃ for 20 min; the remaining steps are the same as in Example 1.

[0031] Comparative Example 9: The difference between this comparative example and Example 1 is that the infection treatment time in S2 is 12 min; the remaining steps are the same as in Example 1.

[0032] Comparative Example 10: The difference between this comparative example and comparative example 9 is that the antibacterial culture medium described in S3 contains the following components at the following mass concentrations: MS medium 4.4 g / L, 2,4-D 0.4 mg / L, 6-BA 2.0 mg / L, IBA 0.4 mg / L, Timentin 400 mg / L, sucrose 30 g / L and agar 7.2 g / L, pH=6.0, autoclaved at 121℃ for 20 min; the remaining steps are the same as those in comparative example 9.

[0033] Effect Experiment: (1) Effects of different varieties of Kentucky bluegrass seeds on genetic transformation In Example 1 and Comparative Examples 1-4 of this invention, five varieties of Kentucky bluegrass, namely “Miracle”, “Kentucky”, “Elegant”, “Jenny”, and “Happy”, were genetically transformed. The stem segment recipients obtained in S2 of Example 1 and Comparative Examples 1-4 were transferred to antibacterial culture medium, and the differentiation was observed and statistically analyzed at 0 d, 7 d, 14 d, and 21 d.

[0034] Differentiation rate = (Number of regenerated seedlings / Number of inoculated seedlings) × 100% The results are as follows Figure 1 As shown, the "Miracle" variety of Kentucky bluegrass exhibited the fastest and best differentiation rate of its stem segment receptors when cultured in an antibacterial medium for 21 days.

[0035] The results are shown in Table 1. There were significant differences in the differentiation effect of different varieties of Kentucky bluegrass seeds. When the seeds of the "Miracle" variety of Kentucky bluegrass were used as raw materials to prepare sterile seedlings, the differentiation rate was the highest and the effect was the best.

[0036] Table 1

[0037] (2) The effect of aseptic seedlings of different ages on the genetic transformation effect In Examples 1 and 2 of this invention, sterile seedling stem segments of different ages were used as materials. The genetic transformation method provided by this invention was used to transform Kentucky bluegrass seedlings, and the differentiation rate of the above genetic transformation results was statistically analyzed.

[0038] Differentiation rate = (Number of regenerated seedlings / Number of inoculated seedlings) × 100% The results are shown in Table 2. When using 10-week-old sterile seedling stem segments as material, the differentiation rate of Kentucky bluegrass seedlings obtained by the genetic transformation method provided by this invention increased by 4.72% compared with those using 4-week-old sterile seedling stem segments as material. It can be seen that the genetic transformation effect is better when using 10-week-old sterile seedling stem segments as material.

[0039] Table 2

[0040] (3) Effects of different composition ratios of differentiation culture media on the genetic transformation effect of Kentucky bluegrass In Examples 1 and Comparative Examples 5-7 of this invention, differentiation culture media with different composition ratios were used to induce Kentucky bluegrass seedlings using the genetic transformation method provided by this invention, and the differentiation rate of the above genetic transformation results was statistically analyzed.

[0041] Differentiation rate = (Number of regenerated seedlings / Number of inoculated seedlings) × 100% The results are shown in Table 3. Compared with the genetic transformation method provided by this invention, Comparative Examples 5-7 increased the content of 2,4-D in the differentiation medium to 0.4 mg / L, 6-BA to 2.0 mg / L, and IBA to 0.4 mg / L, respectively, and did not add IBA to the differentiation medium; the genetic transformation results showed that the differentiation rate was reduced by 2.78%-16.67%, respectively. It can be seen that the genetic transformation effect using the differentiation medium provided by this invention is the best, and the differentiation rate can reach 80.56%.

[0042] Table 3

[0043] (4) Effects of different infection times on the genetic transformation of Kentucky bluegrass In Example 1 and Comparative Example 9 of this invention, Kentucky bluegrass seedlings were induced by setting different infection times and using the genetic transformation method provided by this invention. The differentiation rate and inhibition rate of the above genetic transformation results were statistically analyzed.

[0044] Differentiation rate = (Number of regenerated seedlings / Number of inoculated seedlings) × 100% Inhibition rate = (Number of successfully inhibited seedlings / Number of infected seedlings) × 100% The results are shown in Table 4. When the infection time was 8 min and 12 min, the genetic transformation results showed that the differentiation rate of Kentucky bluegrass seedlings was significantly reduced with the extension of infection time, but the inhibition rate of Kentucky bluegrass seedlings was less affected.

[0045] Table 4

[0046] (5) The combined effects of different composition ratios of antibacterial culture media and different infection times on the genetic transformation effect of Kentucky bluegrass. The effects of different composition ratios of antibacterial culture media in Example 1 and Comparative Example 8, different infection times in Example 1 and Comparative Example 9, and different composition ratios of antibacterial culture media and different infection times in Example 1 and Comparative Example 10 on the genetic transformation effect of Kentucky bluegrass were investigated. Kentucky bluegrass seedlings were induced using the genetic transformation method provided by the present invention, and the differentiation rate and inhibition rate of the above genetic transformation results were statistically analyzed.

[0047] Differentiation rate = (Number of regenerated seedlings / Number of inoculated seedlings) × 100% Inhibition rate = (Number of successfully inhibited seedlings / Number of infected seedlings) × 100% The results are shown in Table 5. Compared with the infection time of 8 min in Example 1, the content of 2,4-D in the antibacterial medium in Comparative Example 8 was increased to 0.4 mg / L, the content of 6-BA was increased to 2.0 mg / L, and the content of IBA was increased to 0.4 mg / L. The genetic transformation results showed that, compared with Example 1, the genetic transformation method using the antibacterial medium in Comparative Example 8 reduced the differentiation rate of Kentucky bluegrass seedlings by 16.68% and the inhibition rate by 4.3%.

[0048] Compared with the infection time of 8 min in Example 1, the genetic transformation method used in Comparative Example 9, with an infection time of 12 min, reduced the differentiation rate of Kentucky bluegrass seedlings by 13.89% and the inhibition rate by 1.32%.

[0049] Compared with Example 1, the combined genetic transformation effects of different composition ratios of antibacterial culture media and different infection times in Comparative Example 10 showed that the genetic transformation method used in Comparative Example 10 reduced the differentiation rate of Kentucky bluegrass seedlings by 41.64% and the inhibition rate by 12.64%. It can be seen that by using the antibacterial culture media and infection time provided by the present invention, the differentiation rate and inhibition rate of Kentucky bluegrass seedlings can be maximized, and the above-mentioned antibacterial culture media and infection time have a synergistic effect.

[0050] Table 5

[0051] The contents not described in detail in this specification are well-known to those skilled in the art. Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the invention. Therefore, the scope of protection of the present invention should be defined by the claims.

Claims

1. A genetic transformation method suitable for Kentucky bluegrass, characterized in that, The genetic transformation method includes the following steps: S1: The seeds of Kentucky bluegrass were sterilized to obtain sterile material. The sterile material was placed in a differentiation medium for differentiation induction culture to obtain sterile seedlings after differentiation induction. S2: Take 4 portions of the product after differentiation induction in S1. Stem segments of 10-week-old sterile seedlings were used as materials. They were inoculated in differentiation medium and pre-cultured for 1 day. The pre-cultured sterile seedling stem segments were then immersed in an infection solution containing Agrobacterium for infection. The infected sterile seedling stem segments were then transferred to differentiation medium for dark culture to obtain stem segment recipients. S3: The stem segment recipients obtained in S2 were transferred to the antibacterial culture medium and cultured in the dark to obtain regenerated seedlings; S4: The regenerated seedlings obtained in S3 were transferred to a resistance selection medium for culture to obtain genetically transformed Kentucky bluegrass seedlings; The differentiation medium described in S1 comprises the following components at the following mass concentrations: MS medium 4.4–4.6 g / L, 2,4 D 0.1~0.3mg / L, 6 BA 1.0~1.4 mg / L, IBA 0.1~0.3 mg / L, sucrose 30~32 g / L and agar 7.0~7.2 g / L, pH=6.0; The antibacterial culture medium described in S3 comprises the following components at mass concentrations: MS medium 4.4~4.6 g / L, 2,4 D 0.1~0.3mg / L, 6 BA 1.0~1.4 mg / L, IBA 0.1~0.3 mg / L, Timentin 200~400 mg / L, sucrose 30~32 g / L and agar 7.0~7.2 g / L, pH=6.0; The resistance screening medium described in S4 comprises the following components at the following mass concentrations: MS medium 4.4–4.6 g / L, 2,4 D 0.1~0.3 mg / L, 6 BA 1.0~1.4 mg / L, IBA 0.1~0.3 mg / L, Timentin 200~400 mg / L, Hygromycin 25~35 mg / L, Sucrose 30~32 g / L and Agar 7.0~7.2 g / L, pH=6.

0.

2. The genetic transformation method according to claim 1, characterized in that, The aseptic treatment steps described in S1 are as follows: remove the seed coat from Kentucky bluegrass seeds, soak them in a 75% ethanol solution for 3 minutes, and rinse them with sterile water for 3 minutes. Repeat 5 times, then soak in a 1% sodium hypochlorite solution for 5 minutes. After soaking, rinse 5 times with sterile water. 6 times.

3. The genetic transformation method according to claim 1, characterized in that, The Agrobacterium mentioned in S2 is Agrobacterium tumefaciens or Agrobacterium rhizogenes.

4. The genetic transformation method according to claim 3, characterized in that, The Agrobacterium contains an overexpression vector capable of expressing the target gene.

5. The genetic transformation method according to claim 1, characterized in that, The infection solution described in S2 comprises the following components at the following mass concentrations: 2.2–2.4 g / L of 1 / 2 MS medium and 30–32 g / L of sucrose; the infection time is 8 hours. 10 min.

6. The genetic transformation method according to claim 1, characterized in that, The dark incubation time mentioned in S2 is 2. 3 d.

7. The genetic transformation method according to claim 1, characterized in that, The cultivation conditions were as follows: daytime temperature 25℃, nighttime temperature 15℃, relative humidity 60%, and light intensity 600 μmol·m⁻¹. 2 ·s 1 The culture time for one day includes 16 hours of light culture and 8 hours of dark culture.